Huntington’s Disease Progressive autosomal dominant neurodegenerative disorder caused by expansion of a CAG (cytosine ,adenine , guanine ) repeat coding for polyglutamine…

1. doi:10.1016/S0022-2836(03)00057-3J. Mol. Biol. (2003) 326, 1337–1349 Characterisation of a Non-canonical Genetic Code in the Oxymonad Streblomastix strix Patrick J.…

Slide 1 Success Story of Transgenic crops Transgenic crops Slide 2 Important Traits for Crop Improvement High crop yield High crop yield High nutritional quality High nutritional…

Slide 111- Criminalistics, 10e Richard Saferstein © 2011, 2007, 2004, 2001, 1998, 1995 Pearson Higher Education, Upper Saddle River, NJ 07458. All Rights Reserved. 1 Slide…

Slide 1 Slide 2 Identify the structures labeled I, II, III, IV and V Slide 3 AUGCCUAUUGAUGGCCCAUAAGUU How would a change in the sequence of nucleotides in a DNA molecule…

Slide 1 Applications of Transgenic technology Slide 2 Transgenic technology Breeding method Breeding method Crop Improvement Crop Improvement The Potential traits: The Potential…

Slide 1 Amino Acid Analyzer Nashwa Othman Slide 2 Slide 3 What are Amino Acids Amino acids are organic compounds containing an amine group, a carboxylic acid group and a…

The genetic code is used as a blueprint to make proteins. We have looked at DNA. But how is this genetic code actually used for anything? Lets See! Proteins are widely used…

PowerPoint Presentation DNA Structure https://www.youtube.com/watch?v=qy8dk5iS1f0 What do these items have to do with one another? Deoxyribonucleic Acid (DNA) Forensic Science…

Applications of Transgenic technology Transgenic technology Breeding method Crop Improvement The big six traits Herbicide Resistance Insect Resistance Virus Resistance Altered…