Page 1
• prepare foreign (target) DNA
• prepare vector (host)• recombine target and
vector DNA• introduce rDNA to host• screen for DNA of
interest
Recombinant DNAgDNA (fragments)
cDNA (copy of RNA)
Preparing gDNA• restriction enzymes• ‘random nuclease’ size fractionate
Page 2
gDNA vs cDNA
• level of expression• differential gene expression• accessibility
• introns• complicates gDNA analysis• can preclude expression
• ease of preparation• cDNA more work
Page 3
Preparation of cDNA1) Isolate mRNA2) Synthesize DNA-RNA hybrid
•reverse transcriptase•oligo-dT primer•random priming
3) Synthesize 2nd DNA strand4) Add termini
RNA dependent DNA polymerase
Page 4
1) Isolate mRNA2) Synthesize DNA-RNA
hybrid3) Synthesize 2nd DNA
strand• self-priming• replacement
synthesis• primed synthesis
4) Add termini
Page 5
1) Isolate mRNA2) Synthesize DNA-RNA
hybrid3) Synthesize 2nd DNA
strand4) Add termini
• i.e., linkers
CGGAATTCCGGCCTTAAGGC Eco RI
Page 6
Recombinant DNA Vectors
Plasmids
• extra-chromosomal elements• 1-200 kb size range• transmitted during conjugation• antibiotic resistance• low copy number vs high copy number
• autonomously-replicating DNA used to ‘carry’ and amplify foreign DNA within host cell
• eg: plasmids, phage/viruses, or combinations
Page 7
Useful Plasmid Features
•Relaxed Replication•Selectable Markers•Streamlined•Polylinker or MCS• Identification of Recombinants
•most derived from pUC or pBR322
|SacI| |ScII| |XbaI||SpeI||BamH||SmaI||PstI||EcRI||EcRV||HIII||ClaI| |SalI||XhoI| |KpnI|GAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCTCGAGGTGGCGCCACCGCCGGCGAGATCTTGATCACCTAGGGGGCCCGACGTCCTTAAGCTATAGTTCGAATAGCTATGGCAGCTGGAGCTCCCCCCCGGGCCATGG
Multiple Cloning Site:
Page 8
• prepare foreign DNA• prepare vector• ligate foreign DNA and vector• introduce vector into host• screen for rDNA of interest
Generic rDNA Protocol
Page 9
• mix foreign and vector DNA in presence of DNA ligase• optimal ratios of vector to insert generally
1.5-2:1• intermolecular base-pairing can occur
between compatible overhangs
Ligation Reaction
Page 10
• catalyzes the formation of phosphodiester bond between 5’-PO4 and 3’-OH• i.e., joins DNA fragments
• typically carried out at lower temperatures (8-16o) for extended periods
DNA Ligase
Page 11
Intramolecular vs. Intermolecular
Page 12
Removal of 5’-PO4 Prevents Vector Self Ligation
Page 13
TERMINICLONINGREQUIREMENTS COMMENTS
IdenticalOverhangs
Phosphatase treatment oflinear plasmid improvesefficiency.
Restriction sites at junctions preserved.Both orientations of insert DNA possible.Tandem copies of insert possible.
Blunt-endHigh concentrations of DNAand ligase needed.Phosphatase treatment.
Restriction sites at junctions ofteneliminated. Tandem copies of insert DNApossible. Both orientations possible.
DifferentOverhangs
Purification of double-cutplasmid increasesefficiency.
Restriction sites at junctions preserved.Background of non-recombinants is low.One possible orientation of insert. Tandemcopies unlikely.
Page 14
• prepare foreign DNA• prepare vector• ligate target and vector• introduce rDNA to host
• heat shock + Ca2+
• electroporation• select for transformants
with antibiotic• screen for rDNA of
interest
Page 15
Colony LiftSources of Probes• cloned genes• synthetic
oligonucleotides• PCR products
Page 16
Identifying Recombinants• based on interruption of a gene
• eg., lacZ gene = -galactosidase• intact -galactosidase produces
blue color in presence of X-gal-complementation or blue-
white screening