Virus-induced gene silencing in rice using a vector derived from a DNA virus

ORIGINAL ARTICLE

Virus-induced gene silencing in rice using a vector derivedfrom a DNA virus

Arunima Purkayastha • Saloni Mathur •

Vidhu Verma • Shweta Sharma • Indranil Dasgupta

Received: 3 June 2010 / Accepted: 2 September 2010

� Springer-Verlag 2010

Abstract Virus-induced gene silencing (VIGS) is a

method of rapid and transient gene silencing in plants using

viral vectors. A VIGS vector for gene silencing in rice has

been developed from Rice tungro bacilliform virus

(RTBV), a rice-infecting virus containing DNA as the

genetic material. A full-length RTBV DNA cloned as a

partial dimer in a binary plasmid accumulated in rice plants

when inoculated through Agrobacterium (agroinoculation)

within 2 weeks and produced detectable levels of RTBV

coat protein. Deletion of two of the four viral ORFs did not

compromise the ability of the cloned RTBV DNA to

accumulate in rice plants. To modify the cloned RTBV

DNA as a VIGS vector (pRTBV-MVIGS), the tissue-spe-

cific RTBV promoter was replaced by the constitutively

expressed maize ubiquitin promoter, sequences comprising

the tRNA-binding site were incorporated to ensure reverse

transcription-mediated replication, sequences to ensure

optimal context for translation initiation of the viral genes

were added and a multi-cloning site for the ease of cloning

DNA fragments was included. The silencing ability of

pRTBV-MVIGS was tested using the rice phytoene

desaturase (pds) gene on rice. More than half of the

agroinoculated rice plants showed white streaks in leaves

within 21 days post-inoculation (dpi), which continued to

appear in all emerging leaves till approximately 60–70 dpi.

Compared to control samples, real-time PCR showed only

10–40% accumulation of pds transcripts in the leaves

showing the streaks. This is the first report of the con-

struction of a VIGS vector for rice which can be introduced

by agroinoculation.

Keywords Gene silencing � Phytoene desaturase �Real-time PCR � Rice � RTBV � Virus-induced gene

silencing (VIGS)

Abbreviations

VIGS Virus-induced gene silencing

RTBV Rice tungro bacilliform virus

PDS Phytoene desaturase

RNAi RNA interference

GLH Green leafhopper

Introduction

Virus-induced gene silencing (VIGS) is an emerging

technology for rapid and transient gene silencing in plants.

VIGS is a manifestation of RNA interference (RNAi), a

universal phenomenon playing pivotal roles in defense and

cellular regulation at multiple levels in a wide range of

biological systems. During viral infection in plants, double-

stranded RNA (dsRNA) produced as replication interme-

diates of RNA viruses or highly structured regions of viral

transcripts can act as efficient inducers of RNAi (Szittya

et al. 2002; Moissiard and Voinnet 2006). In VIGS,

recombinant viruses carrying plant DNA fragments trigger

the silencing of homologous host transcripts by RNAi,

enabling this powerful tool to be applied for the analysis

of plant gene function (reviewed by Purkayastha and

Dasgupta 2009).

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00425-010-1273-z) contains supplementarymaterial, which is available to authorized users.

A. Purkayastha � S. Mathur � V. Verma � S. Sharma �I. Dasgupta (&)

Department of Plant Molecular Biology, University of Delhi

South Campus, Benito Juarez Road, New Delhi 110021, India

e-mail: [email protected]

123

Planta

DOI 10.1007/s00425-010-1273-z

Although VIGS has been used extensively for dicots, its

use in monocots has been rather limited; only two VIGS

vectors have been reported for monocot species—a Barley

stripe mosaic virus (BSMV)-based vector for use in barley

and wheat (Holzberg et al. 2002) and a Brome mosaic virus

(BMV)-based vector for barley, rice and maize (Ding et al.

2006). Both vectors are based on RNA viruses and their

inoculation involves in vitro transcription, followed by

transcript inoculation to plants. Although there has been a

report of Tobacco rattle virus (RNA virus)-based VIGS

vector being optimized for large-scale functional genomic

screens (Burch-Smith et al. 2006), DNA-based vectors,

rather than RNA-based ones, in general are easier to inoc-

ulate to plants using the methods of biolistics or agroinoc-

ulation, and are potentially useful in such screens (Liu et al.

2002; Lu et al. 2003; Zhang et al. 2009). Thus, developing a

DNA-based VIGS system for monocots would be a useful

tool for deciphering the gene functions of this class of

plants, which includes some of the major food crops.

Rice tungro bacilliform virus (RTBV), genus Tungro-

virus, is a rice-infecting pararetrovirus with dsDNA gen-

ome (Hay et al. 1991; Hull 1996; Fauquet et al. 2005).

RTBV, along with Rice tungro spherical virus (RTSV), a

member of the genus Waikavirus, forms a viral complex

causing the tungro disease of rice in South and Southeast

Asia. The affected plants display stunting and yellow-

orange foliar discoloration. In the viral complex, RTBV

gives rise to most of the symptoms, whereas RTSV is

responsible for the insect vector transmissibility by the

green leafhopper (GLH). Cloned RTBV DNA can be

introduced into rice plants using Agrobacterium-mediated

transfer (agroinoculation), upon which it causes symptoms

of mild stunting (Dasgupta et al. 1991). RTBV has a

genome of around 8 kb encoding four open reading frames

(ORFs I–IV, Hay et al. 1991). Functions of proteins

encoded by ORFs I, II and IV have not yet been elucidated.

ORF III codes for a polyprotein, which is processed to

obtain, among others, coat protein, aspartate protease and

reverse transcriptase–ribonuclease H.

To construct a VIGS vector for rice, a full-length cloned

DNA molecule representing an Indian RTBV isolate (Nath

et al. 2002) was assembled as a partial dimer in a binary

plasmid and tested for infectivity on rice by agroinocula-

tion. To retain the essential ORFs required for the repli-

cation and spread of the molecule in the plant and to make

it more suitable as a VIGS vector, the partial dimer was

appropriately shortened and modified. Here, we describe

the construction of an RTBV-derived VIGS vector and

show that it is capable of accumulation in emerging leaves,

following agroinoculation of rice plants and give evidence

that it silences an endogenous rice gene. This is the first

report of the development of a VIGS vector for rice based

on a DNA virus.

