Education Biodiversity informatics: why aren't we there yet?

1.Biodiversity informatics: why aren’t we there yet? @rdmpage http://iphylo.blogspot.com 2. I’ve often said I want a Google for biodiversity data… 3. …turns out what…

Science Biodiversity Knowledge Graphs

PowerPoint Presentation Biodiversity knowledge graphs @rdmpage http://iphylo.blogspot.com 1 Our questions are âpathsâ in this network http://iphylo.org/~rpage/geojson-phylogeny-demo/…

Documents Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater...

Slide 1 Slide 2 Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format. Slide 3 Detection Sequence…

Documents Real Time PCR

Real Time PCR Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format. Calibration System Detection Sequence 5’ AGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAAT…