Form 5: Chapter 6 – Variation Chapter 6: Variation 6.1 Variation in Organism 1. Difference in an organism from the same species. 2. Types: Continuous Discontinuous Quantitative…

1. WHAT’S AHEAD FORBIOLOGY?THE DATA INTENSIVE FUTUREC. Titus [email protected] Professor, Michigan State University(In January, moving to UC Davis / VetMed.)Talk…

1. Bioinformatics:Definitions, Challenges and Impact on Health Care Systems Daniel Masys, M.D. Professor and Chair Department of Biomedical Informatics Vanderbilt University…

Slide 1CHAPTER 20 DNA TECHNOLOGY AND GENOMICS Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Section B: DNA Analysis and Genomics 1.Restriction…

Slide 1Chapter 13 Meiosis and Sexual Life Cycles Slide 2 Inheritance/Heredity When traits are passed down from one generation to the next, we say they are inherited. The…

Slide 1Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 21.1 Chapter 21 Genomes and their Evolution Slide 2 Copyright © 2005 Pearson Education,…

Slide 1Annotation of Gene Function …and how thats useful to you Slide 2 What is TAIR*? NSF-funded project begun in 1999 Web resource for Arabidopsis data and stocks Literature-based…

Slide 1Microarrays & Gene Expression Analysis Slide 2 Slide 3 Contents DNA microarray technique Why measure gene expression Clustering algorithms Relation to Cancer SAGE…

Slide 1Antibody Identification Slide 2  Most important blood group system in blood transfusion medicine.  (after ABO) Slide 3  1939 – Levine and Stetson 1 st discovered…

1.Similarity Search in Large Datasets using Gene Ontology COMPUTATIONAL INFORMATICS Heiko Müller, David Rozado, Mat Cook, Ashfaqur Rahman 2. Gene01: ACGGTAGGCTAGACTAGATATTAACG…