Materials and methods

Plant growth condition

Plants (two varieties of indica rice, PB-1 and TN-1,

obtained from Indian Agricultural Research Institute, New

Delhi) were grown either in glass tubes in Yoshida’s

medium (Yoshida et al. 1976) at 27�C and under 16 h light

and 8 h dark cycle using artificial lighting with 70%

humidity or in soil at 30�C under glasshouse conditions

with 80% relative humidity and supplemented with addi-

tional lighting.

Construction of pRTBV-Inf, pRTBV-Del-Inf,

pRTBV-MVIGS and pRTBV-MVIGS-pds

The transcription start site in pRTBV203, a cloned DNA

representing an Indian RTBV isolate, has been mapped at

position 7392 (Mathur and Dasgupta 2007). To construct

pRTBV-Inf, an approximately 3.9-kb fragment corre-

sponding to position between 6955–7934 and 1–2930 of

pRTBV203 was amplified using the Expand Long Tem-

plate PCR System (Roche, Mannheim, Germany) using

primer P1 (Table S1) and standard M13 reverse primer,

using pRTBV203 as the template. The primer P1 was

designed to include a SalI site at its 50 end, while the M13

reverse primer was complementary to regions of the

pUC18 backbone of pRTBV203. This region of the RTBV

DNA, between position 6955 of pRTBV203, upstream of

the promoter and unique BamHI site at position 2930

within the ORF III was used as the repeat region in the

partial dimer. The amplified fragment was cloned in the

binary vector pBinAR (Hofgen and Willmitzer 1990) using

the enzymes BamHI and SalI. To complete the partial

dimer, the unit-length RTBV genome cloned in the BamHI

site in pRTBV203 was excised and ligated to the BamHI-

linearized pBinAR. The expected partial dimer (pRTBV-

Inf) was selected from transformed colonies following

multiple restriction digestions of the resident plasmids.

The following steps were used to obtain pRTBV-Del-

Inf, the deleted version of pRTBV-Inf. First, an 846-bp

fragment of pRTBV203 from the nucleotide position

7169–7934 and 1–81 was amplified using Pwo polymerase

(Roche) with primers P2 and P3, carrying recognition sites

for EcoRI at their 50 ends (Table S1). The product was

purified, digested with EcoRI and cloned in pCAM-

BIA1380 (Roberts et al. 1998) at the EcoRI site (pRTBV

partial Del-Inf-I). Next, a 761-bp fragment from

pRTBV203 (position 7154–7921) was amplified using Pwo

polymerase (Roche) with primers P4 and P5, carrying

recognition sites for SalI at their 50 ends (Table S1),

purified, digested with SalI and cloned in the SalI site of

the pRTBV partial Del-Inf-I to obtain pRTBV partial

Planta

123

Del-Inf-II. Finally, a 6,124-bp fragment from another

cloned DNA of another Indian RTBV isolate (pRTBV204;

Nath et al. 2002), between the nucleotide residues 999–

7123, was amplified using the Expand High-fidelity PCR

system (Roche) with primers IF1 and IF2, carrying rec-

ognition sites for BamHI at their 50 ends (Table S1). The

product was purified, digested with BamHI and inserted

into the BamHI site of the pRTBV partial Del-Inf-II.

The resulting plasmid (pRTBV-Del-Inf) was checked by

multiple restriction digestions.

A cassette containing MUP, multiple cloning site (MCS)

and nos terminator was obtained from binary vector

pB4NU (Raghuvanshi 2001) by restriction digestion with

EcoRI and HindIII. The cassette was cloned into the binary

vector pCAMBIA2300 (McElroy et al. 1995) digested with

EcoRI and HindIII to obtain an intermediate vector (pINT-

1). The binary vector pB4NU was digested with PstI to

release the MUP fragment of about 2.0 kb. The MUP

fragment was cloned into the PstI site of plasmid pBSK.

The orientation of the insert in pBSK was checked by

restriction digestion with SalI and XbaI. MUP fragment

was obtained by digestion with KpnI and BamHI from the

clone in the sense-orientation and inserted into pINT-1 to

obtain the second intermediate vector, pINT-2, containing

two MUP fragments as direct repeats. Primer pairs

MVIGS-FP and MVIGS-RP (Fig. 1) were designed to

amplify ORF III and ORF IV from pRTBV204 corre-

sponding to nucleotide position 999–7183 of RTBV. The

DNA fragment was amplified using Phusion polymerase

(Finnzymes, Espoo, Finland) and the product was cloned

into TOPO cloning vector (Invitrogen, Carlsbad, CA,

USA). The cloned fragment was subsequently released

from the TOPO vector using BamHI. pINT-2 DNA was

digested with BamHI and ligated to the 6.1-kb amplifica-

tion product from pRTBV204 to obtain pRTBV-MVIGS.

The identity and orientation of the inserts were checked by

digestion with appropriate restriction enzymes.

Total RNA was isolated from rice using TRIzol Reagent

(Invitrogen). A 529-bp cDNA fragment of pds corre-

sponding to nucleotide residues 211–740 on the cDNA

sequence (AF049356) was amplified from the cDNA pool

of rice using primer pairs PDS-FP and PDS-RP (Table S1).

The primers were designed to include MluI and PacI

restriction sites at their respective 50 ends, respectively. The

cDNA fragment thus obtained was cloned into T/A vector

(InsT/A cloning Kit, Fermentas, Ontario, Canada), digested

with MluI and PacI and cloned in a reverse orientation into

the MluI–PacI sites of MCS of pRTBV-MVIGS to give

rise to pRTBV-MVIGS-pds.

Agroinoculation procedures

For agroinoculation, all vectors were transformed into

Agrobacterium tumefaciens strain EHA105 (Hood et al.

1993). Transformation was confirmed by colony PCR.

Agroinoculations were either carried out by the method

described by Dasgupta et al. (1991) or by a modified pro-

cedure. In the former method, the plants were maintained

in soil at 30�C under glasshouse conditions. In the latter

method, a primary culture was initiated from a single

Agrobacterium colony in LB medium supplemented with

appropriate antibiotics. Subsequently, a secondary culture

was grown so as to have an OD600 of 0.6–0.8. The cells

were harvested and resuspended in 10 mM MES, 10 mM

MgCl2, 200 lM acetosyringone to a volume 20-fold less

than the original. Approximately 15-day-old rice plants

grown in Yoshida’s medium were used for agroinoculation,

in which about 50 ll of the bacterial suspension was

injected into the meristematic region located at the crown

of the plants and were then transferred onto sterile What-

man No. 1 filter paper immersed in Yoshida’s medium

placed on a solid support with its ends dipped into a res-

ervoir containing the medium. The plants were covered

with moist tissue paper and transferred to tubes containing

5’GGATCCGTCGACTGGTATCAGAGCAATGTTACCATGACCATGGGGTCTTAGACCG 3’

a

BamHI SalIKozak sequencetRNA binding site

MVIGS-FP

999-1013

5’GGATCCGGGCCCTTAATTAAGACGTGACGTCCACGCGT TTATGCCTCCAGCCT 3’b

MVIGS-RPBamHI PacI MluI

7199-7213

Fig. 1 Primers MVIGS-FP and MVIGS-RP used to amplify 6.1 kb

RTBV ORF III. a Restriction enzyme sites, tRNA-binding site and

Kozak sequences (in bold and underlined) added are indicated in

primer MVIGS-FP. Also indicated are the RTBV nucleotides (boxed)

with their corresponding positions in the viral genome (GenBank Acc.

