Documents Biological Motif Discovery Concepts Motif Modeling and Motif Information EM and Gibbs Sampling...

Slide 1 Biological Motif Discovery Concepts Motif Modeling and Motif Information EM and Gibbs Sampling Comparative Motif Prediction Applications Transcription Factor Binding…

Documents Regulatory Genomics Lecture 2 November 2012 Yitzhak (Tzachi) Pilpel 1.

Regulatory Genomics Lecture 2 November 2012 Yitzhak (Tzachi) Pilpel * Course requirements Attendance and participation Two reading assignments A final take home papers reading-based…

Documents Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr. Garry Larson City…