Documents Previous Lecture: Sequence Alignment Concepts. Introduction to Biostatistics and Bioinformatics...

Slide 1 Previous Lecture: Sequence Alignment Concepts Slide 2 Introduction to Biostatistics and Bioinformatics Sequence Database Searching This Lecture Stuart M. Brown, Ph.D.…

Documents Mathematics and computation behind BLAST and FASTA

Mathematics and computation behind BLAST and FASTA Xuhua Xia [email protected] http://dambe.bio.uottawa.ca Slide * Bioinformatics-enabled research Sequence variation: UUCUCAACCAACCAUAAAGAUAU…