No. AJ292232). The trinucleotide ACC has been added and a single

nucleotide at position 1002 (G, italicized) has been changed to

introduce the Kozak sequence. b Primer MVIGS-RP indicating the

restriction sites and the RTBV sequences, with their corresponding

positions

Planta

123

Yoshida’s medium 24 h post-inoculation and were main-

tained at 27�C under conditions mentioned earlier.

Assay for the accumulation of pRTBV-Inf, pRTBV-

Del-Inf and pRTBV-MVIGS in inoculated rice plants

PCR was employed to as a primary screen to detect the

presence of all three DNA molecules in the plants at

15 days post-inoculation (dpi). For pRTBV-Inf, ELISA

was performed using antibodies raised against RTBV,

essentially according to the method described by Clark and

Adams (1977). DNA slot-blot analysis was performed for

pRTBV-Del-Inf and pRTBV-MVIGS using methods

described earlier (Borah et al. 2008). For PCR and dot-blot

analysis, total genomic DNA was isolated from the second

leaf of agroinoculated plants at 15 dpi using a method

described by Dellaporta et al. (1983) with modifications.

Briefly, a 5 cm portion of leaf was ground using liquid

nitrogen and the resultant powder was thawed in 600 ll of

extraction buffer (10 mM Tris pH 8.0, 1 mM EDTA pH

8.0, 1% SDS). The mixture was then incubated at 65�C for

20 min followed by cooling on ice for 5 min. Two hundred

microliters of 6 M ammonium acetate was added to the

tube and was mixed thoroughly followed by centrifugation

at 14,000g in a micro-centrifuge for 10 min at 4�C to pellet

the debris. The clear supernatant was mixed with 600 ll of

isopropanol to facilitate precipitation of DNA. The pre-

cipitation was carried out at -20�C for 30 min. The pre-

cipitate was collected by centrifugation at 14,000g for

15 min at 4�C and was washed with 70% ethanol at room

temperature for 10 min. The DNA pellet thus obtained was

air-dried and dissolved in 20 ll of T10E1 buffer. Ten

microliters of RNase (10 mg/ml) was added to the

extraction buffer. The DNA pellet obtained after isopro-

panol precipitation was used for PCR and dot-blot assay.

The DNA was quantified by spectrophotometer.

PCR amplifications were performed with 100 ng of

DNA. Primer pairs IDG-1 and IDG-2 (Table S1) corre-

sponding to nucleotide positions 5444–5465 and

6529–6553, respectively, in pRTBV204 were used to

screen agroinoculated plants for the presence of accumu-

lated pRTBV-Inf. Primer pairs DI-F and DI-R were

designed corresponding to nucleotide positions 7562–7585

and 1027–1051 in pRTBV204 (Table S1) to differentiate

between molecules derived from pRTBV-Del-Inf from a

natural RTBV infection. The forward primer was designed

from the pRTBV203 promoter region and the reverse

primer was designed from the segment of the genome

corresponding to the MP region of pRTBV204. As the

pRTBV-Del-Inf did not include ORF I and ORF II of

RTBV, it was expected that any molecule arising from

pRTBV-Del-Inf would give rise to a shorter amplicon

compared to those arising from a natural RTBV infection.

For DNA slot-blot analysis for both pRTBV-Del-Inf and

pRTBV-MVIGS, 2 lg of DNA was spotted for each of the

inoculated, mock-inoculated and uninoculated samples. As

a positive control, 400 ng of total genomic DNA from

tungro-affected plants at 30 dpi after GLH inoculation and

10 ng of pRTBV-Del-Inf or pRTBV-MVIGS DNA were

used. The probe for hybridization was derived from a DNA

fragment amplified from pRTBV204 using primer pair MP-

FP/MP-RP (Table S1). Megaprime DNA labeling System

(Amersham, Buckinghamshire, UK) was used for prepar-

ing the probe for Southern hybridization of the blots.

RNA isolation and real-time PCR analysis

Total RNA was isolated from plants agroinoculated with

pRTBV-MVIGS-pds or controls with pRTBV-MVIGS at

28 dpi, using TRIzol Reagent (Invitrogen) and treated with

RNase-free DNase-I (Fermentas) prior to cDNA synthesis

following the manufacturer’s recommendations. The first

strand cDNA was generated with 1 lg of total RNA using

high capacity cDNA archive kit (Applied Biosystems,

Carlsbad, CA, USA). Real-time RT-PCR analysis was

carried out with a real-time PCR detection system (7000

Sequence Detection System, Applied Biosystems). Primers

were designed using Primer Express� software (Applied

Biosystems). For SYBR real-time RT-PCR experiments,

primers pdsRT1 and pdsRT2 were used for pds transcripts

and primers ubq5RT1 and ubq5RT2 for ubiquitin (UBQ5)

transcripts (Table S1). The pds primers, indicated above,

were designed to exclude the region of cDNA cloned into

the pRTBV-MVIGS vector to ensure that only the endog-

enous mRNA was amplified. Amplification efficiency of

pds primers was determined by means of a calibration

curve (CT value vs. log of input cDNA) prepared in

duplicate using a tenfold dilution series. The slope of the

log-linear phase of the calibration curve was used to cal-

culate the percentage efficiency using the formula: effi-

ciency (%) = [10(-1/slope) - 1] 9 100. The UBQ5 gene

was used as an internal control. Cycling parameters were as

follows: 1 cycle at 50�C for 2 min, 1 cycle at 95�C for

10 min and 40 cycles, each consisting of 15 s at 95�C and

1 min at 60�C. The real-time RT-PCR experiment was

repeated with two independent sets of agroinoculated

plants showing streaking phenotype. From each set, total

RNA was isolated from two leaves of each plant (two

biological replicates) and from each RNA preparation,

real-time PCR was performed three times to determine

pds transcript levels (three technical replicates). The CT

values obtained for desired genes were normalized with

UBQ5 reference values and the DCT values were thus

obtained. Each DCT value was then compared to that of

the controls which was considered as the calibrator value

and the relative mRNA levels were calculated by the

Planta

123

formula: relative mRNA level ¼ 2�ðDCT sample�DCT calibratorÞ.The results thus obtained were plotted as relative mRNA

levels.

