Slide 1Mutations Slide 2 A C CC T A A AA G G T DNA C C G G G A A U U UUU mRNA transcription nucleus Gly Ser Phe Trp PROTEIN translation Cytoplasm: ribosome Slide 3 A change…

Slide 1Mutations and the Birth and Death of Genes Author Ann Brokaw Rocky River High School Ohio Slide 2 About This Activity… These slides provide examples of different…

1.Other forms of cloning and analysis PCR Restriction mapping The human genome project In situ methodologies These adapt southern, northern and western techniques to assess…

1.04- GENETIC TESTING 1.04- GENETIC TESTING Biomedical Technology II Day 1 Deciding to Know or Not to Know The purpose of day 1 is to demonstrate that genetic knowledge can…

Slide 1 dNTP Imbalance in Mitochondria Alexandra Frolova Dr. Christopher K. Mathews Laboratory Biochemistry and Biophysics Slide 2 Rates of mutation in mtDNA are 10-100 fold…

Slide 1 Chapter 13: Mutations and Chromosomal Abnormalities Higher Human Biology Unit 1: Cell Function and Inheritance 04/08/20151Mrs Smith: Ch13: Mutations an Chromosomal…

Slide 1 DNA Damage, Mutations, and Repair See Stryer p. 768-773 Slide 2 DNA Mutations 1. Substitution mutations: one base pair for another, e.g. T for G the most common form…

Slide 1 TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA…

Mutations mutations â errors in the DNA can have a bad resultant effect can have no effect can have a positive resultant effect Mutations are usually not an issue because…

Mutations mutations â errors in the DNA can have a bad resultant effect can have no effect can have a positive resultant effect Mutations are usually not an issue because…