UMEÅ UNIVERSITY MEDICAL DISSERTATIONS
New Series No. 1522 ISSN 0346-‐6612 ISBN 978-‐91-‐7459-‐481-‐2
Telomere length -‐ Dynamics and role as a biological marker
in malignancy
Ulrika Svenson
Department of Medical Biosciences, Pathology Umeå University
Umeå 2012
Responsible publisher under Swedish law: the Dean of the Medical Faculty This work is protected by the Swedish Copyright Legislation (Act 1960:729) New Series No: 1522 ISSN: 0346-‐6612 ISBN: 978-‐91-‐7459-‐481-‐2 E-‐version available at: http://umu.diva-‐portal.org/ Cover and figure design: Ulrika Svenson Printed by: Print & Media, Umeå, Sweden, 2012 © Ulrika Svenson, 2012
To my family and friends
”Anything's possible if you've got enough nerve”
J.K. Rowling
i
TABLE OF CONTENTS TABLE OF CONTENTS i ABSTRACT iii ORIGINAL ARTICLES iv LIST OF ABBREVIATIONS v POPULÄRVETENSKAPLIG SAMMANFATTNING vi INTRODUCTION 1
TELOMERE BIOLOGY 1 IT STARTS WITH THE END 1 THE TELOMERASE ENZYME 2 FACTORS INFLUENCING TELOMERE LENGTH 3 TELOMERE LENGTH IN PERIPHERAL BLOOD CELLS 5 The hematopoietic and immune system -‐ an overview 5 Blood telomere length in health and disease 7 Telomeres and telomerase in blood cell subpopulations 7 APPROACHES FOR TELOMERE LENGTH ESTIMATION – A SUMMARY 9 TUMOR BIOLOGY 11 THE HALLMARKS OF CANCER 11 TUMORS AND TELOMERES 11 THE IMMUNE SYSTEM AND CANCER 13 SPECIFIC TUMOR TYPES 15 Breast cancer 15 Renal cell carcinoma 16
AIMS 18 MATERIALS AND METHODS 19
STUDY POPULATIONS AND TISSUE SAMPLES 19 MAGNETIC IMMUNE CELL SEPARATION 21 TELOMERE LENGTH MEASUREMENTS 21 Telomere real-‐time PCR 21 Southern blot 22 Single Telomere Length Analysis (STELA) 22 TELOMERASE ACTIVITY 23 FLOW CYTOMETRY 23 MULTIPLEX CYTOKINE ANALYSIS 23 STATISTICAL ANALYSIS 24
RESULTS 25 PAPER I 25 PAPER II 26 PAPER III 27 PAPER IV 28
ii
DISCUSSION 30 BLOOD TELOMERE LENGTH AS A RISK MARKER IN MALIGNANCY 30 TELOMERE LENGTH AS A PROGNOSTIC INDICATOR FOR 32 CANCER SURVIVAL THE IMPACT OF IMMUNOLOGICAL FACTORS ON TELOMERE LENGTH 34 TELOMERE LENGTH DYNAMICS IN LEUKOCYTES AND THEIR SUBSETS 36 CONCLUDING SUMMARY 39 ACKNOWLEDGEMENTS 40 REFERENCES 43
iii
ABSTRACT Telomeres are protective structures at the end of our chromosomes, composed of multiple repeats of the DNA sequence TTAGGG. They are essential for maintaining chromosomal stability by preventing damage and degradation of the chromosome ends. Telomeres are normally shortened with each cell division until a critical length is reached, at which stage cell cycle arrest is induced. Telomere shortening can be prevented in the presence of the telomere-‐elongating enzyme telomerase. Telomerase is expressed during embryogenesis and in certain normal cell types, but most somatic cells exhibit undetectable levels of telomerase activity. In contrast, most cancer cells express telomerase enabling them to proliferate indefinitely. There is a search for reliable molecular markers that can be used to help predict cancer risk and outcome. The interest of investigating telomere length as a potential biomarker in malignancy has grown rapidly, and both tumors and normal tissues have been in focus for telomere length measurements. In this thesis, telomere length was investigated in breast cancer patients and in patients with renal cell carcinoma (RCC). The breast cancer patients were found to have significantly longer mean telomere length in peripheral blood cells (i.e. immune cells) compared to a tumor-‐free control group. Moreover, patients with the longest blood telomere length had a significantly worse outcome compared to patients with shorter blood telomeres. In a patient group with clear cell RCC, telomere length was investigated in peripheral blood cells, in tumors and in corresponding kidney cortex. Again, patients with the longest blood telomere length had a significantly worse prognosis compared to those with shorter blood telomeres. In contrast, telomere length in tumor and kidney cortex tissues did not predict outcome per se. Immunological components may play a role in telomere length dynamics as well as in cancer development. We aimed to investigate a possible association between telomere length and certain immunological parameters, including various cytokines and peripheral levels of a blood cell type with suppressor function [regulatory T cells (Tregs)]. In our patients with clear cell RCC, three cytokines correlated significantly with tumor telomere length, but not with telomere length in peripheral blood cells. In a separate patient group with various RCC tumors, blood telomere length correlated positively with the amount of Tregs. It might be speculated that a subset of patients with long blood telomeres has a less efficient immune response due to high Treg levels, contributing to a worse prognosis. Another aim of this thesis was to explore telomere length changes over time. Evaluation of blood samples collected at a 6-‐month interval from 50 individuals, showed that half of the participants experienced a decline in mean telomere length during the time period. This group had longer telomere length at baseline compared to those who demonstrated increased/stable telomere length. In a separate group of five blood donors, a remarkable drop in telomere length was detected in one donor over a 6-‐month period, whereas the other donors exhibited only small fluctuations in telomere length. In conclusion, the results of this thesis indicate that blood telomere length has potential to act as an independent prognostic marker in malignancy. Adding to the complexity is the fact that changes in blood telomere length might occur within relatively short time spans, indicating that telomere length is a dynamic character.