Results

Cloned derivatives of RTBV DNA accumulated

in agroinoculated rice plants

To develop a VIGS vector for rice from RTBV, the ability of

a cloned RTBV DNA present in a partially dimerised form in

a binary plasmid to systemically accumulate in rice plants

was investigated. The strategy described for the construction

of an infectious clone, a Philippine isolate of RTBV,

pRTRB1162 (Dasgupta et al. 1991), was followed. An

Indian isolate of RTBV (pRTBV203) was used as the

starting material for the construction of the VIGS vector. In

pararetroviruses, since a terminally redundant more than

full-length transcript acts as the template for reverse tran-

scription-mediated synthesis of the viral DNA, to check the

infectivity of a viral DNA, it is necessary to have it cloned as

a partial dimer in a binary vector and introduced in the host

plant through Agrobacterium-mediated transfer, a process

named agroinoculation (Grimsley et al. 1986). In such

constructs, the promoter of the viral genome is repeated, so

that a viral transcript with a terminal repeat is generated in

agroinoculated plants (Medberry et al. 1990; Dasgupta et al.

1991; Bouhida et al. 1993; Huang and Hartung 2001). Such a

partial dimer construct from an Indian isolate of RTBV was

constructed and named pRTBV-Inf. The plasmid contained

a unit-viral-length BamHI fragment in an orientation capa-

ble of giving rise to a RTBV transcript with direct terminal

repeats. The integrity of pRTBV-Inf was checked using

appropriate restriction enzymes and the expected digestion

patterns were obtained. A schematic representation of

pRTBV-Inf is shown in Fig. 2a.

The effect of introducing pRTBV-Inf in rice plants by

agroinoculation was tested with an average of 40 plants per

experiment, repeated ten times. The rice variety TN-1,

which displays symptoms of severe stunting and yellow-

orange foliar discoloration, was used for these experiments

and plants were maintained under glasshouse conditions.

PCR performed with primers IDG-1 and IDG-2 (Table S1)

on systemic leaves to amplify RTBV DNA showed

amplification of a band of the expected size in 11–19% of

all the agroinoculated plants by 14 dpi (Fig. 3a). Eighty

percent of the PCR-positive plants displayed symptoms of

stunting and yellow-orange discolouration by 15–20 dpi,

the symptoms getting more pronounced by 30 dpi

(Fig. 3b). None of the mock-inoculated plants (pRTBV-Inf

in E. coli) showed symptoms or amplified RTBV DNA. As

a confirmation for the presence of RTBV, ELISA of nine

randomly selected PCR-positive plants using RTBV anti-

bodies showed average values of 1.76 times that of a mock-

inoculated plant, similar to the values obtained in plants

infected with RTBV and RTSV transmitted using GLH.

pRTBV-Inf, because of its large size (almost 24 kb),

does not lend itself easily as a VIGS vector. Since the

essential functions of replication and systemic spread are

all carried out by the proteins encoded by the product of

ORF III (Hay et al. 1991; Laco and Beachy 1994; Laco

et al. 1995; Marmey et al. 1999), it was reasoned that it

may be possible to have some or all of the ORFs I, II and

IV deleted from pRTBV-Inf, keeping the essential func-

tions intact. Such a molecule was assembled and named

pBinAR backbonea

ORF I ORF II ORF III ORF IVRTBVpromoter

RTBVpromoter

ORF I ORF II ORF III (partial)

pCAMBIA1380 backboneb

pRTBV-Inf

MCS

pCAMBIA1380 backboneb

pRTBV-Del-Inf

MUP

MCS

pCAMBIA 2300 backbonec

MUP

tRNA binding site

pRTBV-MVIGS

Fig. 2 Schematic representation of RTBV-derived vectors used in

this study, pRTBV-Inf (a), pRTBV-Del-Inf (b) and pRTBV-MVIGS

(c). Dashed line in each case represents the binary plasmid, solidblack box represents tRNA-binding site introduced in the primer,

shaded rectangles indicate RTBV ORFs, similar shadings indicate

identical ORFs, shaded arrows indicate promoters. MUP maize

ubiquitin promoter. Position of MCS is indicated in pRTBV-MVIGS

Planta

123

pRTBV-Del-Inf, which contained as an insert, nucleotides

corresponding to positions 7169–7934 and 1–81 from

pRTBV 203, 999–7123 from pRTBV204 and 7154–7921

from pRTBV203, in that order. Such a molecule is

expected to generate, from the internal RTBV promoter

and the transcription-termination site, a terminally redun-

dant transcript containing the complete coding regions of

ORF III and a 50 nucleotide 30-truncated ORF IV, flanked

by a direct terminal repeat of about 500 bp each in rice

plants. A schematic representation of pRTBV-Del-Inf is

shown in Fig. 2b.

Once the infectious nature of pRTBV-Inf was estab-

lished, pRTBV-Del-Inf was tested for accumulation in

systemic leaves of two rice varieties, TN-1, described

earlier and PB-1, a variety which does not show yellow-

orange discolouration on RTBV and RTSV infection, but

shows marked stunting. A total of 121 PB-1 plants were

agroinoculated with pRTBV-Del-Inf in 5 independent

experiments, all being maintained under glasshouse con-

ditions. PCR performed on the plants at 14 dpi showed a

similar proportion amplifying pRTBV-Del-Inf as was

observed for pRTBV-Inf. The forward and reverse primers

to detect the accumulation of pRTBV-Del-Inf inoculated

plants, DI-F and DI-R, were designed from the RTBV

promoter and the 50 end of ORF III, respectively. Since

RTBV ORFs I and II are absent in pRTBV-Del-Inf, an

amplification product of about 0.5 kb was expected as

compared to a 1.4 kb from RTBV DNA. Indeed, all the

amplified products were of 0.5 kb in size (data not shown).

