Warm Up: (11_5) ATGCGTCGT What is the complementary DNA strand? Based on this complementary strand what would the mRNA strand be?
Dec 18, 2015
Warm Up: (11_5)
ATGCGTCGT
What is the complementary DNA strand?
Based on this complementary strand what would the mRNA strand be?
Make your mRNAs!
• You are just making nucleotides!!! Do not link nucleotides together!
DNA to Protein Translation
• Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes
DNA to Protein Translation
• Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes– tRNA contains an anticodon: three nucleotides on
the tRNA that are complementary (match up with) the mRNA
DNA to Protein Translation
• Initiation: The mRNA, ribosome and tRNA’s get together with the help of enzymes– The start codon (methionine) is the first to go
through
DNA to Protein Translation
• Elongation: A polypeptide chain is formed. – tRNA’s with the proper anticodon match up with
the mRNA. – They move through the ribosome,
DNA to Protein Translation
• Termination – Process stops when a stop codon is reached
DNA to Protein Translation
Termination – Process stops when a stop codon is reached
Disassembly Polypeptide (protein) is released as the three types of RNA separate
Protein Synthesis Videos
• https://www.youtube.com/watch?v=nHM4UUVHPQM
• https://www.youtube.com/watch?v=D3fOXt4MrOM
Reading a codon chart!
Use the Codon Chart to make the amino acid sequence
mRNA: AUG-CCA-GAU-GGA-UAA
DNA: TAC-CCG-GAT-GGG-ATC
Translation Practice Problems
1. What is a codon? What is an anticodon?2. How many amino acids are there?3. What three types of RNA are involved in translation, what
function does each play? 4. What is a polypeptide chain? What does it eventually turn into? 5. Explain how tRNA assists in building a protein 6. Explain how protein production is stopped.
7. Transcribe the following DNA Template strand to mRNA 3’ TACAATAGGGTCTCAGCACGCCCCATT 5’. Then decode the anti-codon sequence (hint: you need to use your mRNA sequence for
this). Last, translate the mRNA sequence to an amino acid sequence
Process: Where is this process located
(assuming eukaryote
cell)?
Is DNA directly involved in
process?
Which types of RNA are
involved?
End Result and Purpose
Transcription 1. 2. 3. 4.
Translation 5. 6. 7. 8.
Lets Practice Translation
• Take your mRNA strand and translate it! – Use the transfer RNA anticodons as a check
– If you cannot find the amino acid you are looking for you may have made a mistake….
Show Ms. Spencer the process when you have completed it!
Codon Bingo (Can Repeat!!!!)1. alanine 2. glutamate 3. leucine 4. serine 5. arginine 6. glutamine 7. lysine 8. tryptophan 9. asparagines 10.glycine 11.methionine
12.tyrosine 13.aspartate 14.histidine 15.phenylalanine 16.threonine 17.cysteine 18.isoleucine 19.proline 20.valine 21.stop
DNA ReplicationThink – Pair – Share
When do cells need to replicate their DNA?
DNA ReplicationThink – Pair – Share
When do cells need to replicate their DNA?
Cell Division! Prokaryotes: Binary Fission
Eukaryotes: Mitosis and Meiosis
DNA Replication 1. Helicases separate DNA strands, this creates
a replication fork
DNA Replication 1. Helicases separate DNA strands 2. DNA polymerase adds complementary
nucleotides to the strand
DNA Replication
1. Helicases separate DNA strands 2. DNA polymerase adds complementary
nucleotides to the strand 3. DNA polymerase finishes replicating and
falls off, two separate DNA molecules result
DNA Replication 1. Helicases separate DNA strands 2. DNA polymerase adds complementary
nucleotides to the strand 3. DNA polymerase finishes replicating and
falls off, two separate DNA molecules result 4. Each new DNA has one original DNA strand
and one new DNA strand, this is called semi-conservative replication
DNA is made in the 5’ to 3’ direction • That means that the leading stand can
copy uniformly, the lagging strand is copied in segments, these segments are called Okazaki fragments
DNA Replication 1. Helicases separate DNA strands, this creates
a replication fork
DNA Replication Videos https://www.youtube.com/watch?v=27TxKoFU2Nw
https://www.youtube.com/watch?v=5qSrmeiWsuc
https://www.youtube.com/watch?v=dKubyIRiN84
https://www.youtube.com/watch?v=5qSrmeiWsuc
Okazaki Fragments: https://www.youtube.com/watch?v=TEQMeP9GG6M