iv
ORIGINAL ARTICLES
PAPER I Breast cancer survival is associated with telomere length in peripheral blood cells. Svenson U*, Nordfjäll K*, Stegmayr B, Manjer J, Nilsson P, Tavelin B, Henriksson R, Lenner P, Roos G. Cancer Res. 2008;68:3618-‐23. * Authors contributed equally PAPER II Telomere length in peripheral blood predicts survival in clear cell renal cell carcinoma. Svenson U, Ljungberg B, Roos G. Cancer Res. 2009;69:2896-‐901. PAPER III Telomere length in relation to immunological parameters in patients with renal cell carcinoma. Svenson U, Grönlund E, Söderström I, Sitaram RT, Ljungberg B, Roos G. Manuscript 2012; submitted. PAPER IV Blood cell telomere length is a dynamic feature. Svenson U, Nordfjäll K, Baird D, Roger L, Osterman P, Hellenius ML, Roos G. PLoS One. 2011;6:e21485.
v
LIST OF ABBREVIATIONS ALT Alternative lengthening of telomeres ANCOVA Analysis of covariance B-‐F-‐B cycle Breakage-‐fusion-‐bridge cycle ccRCC Clear cell renal cell carcinoma Ct Cycle threshold CV Coefficient of variation DSB Double-‐strand DNA breaks ER Estrogen receptor G-‐CSF Granulocyte colony-‐stimulating factor G-‐rich Guanine-‐rich HCC Hepatocellular carcinoma HCS Hematopoietic stem cell hTERT Human telomerase reverse transcriptase hTR Human telomerase RNA template IL Interleukin M cells Myeloid cells MCP-‐1 Monocyte chemotactic protein-‐1 MHC Major histocompatibility complex MIP-‐1β Macrophage inflammatory protein-‐1 beta NK cell Natural killer cell OR Odds ratio PAP Physical activity on prescription Q-‐FISH Quantitative fluorescence in situ hybridization RCC Renal cell carcinoma RTM Regression to the mean RT-‐PCR Real-‐time polymerase chain reaction SSB Single-‐strand DNA breaks STELA Single telomere length analysis TA Telomerase activity T/N Tumor to non-‐tumor TNM Tumor Node Metastasis Tregs Regulatory T cells TRF Terminal restriction fragment T/S ratio Telomere repeat copy number to single-‐copy gene copy number
vi
POPULÄRVETENSKAPLIG SAMMANFATTNING Inuti våra cellers cellkärna finns arvsmassan, DNA, innehållande gener som kodar för olika proteiner. DNA-‐strängarna är organiserade i så kallade kromosomer och i ändarna av dessa återfinns telomererna. Hos människan består telomererna av den repetitiva DNA-‐sekvensen TTAGGG tillsammans med associerade proteiner. Telomererna har en mycket viktig roll eftersom de skyddar kromosomändarna från att skadas och brytas ned. Inför varje celldelning kopieras kromosomerna i en process kallad replikation och under denna process sker i de flesta celler en förkortning av telomererna. Eftersom telomerer inte innehåller några informationsbärande gener förloras dock inget viktigt genetiskt material. Så småningom nås dock en kritisk telomerlängd där kromosomerna riskerar att skadas vid fortsatt förkortning. Då aktiveras speciella signalvägar som gör att cellen permanent slutar att dela sig. Vissa celler har dock förmågan att förhindra telomerförkortning genom att aktivera ett enzym, telomeras, som förlänger telomererna. Telomeras är inaktivt hos de flesta normala celler, med undantag för t.ex. stamceller, könsceller och vissa celler inom immunförsvaret. Däremot är telomeras aktivt i de flesta cancerceller, vilket gör att dessa celler kan bibehålla sina telomerer. På så sätt erhåller de potential att kunna dela sig i det oändliga. En rad faktorer tros ha en inverkan på telomerlängden, bland annat ärftlighet, hormoner, livsstil och omgivningsfaktorer. Generellt ses även en förkortning av telomerlängden med åldern, även om det råder stor spridning i telomerlängd mellan personer i samma åldrar. Cancer utgörs av en rad olika tumörsjukdomar (maligniteter) med det gemensamma att celler börjat dela sig okontrollerat på grund av förändringar/mutationer i arvsmassan. Godartade tumörer kallas benigna och växer lokalt, medan cancer utgörs av maligna tumörer med potentiell förmåga att sprida sig till andra vävnader i kroppen, s.k. metastasering. Det har länge pågått intensiv forskning kring att hitta pålitliga och lättanalyserade molekyler i kroppen, biologiska markörer, som kan förutsäga exempelvis insjuknanderisk, överlevnadstid (prognos) och/eller behandlingsresultat