A total of 145 TN-1 plants were agroinoculated in 3

independent experiments to estimate the accumulation of

pRTBV-Del-Inf DNA by dot-blot hybridization, using a

probe derived from RTBV DNA. In contrast to PB-1

plants, TN-1 plants were grown at a lower temperature

(27�C), as compared to the glasshouse (30�C) and in a

liquid medium. Distinct hybridization signals were

obtained in 42 out of 145 plants tested at 15 dpi. A

representative dot blot is shown in Suppl. Fig. S1. Com-

pared to the uninoculated plants (slots E1–E3 and E12), the

hybridization signals in 16 of the 48 pRTBV-Del-Inf

inoculated plants (slots A1–D12) were very bright. Lanes

E5 and E6 show the signals in samples from plants inoc-

ulated with RTBV using GLH.

The promoter of the Indian isolate of RTBV when

expressed transgenically is active mainly in the vascular

bundles in a mature rice plant (Mathur and Dasgupta 2007).

We reasoned that the use of a constitutive promoter, rather

than a tissue-specific one, would be more appropriate for a

VIGS vector. Hence, maize ubiquitin promoter (MUP),

because of its constitutive nature and high levels of

expression in monocots, was chosen to drive the tran-

scription of the viral genes. Apart from replacing the pro-

moter, tRNA-binding site (to enable tRNA-mediated

initiation of reverse transcription, an essential feature of

pararetroviral DNA replication, to take place, Hay et al.

1991) and Kozak sequences (Kozak 1989), to provide an

optimal sequence context for translation initiation of the

viral genes, were introduced immediately downstream of

MUP. The above features were designed to be part of the

primer used to amplify the RTBV genes (MVIGS-FP,

Fig. 1). To introduce the Kozak sequence, three nucleo-

tides ‘‘ACC’’ were introduced and the ‘‘A’’ at nucleotide

position 1002 of the RTBV sequence was replaced with

‘‘G’’ (Fig. 1). The recognition sites of the restriction

enzymes PacI and MluI were introduced in the primer,

MVIGS-RP (Fig. 1). A 6.1-kb DNA fragment representing

ORFs III and IV of the RTBV DNA was amplified from

pRTBV204, using primers MVIGS-FP and MVIGS-RP,

such that the MUP, tRNA-binding site and the Kozak

sequence were positioned at the 50 end of the product and

the PacI–MluI sites at the 30 end, together cloned into the

binary plasmid pCAMBIA 2300. The vector was called

pRTBV-MVIGS, a schematic diagram of which is shown

in Fig. 2c.

a M 1 2 3 4 5 6 7 8 9 10 11 + b c

1.1 kb

6.9

1.1 0.70.70.6

Mock pRTBV-Inf pRTBV-MVIGSMock

Fig. 3 Detection of pRTBV-Inf in rice plants after agroinoculation

with pRTBV-Inf and lack of symptoms following agroinoculation

with pRTBV-MVIGS. a Lanes 1–11 PCR amplification of pRTBV-

Inf in agroinoculated rice plants at 14 dpi; M DNA size marker; ?:

pRTBV-Inf plasmid as positive control, numbers at the side indicate

size markers in kb. b Photograph of plants variety TN-1 mock-

inoculated and agroinoculated by pRTBV-Inf at 30 dpi. c Photograph

of plants variety TN-1 mock-inoculated and agroinoculated by

pRTBV-MVIGS at 20 dpi. The roots have been trimmed for clarity

Planta

123

The ability of pRTBV-MVIGS, the vector with several

new features compared to pRTBV-Del-Inf, to accumulate

in rice plants was checked on the rice variety TN-1. A total

of 110 plants were agroinoculated in 5 independent

experiments and observed over a period of 10 weeks at

27�C maintained in liquid medium. No stunting or yel-

lowing was noticed in plants inoculated with pRTBV-

MVIGS or in mock-inoculated controls (plants inoculated

with pRTBV-MVIGS in E. coli) at 20 dpi (Fig. 3c), a stage

where symptoms appear in case of inoculation with

pRTBV-Inf. The plants were observed till 70 dpi for the

appearance of symptoms but none were apparent. A frac-

tion of plants inoculated with pRTBV-MVIGS was tested

for the accumulation of pRTBV-MVIGS DNA in the sec-

ond leaf at 14 dpi by DNA dot blot. Of the 75 plants tested,

52 showed strong signals indicating accumulation of

pRTBV-MVIGS in the leaf tested.

pRTBV-MVIGS-pds was able to silence the rice pds

gene

To determine the efficacy of pRTBV-MVIGS in gene

silencing, the marker gene phytoene desaturase (pds) was

selected. PDS is an enzyme required for the biosynthesis of

carotenoid pigments that protect chlorophyll from photo-

bleaching and its silencing is associated with the devel-

opment of white streaks in the leaves of monocot plants

(Holzberg et al. 2002). The pRTBV-MVIGS construct

carrying pds were named pRTBV-MVIGS-pds.

Thirty-six TN-1 plants were agroinoculated with

pRTBV-MVIGS-pds in three independent experiments.

These plants were maintained in liquid medium (Yoshida’s

medium) at 27�C. At the same time, 78 TN-1 plants

inoculated with pRTBV-MVIGS-pds were maintained in

soil under glasshouse conditions. Between 21 and 35 dpi,

77% of the plants maintained in Yoshida’s medium agro-

inoculated with pRTBV-MVIGS-pds developed white

streaks in the emerging leaves (Fig. 4a; Table 1). Control

plants inoculated with the empty vector and those mock

inoculated remained green throughout. The leaf streaks

continued to appear in all leaves (approximately 4–5)

emerging till 60–70 dpi, after which the leaves emerging

were free of streaks. The leaves formed before agroinoc-

ulation did not show any streaking phenotype. None of the

inoculated plants kept under glasshouse conditions at 30�C

developed the streaking phenotype.

To determine the levels of pds transcripts, real-time

PCR analysis was used on RNA extracted from leaves of

six plants showing streaking phenotype. Amplification

efficiency of pds primers, determined using a calibration

curve prepared from a tenfold dilution series, was an

average of 96%. In plants displaying streaking phenotype,

the levels of pds transcripts were 10–40% of the corre-

sponding levels in mock-inoculated controls (Fig. 4b). This

experiment was repeated once with comparable results.

