1. Launch What are some differences between autosomal and sex-linked traits? The offspring of two individuals produce 775 children with a dominant phenotype and 236 children…

Chapter 10: Molecular Biology of the Gene PAGE 1 DNA â Structure, Replication, Transcription, and Translation: Molecular Biology of the Gene DNA RNA The three main parts…

Honors Biology 2nd Semester Final Exam Review Remember that the Final is cumulative and covers the entire course. However, the emphasis is on Second Semester material. Part…

1. DNA: deoxyribonucleic acid • Chemical compound that passes hereditary information from generation to generation • Where is DNA found in Eukaryotic cells? (plant, animal,…

Slide 1PROTEIN SYNTHESIS Or…how our bodies make proteins! Slide 2 What do these Chinese symbols say? Transcribe to English alphabet: Translate to English words: Slide 3…

Slide 1 Warm Up: (11_5) ATGCGTCGT What is the complementary DNA strand? Based on this complementary strand what would the mRNA strand be? Slide 2 Make your mRNAs! You are…

Slide 1 Slide 2 Identify the structures labeled I, II, III, IV and V Slide 3 AUGCCUAUUGAUGGCCCAUAAGUU How would a change in the sequence of nucleotides in a DNA molecule…

Slide 1 Decoding DNA Worksheet Objective: Be able to use the codon chart. Be able to interprete tables. Slide 2 Complete the table below: DNA CAT mRNA codon Anticodon tRNA…

Slide 1 DNA, RNA and Protein Synthesis TAKS Review Slide 2 Structure of DNA DNA is deoxyribonucleic acid DNA is a large molecule that has subunits called nucleotides. The…

Slide 1 TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1 Slide 2 Central Dogma DNA mRNA Proteins Traits Slide 3 DNA vs. RNA Review  DNA  Double stranded  Made up…