YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

• prepare foreign (target) DNA

• prepare vector (host)• recombine target and

vector DNA• introduce rDNA to host• screen for DNA of

interest

Recombinant DNAgDNA (fragments)

cDNA (copy of RNA)

Preparing gDNA• restriction enzymes• ‘random nuclease’ size fractionate

Page 2: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

gDNA vs cDNA

• level of expression• differential gene expression• accessibility

• introns• complicates gDNA analysis• can preclude expression

• ease of preparation• cDNA more work

Page 3: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Preparation of cDNA1) Isolate mRNA2) Synthesize DNA-RNA hybrid

•reverse transcriptase•oligo-dT primer•random priming

3) Synthesize 2nd DNA strand4) Add termini

RNA dependent DNA polymerase

Page 4: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

1) Isolate mRNA2) Synthesize DNA-RNA

hybrid3) Synthesize 2nd DNA

strand• self-priming• replacement

synthesis• primed synthesis

4) Add termini

Page 5: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

1) Isolate mRNA2) Synthesize DNA-RNA

hybrid3) Synthesize 2nd DNA

strand4) Add termini

• i.e., linkers

CGGAATTCCGGCCTTAAGGC Eco RI

Page 6: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Recombinant DNA Vectors

Plasmids

• extra-chromosomal elements• 1-200 kb size range• transmitted during conjugation• antibiotic resistance• low copy number vs high copy number

• autonomously-replicating DNA used to ‘carry’ and amplify foreign DNA within host cell

• eg: plasmids, phage/viruses, or combinations

Page 7: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Useful Plasmid Features

•Relaxed Replication•Selectable Markers•Streamlined•Polylinker or MCS• Identification of Recombinants

•most derived from pUC or pBR322

|SacI| |ScII| |XbaI||SpeI||BamH||SmaI||PstI||EcRI||EcRV||HIII||ClaI| |SalI||XhoI| |KpnI|GAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTCCTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGG

Multiple Cloning Site:

Page 8: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

• prepare foreign DNA• prepare vector• ligate foreign DNA and vector• introduce vector into host• screen for rDNA of interest

Generic rDNA Protocol

Page 9: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

• mix foreign and vector DNA in presence of DNA ligase• optimal ratios of vector to insert generally

1.5-2:1• intermolecular base-pairing can occur

between compatible overhangs

Ligation Reaction

Page 10: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

• catalyzes the formation of phosphodiester bond between 5’-PO4 and 3’-OH• i.e., joins DNA fragments

• typically carried out at lower temperatures (8-16o) for extended periods

DNA Ligase

Page 11: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Intramolecular vs. Intermolecular

Page 12: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Removal of 5’-PO4 Prevents Vector Self Ligation

Page 13: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

TERMINICLONINGREQUIREMENTS COMMENTS

IdenticalOverhangs

Phosphatase treatment oflinear plasmid improvesefficiency.

Restriction sites at junctions preserved.Both orientations of insert DNA possible.Tandem copies of insert possible.

Blunt-endHigh concentrations of DNAand ligase needed.Phosphatase treatment.

Restriction sites at junctions ofteneliminated. Tandem copies of insert DNApossible. Both orientations possible.

DifferentOverhangs

Purification of double-cutplasmid increasesefficiency.

Restriction sites at junctions preserved.Background of non-recombinants is low.One possible orientation of insert. Tandemcopies unlikely.

Page 14: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

• prepare foreign DNA• prepare vector• ligate target and vector• introduce rDNA to host

• heat shock + Ca2+

• electroporation• select for transformants

with antibiotic• screen for rDNA of

interest

Page 15: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Colony LiftSources of Probes• cloned genes• synthetic

oligonucleotides• PCR products

Page 16: Prepare foreign (target) DNA prepare vector (host) recombine target and vector DNA introduce rDNA to host screen for DNA of interest Recombinant DNA gDNA.

Identifying Recombinants• based on interruption of a gene

• eg., lacZ gene = -galactosidase• intact -galactosidase produces

blue color in presence of X-gal-complementation or blue-

white screening


Related Documents