Fig. 4 Silencing of phytoene desaturase (pds) gene in rice plants.

a Photographs of portions of rice leaves from plants (second leaf at

28 dpi) inoculated with (i) pRTBV-MVIGS-pds, (ii) pRTBV-MVIGS

and (iii) mock-inoculated. b Accumulation of pds transcript at 28 dpi

in rice plants inoculated with pRTBV-MVIGS-pds, compared to

mock-inoculated control. Heights of bars are proportional to the

values assessed by real-time PCR. Mock mock-inoculated plant, UIuninoculated plant, columns 1–6 individual plants inoculated with

pRTBV-MVIGS-pds

Table 1 Development of streaking phenotype in rice plants indica-

tive of pds silencing

Experiment pRTBV-MVIGS pRTBV-MVIGS-pds

1 0/15 13/16

2 0/8 7/10

3 0/10 8/10

The constructs used are indicated. Number of plants showing

streaking phenotype in emerging leaves/number of plants inoculated

at 21 dpi

Planta

123

Discussion

Here, we describe, for the first time, the construction of a

DNA-based VIGS vector for rice and demonstrate its use

by silencing the rice pds gene. Reports indicate that DNA-

based VIGS vectors rather than RNA-based ones are the

method of choice especially where high-throughput gene

silencing is required for functional screens of a large

number of genes. For example, the soybean VIGS vector,

based on the RNA virus Bean pod mottle virus (BPMV;

Zhang and Ghabrial 2006), was recently modified to

express the corresponding cDNA under the strong Cauli-

flower mosaic virus (CaMV) 35S promoter and introduced

in the plants by biolistic inoculation (Zhang et al. 2009). In

contrast to the original report of BPMV-based vector, the

DNA vector used a much milder strain of the virus to

achieve comparable levels of silencing in host plant.

Similar modifications have also been reported for the

widely used Tobacco mosaic virus (TMV)- and Potato

virus X-based vectors (Lu et al. 2003; Liu et al. 2002). The

VIGS vector reported in this study, being based on a binary

plasmid, can be easily inoculated into rice plants using

simple agroinoculation procedures, allowing increased

convenience in handling compared to the methods descri-

bed earlier with the BMV-based vectors for VIGS of rice

(Ding et al. 2006). The earlier method required a multi-step

inoculation procedure consisting of an initial in vitro pro-

duction of transcripts and inoculation on barley leaves,

followed by preparation of leaf extracts at 10–14 dpi, with

which to finally inoculate rice plants. In contrast, using

pRTBV-MVIGS, transcript inoculation can be by-passed

and the vector can be directly delivered to the plants in

which gene silencing is desired. A MCS has also been

introduced into the 30 end of the vector to allow easy

cloning of target gene fragments without disrupting the

ORFs.

DNA dot-blot assay indicated accumulation of pRTBV-

Del-Inf molecules in systemic leaves of agroinoculated

plants, despite completely lacking RTBV ORFs I and II

and carrying a truncated ORF IV, which showed that all the

functions required for the replication and spread were

performed by proteins encoded by the ORF III. It has been

reported that ORF II product interacts with Coat protein

and disruption of this interaction affected the infectivity of

cloned RTBV-Phil DNA in agroinoculation experiments

(Herzog et al. 2000). Amino acid residues 56–73 of the

ORF II-encoded protein exhibited coiled structures, similar

to the P3 protein of CaMV, which can form tetramer in

vitro (Leclerc et al. 1998). These two facts taken together

led the authors to propose that the ORF II product may

function in a fashion similar to scaffolding proteins of

dsDNA bacteriophages and certain animal viruses (Hendrix

and Garcea 1994), attributing a role of ORF II product in

capsid assembly of RTBV (Herzog et al. 2000). We did not

attempt to look for virus-like particles in plants agroinoc-

ulated with pRTBV-Del-Inf or pRTBV-MVIGS, something

we plan to do in future. Since we observed efficient rep-

lication of pRTBV-Del-Inf and pRTBV-MVIGS, both

lacking ORF II, we conclude that ORF II product has no

significant role to play in the replication and spread of these

molecules in rice.

The streaking phenotype appearing in newly emerging

leaves is a characteristic feature of pds silencing. The

mock-inoculated and uninoculated plants were indistin-

guishable, indicating that the agroinoculation process, per

se, was not giving rise to any stress response in the inoc-

ulated plant. Just 10–40% levels of pds transcripts in the

leaves displaying steaks compared to the controls were

similar to that reported earlier for pds-silenced barley

(Holzberg et al. 2002; Ding et al. 2006; Bruun-Rasmussen

et al. 2007), using BSMV- and BMV-based VIGS vectors.

Interestingly, it was observed that the silencing phenotype

did not penetrate throughout the entire lamina of the leaves.

One possible explanation for the streaking phenotype,

rather than a uniform bleaching response, may be the

absence of pRTBV-MVIGS-pds in all tissues or the

inability to induce silencing uniformly (Ding et al. 2006).

Development of the photo-bleaching phenotype can be

expected to depend upon the rate of turnover or stability of

PDS. Hence, it is also possible that the silenced phenotype

is not visible in sectors where the carotenoid pigments are

already present in significant quantities or are synthesized

by pre-existing PDS.

One of the challenges of designing a VIGS vector is to

produce symptomless infection or infection with attenuated

symptoms in the host. Both the VIGS vectors available for

monocots (BSMV- and BMV-based) are associated with

viral symptoms, albeit mild (Holzberg et al. 2002; Ding

et al. 2006). In contrast, inoculation of plants with either

the pRTBV-MVIGS or that containing target gene insert

was completely symptomless. It has been reported that

RTBV not RTSV causes most tungro symptoms (Dasgupta

et al. 1991; Encabo et al. 2009), although the identities of

the RTBV genes responsible are unknown. Two rice tran-

scription factors, RF2a and RF2b, interact with and pos-

sibly are sequestered to an element (Box II), present in the

upstream promoter regions (-53 to -39 with respect to the

transcription start site) of RTBV (Dai et al. 2004, 2006).

The above sequestration of the transcription factors has

been proposed to cause perturbation in rice gene expression

patterns leading to the symptoms of tungro. Hence, RF2a-

and RF2b-overexpressing transgenic rice lines do not show

symptoms upon RTBV inoculation (Dai et al. 2008).

Though the Box II element is not completely conserved in

the two groups of RTBV, from Philippines and India

(Mathur and Dasgupta 2007), an interaction of host factors

Planta

123

with elements resembling Box II in the RTBV-WB pro-

moter, causing the tungro symptoms, cannot be ruled out.

In pRTBV-MVIGS, since RTBV promoter is replaced by

MUP, the lack of Box II element or other similar elements,

otherwise interacting with RF2a and RF2b, may contribute

to the lack of symptoms in plants upon agroinoculation

with pRTBV-MVIGS.

