Documents Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater...

Slide 1 Slide 2 Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format. Slide 3 Detection Sequence…

Documents Real Time PCR

Real Time PCR Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format. Calibration System Detection Sequence 5’ AGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAAT…

Documents Trypanosoma cruzi from Opossums in Southwest Georgia and North Florida Jessica L. Gillis and J....

Trypanosoma cruzi from Opossums in Southwest Georgia and North Florida Jessica L. Gillis and J. Mitchell Lockhart Department of Biology Valdosta State University Trypanosoma…