White streaks started to appear in the emerging leaves of

the plants agroinoculated with pRTBV-MVIGS-pds from 21

to 35 dpi. All subsequent leaves emerging till 60–70 dpi

continued showing streaks. Thereafter, the emerging leaves

were devoid of streaks. It is interesting to note that similar

streaking phenotype in monocots reported earlier was also

transient in nature (Holzberg et al. 2002; Scofield et al. 2005;

Ding et al. 2006). Stronger levels of silencing might be

achievable using inverted repeat constructs of target genes

(Lacomme et al. 2003), which need to be tested in the future.

Temperature is an important factor affecting the extent

and efficiency of silencing of VIGS vectors. Generally,

lower temperatures enhance the efficiency of VIGS vectors,

such as those based on Tobacco rattle virus (Szittya et al.

2003; Fu et al. 2006; Cai et al. 2007; Nethra et al. 2006;

Tuttle et al. 2008) and Cotton Leaf Crumple Virus

(Chellappan et al. 2005). This probably explains why we, in

this study, observed efficient silencing by pRTBV-MVIGS

only when the plants were grown at a temperature of 27�C in

the culture room and not at 30�C. Lower humidity conditions

have also been shown to be favorable for efficient silencing

by TRV-VIGS (Fu et al. 2006). The humidity conditions in

the culture room were generally lower than that of glass-

house and this factor may also have added to the silencing

phenotype obtained under culture room conditions.

Rice is the single most important monocot plant

responsible for providing dietary calories for a large

number of people, mainly in the developing countries. The

complete genome of rice has been sequenced (International

Rice Genome Sequencing Project 2005) and this major

food crop is poised for functional genomics research

making the development of pRTBV-MVIGS system very

timely. pRTBV-MVIGS lends itself well to high-through-

put methods and has the potential to greatly speed up

functional genomic research of rice.

Acknowledgments This work was funded by Department of Bio-

technology, Government of India, New Delhi, Grant no. BT/AB/03/

FG-I/2003 to ID. AP wishes to thank University Grants Commission,

New Delhi and SM, VV and SS wish to thank Council for Scientific

and Industrial Research, New Delhi for Research Fellowships.

References

Borah BK, Johnson AMA, Sai Gopal DVR, Dasgupta I (2008) A

comparison of four DNA extraction methods for the detection of

citrus yellow mosaic badnavirus from two species of citrus using

PCR and dot-blot hybridisation. J Virol Methods 151:321–324

Bouhida M, Lockhart BEL, Olszewski NE (1993) An analysis of the

complete sequence of a sugarcane bacilliform virus genome

infectious to banana and rice. J Gen Virol 74:15–22

Bruun-Rasmussen M, Madsen CT, Jessing S, Albrechtsen M (2007)

Stability of barley stripe mosaic virus-induced gene silencing in

barley. Mol Plant Microbe Interact 20:1323–1331

Burch-Smith TM, Schiff M, Liu Y, Dinesh-Kumar SP (2006)

Efficient virus-induced gene silencing in Arabidopsis. Plant

Physiol 142:21–27

Cai X, Wang C, Xu Y, Xu Q, Zheng Z, Zhou X (2007) Efficient gene

silencing induction in tomato by a viral satellite DNA vector.

Virus Res 125:169–175

Chellappan P, Vanitharani R, Ogbe F, Fauquet CM (2005) Effect of

temperature on geminivirus-induced gene silencing. Plant Phys-

iol 138:1828–1841

Clark MF, Adams AN (1977) Characteristics of the microplate

method of enzyme-linked immunosorbent assay for the detection

of plant viruses. J Gen Virol 34:475–483

Dai S, Zhang Z, Chen S, Beachy RN (2004) RF2b, a rice bZIP

transcription activator, interacts with RF2a and is involved in

symptom development of rice tungro disease. Proc Natl Acad Sci

USA 101:687–692

Dai S, Zhang Z, Bick J, Beachy RN (2006) Essential role of the Box

II cis element and cognate host factors in regulating the promoter

of rice tungro bacilliform virus. J Gen Virol 87:715–722

Dai S, Wei X, Alfonso AA, Pei L, Duque UG, Zhang Z, Babb GM,

Beachy RN (2008) Transgenic rice plants that over-express

transcription factors RF2a and RF2b are tolerant to rice tungrovirus replication and disease. Proc Natl Acad Sci USA

105:21012–21016

Dasgupta I, Hull R, Eastop S, Poggi-Pollini C, Blakebrough M,

Boulton MI, Davies JW (1991) Rice tungro bacilliform virusDNA independently infects rice after Agrobacterium-mediated

transfer. J Gen Virol 72:1215–1221

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA mini-

preparation, version II. Plant Mol Biol Rep 1:19–21

Ding XS, Schneider WL, Chaluvadi SR, Rouf Mian M, Nelson RS

(2006) Characterization of a brome mosaic virus strain and its

use as a vector for gene silencing in monocotyledonous hosts.

Mol Plant Microbe Interact 19:1229–1239

Encabo JR, Cabauatan PQ, Cabunagan RC, Satoh K, Lee JH, Kwak

DY, De Leon TB, Macalalad RJ, Kondoh H, Kikuchi S, Choi IR

(2009) Suppression of two tungro viruses in rice by separable

traits originating from cultivar Utri Merah. Mol Plant Microbe

Interact 22:1268–1281

Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA (2005)

Virus taxonomy. Eighth Report of the International Committee

for the Taxonomy of Viruses. Academic Press, New York

Fu DQ, Zhu BZ, Zhu HL, Zhang HX, Xie YH, Jiang WB, Zhao XD,

Luo KB (2006) Enhancement of virus-induced gene silencing in

tomato by low temperature and low humidity. Mol Cells

21:153–160

Grimsley N, Hohn B, Hohn T, Walden R (1986) ‘‘Agroinfection’’ an

alternative route for viral infection of plants by using the Ti

plasmid. Proc Natl Acad Sci USA 83:3282–3286

Hay JM, Jones MC, Blakebrough ML, Dasgupta I, Davies JW, Hull R

(1991) An analysis of an infectious clone of rice tungrobacilliform virus, a plant pararetrovirus. Nucleic Acids Res

19:2615–2621

Hendrix RW, Garcea RL (1994) Capsid assembly of dsDNA viruses.

Semin Virol 5:15–26

Herzog E, Guerra-Peraza O, Hohn T (2000) The rice tungro

bacilliform virus gene II product interacts with the coat protein

domain of the viral gene III polyprotein. J Virol 74:2073–2083

Planta

123

Hofgen R, Willmitzer L (1990) Biochemical and genetic analysis of

different patatin isoforms expressed in various organs of potato

(Solanum tuberosum). Plant Sci 66:221–230

Holzberg S, Brosio P, Gross C, Pogue GP (2002) Barley stripe mosaicvirus-induced gene silencing in a monocot plant. Plant J

30:315–327

Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New

Agrobacterium helper plasmids for gene transfer to plants.

Transgenic Res 2:208–218

Huang Q, Hartung JS (2001) Cloning and sequence analysis of an

infectious clone of Citrus yellow mosaic virus that can infect

sweet orange via Agrobacterium-mediated inoculation. J Gen

Virol 82:2549–2558

Hull R (1996) Molecular biology of rice tungro viruses. Annu Rev

Phytopathol 34:275–297

International Rice Genome Sequencing Project (2005) The map-based

sequence of the rice genome. Nature 436:793–800

Kozak M (1989) The scanning model for translation: an update. J Cell

Biol 108:229–241

Laco GS, Beachy RN (1994) Rice tungro bacilliform virus encodes

reverse transcriptase, DNA polymerase, and ribonuclease H

activities. Proc Natl Acad Sci USA 91:2654–2658

Laco GS, Kent SB, Beachy RN (1995) Analysis of the proteolytic

processing and activation of the rice tungro bacilliform virusreverse transcriptase. Virology 208:207–214

Lacomme C, Hrubikova K, Hein I (2003) Enhancement of virus-

induced gene silencing through viral-based production of

inverted-repeats. Plant J 34:543–553

Leclerc D, Burri L, Kajava AV, Mougeot JL, Hess D, Lustig A,

Kleemann G, Hohn T (1998) The open reading frame III product

of cauliflower mosaic virus forms a tetramer through a

N-terminal coiled-coil. J Biol Chem 273:29015–29021

Liu Y, Schiff M, Marathe R, Dinesh-Kumar SP (2002) Tobacco Rar1,

EDS1 and NPR1/NIM1 like genes are required for N-mediated

resistance to tobacco mosaic virus. Plant J 30:415–429

Lu R, Malcuit I, Moffett P, Ruiz MT, Peart J, Wu AJ, Rathjen JP,

Bendahmane A, Day L, Baulcombe DC (2003) High throughput

virus-induced gene silencing implicates heat shock protein 90 in

plant disease resistance. EMBO J 22:5690–5699

Marmey P, Bothner B, Jacquot E, de Kochko A, Ong CA, Yot P,

Siuzdak G, Beachy RN, Fauquet CM (1999) Rice tungrobacilliform virus open reading frame 3 encodes a single

37-kDa coat protein. Virology 253:319–326

Mathur S, Dasgupta I (2007) Downstream promoter sequence of an

Indian isolate of rice tungro bacilliform virus alters tissue-

specific expression in host rice and acts differentially in

heterologous system. Plant Mol Biol 65:259–275

McElroy D, Chamberlain DA, Moon E, Wilson KJ (1995) Develop-

ment of a gusA reporter gene construct for cereal transformation,

availability of plant transformation vectors from CAMBIA

molecular genetic resource service. Mol Breed 1:27–37

Medberry SL, Lockhart BEL, Olszewski NE (1990) Properties of

commelina yellow mottle virus’s complete DNA sequence,

genomic discontinuities and transcript suggest that it is a

pararetrovirus. Nucleic Acids Res 18:5505–5551

Moissiard G, Voinnet O (2006) RNA silencing of host transcripts by

cauliflower mosaic virus requires coordinated action of the four

Arabidopsis Dicer-like proteins. Proc Natl Acad Sci USA

103:19593–19598

Nath N, Mathur S, Dasgupta I (2002) Molecular analysis of two

complete rice tungro bacilliform virus genomic sequences from

India. Arch Virol 147:1173–1187

Nethra P, Nataraja KN, Rama N, Udayakumar M (2006) Standard-

ization of environmental conditions for induction and retention

of post-transcriptional gene silencing using tobacco rattle virusvector. Curr Sci 90:431–435

Purkayastha A, Dasgupta I (2009) Virus-induced gene silencing: a

versatile tool for discovery of gene functions in plants. Plant

Physiol Biochem 47:967–976

Raghuvanshi S (2001) Investigations on chloroplast transformation

and characterization of constitutively photomorphogenic 1(COP1) gene in rice. Ph.D. Thesis, University of Delhi

Roberts CS, Rajagopal S, Smith LA, Nguyen TA, Yang W, Nuroho S,

Ravi KS, Cao M-L, Vijayachandra K, Patell V, Harcourt R,

Dransfield L, Desamero N, Slamet I, Keese P, Kilian A,

Jefferson RA (1998) A comprehensive set of modular vectors for

advanced manipulations and efficient transformation of plants by

both Agrobacterium and direct DNA uptake methods. pCAM-

BIA Vector release manual version 3.05. CAMBIA. Canberra,

Australia

Scofield SR, Huang L, Brandt AS, Gill BS (2005) Development of a

virus-induced gene-silencing system for hexaploid wheat and its

use in functional analysis of the Lr21-mediated leaf rust

resistance pathway. Plant Physiol 138:2165–2173

Szittya G, Molnar A, Silhavy D, Hornyik C, Burgyan J (2002) Short

defective interfering RNAs of tombusviruses are not targeted but

trigger post transcriptional gene silencing against their helper

virus. Plant Cell 14:359–372

Szittya G, Silhavy D, Molnar A, Havelda Z, Lovas A, Lakatos L,

Banfalvi Z, Burgyan J (2003) Low temperature inhibits RNA

silencing mediated defence by the control of siRNA generation.

EMBO J 22:633–640

Tuttle JR, Idris AM, Brown JK, Haigler CH, Robertson D (2008)

Geminivirus-mediated gene silencing from cotton leaf crumplevirus is enhanced by low temperature in cotton. Plant Physiol

148:41–50

Yoshida S, Forno SA, Cock SH, Gomez KA (1976) Routine

procedure for growing rice plants in culture solution. In:

Yoshida S (ed) Laboratory manual for physiological studies of

rice. IRRI, Manila, Philippines, pp 3367–3374

Zhang C, Ghabrial SA (2006) Development of bean pod mottle virus-

based vectors for stable protein expression and sequence-specific

virus-induced gene silencing in soybean. Virology 344:401–411

Zhang C, Yang C, Whitham SA, Hill JH (2009) Development and use

of an efficient DNA-based viral gene silencing vector for

soybean. Mol Plant Microbe Interact 22:123–231

Planta

123