vid cancersjukdom. De senaste åren har allt fler forskare intresserat sig för om telomerernas längd kan agera biologisk markör vid en rad olika sjukdomar. Speciellt har intresset för att analysera telomerlängden i blodets celler, mer specifikt i blodets immunceller, ökat. Blod är en lättillgänglig vävnad och blodcellernas telomerlängd har visat sig korrelera med andra vävnaders telomerlängd. En rad studier har dessutom observerat signifikanta skillnader i medellängd mellan friska kontrollpersoners blodtelomerer och telomererna hos patienter med diverse åldersrelaterade sjukdomar, däribland cancer. Ett av målen med detta forskningsprojekt har varit att undersöka om telomerlängd kan ge information om risk och/eller prognos vid malignitet. Fokus har legat på telomerlängdsanalys hos patienter med nydiagnosticerad bröstcancer respektive njurcancer. I den första delstudien observerades att bröstcancerpatienter hade signifikant längre blodtelomerer jämfört med en tumörfri kontrollgrupp. Vidare visade sig patienterna med längst blodtelomerer ha en sämre prognos jämfört med patienter
vii
med kortare telomerlängd. I den andra delstudien, vilken inkluderade patienter med klarcellig njurcancer, analyserades telomerlängden dels i perifera blodceller, dels i tumörvävnad och i närliggande tumörfri njurvävnad. Liknande som för bröstcancerpatienterna fann vi att njurcancerpatienter med långa blodtelomerer hade en sämre överlevnadstid jämfört med patienter med kortare telomerer. I två olika cancergrupper visade sig alltså blodtelomerlängd bära på prognostisk information. Däremot var inte telomerlängden i tumörvävnad eller korresponderande tumörfri njurvävnad signifikant kopplad till prognos. Immunsystemet skyddar oss mot sjukdomsalstrande agens och tros även vara viktigt i vårt försvar mot cancer. Systemet är komplext och består av olika sorters immunceller och diverse molekyler. Komponenter inom immunförsvaret kan dock även orsaka vävnadsskada och vissa immunologiska faktorer tycks snarare gynna cancercellernas tillväxt än tvärtom. Vi spekulerade i att cancerpatienter med långa blodtelomerer eventuellt uppvisade sämre prognos på grund av ett mindre effektivt immunförsvar. Mindre aktiva immunceller bör, åtminstone i teorin, kunna bibehålla telomerlängden i högre grad på grund av färre celldelningar. Det finns speciella immunceller, regulatoriska T-‐celler (Tregs), med en hämmande funktion på delar av immunförsvaret. De tros bland annat skydda mot autoimmuna sjukdomar, men höjda nivåer av Tregs har också kopplats till sämre prognos i flera cancerstudier. I en av studierna i detta arbete fann vi att njurcancerpatienter med långa blodtelomerer tenderade att ha högre nivåer av T-‐regs, vilket stämmer med vår hypotes. Andra immunologiska komponenter kan också ha en inverkan på telomerlängden. Till exempel har en del signalmolekyler (cytokiner) inom immunförsvaret visat sig kunna stimulera telomeras. Vi mätte ett antal olika cytokiner hos vår patientgrupp med klarcellig njurcancer och fann att höjda nivåer av vissa cytokiner korrelerade med längre telomerer i tumörvävnaden. Ett ytterligare mål var att undersöka hur telomerlängden förändras över tid. På en grupp jämnåriga (och överviktiga) individer mättes telomerlängden i blodprov insamlade med 6 månaders intervall. Vi fann att hälften av individerna förkortade sina telomerer under denna period, medan övriga uppvisade stabil eller ökad telomerlängd. De individer med längst blodtelomerer vid första provtagningstillfället tenderade att förkorta sina telomerer mest och vice versa. Resultatet stämmer överens med en tidigare studie från vår forskargrupp där uppföljningstiden var längre (10 år). I en parallell studie på fem blodgivare fann vi att en av dessa blodgivare uppvisade en tydlig telomerförkortning under en 6-‐månadersperiod, medan övriga låg mer stabilt i sin blodtelomerlängd. Sammanfattningsvis tyder resultaten i denna avhandling på att blodtelomerlängd har potential att agera prognostisk markör vid cancersjukdom. Detta skulle i sin tur kunna ha betydelse för framtida behandlingsstrategier. En komplicerande faktor är dock att telomerlängden hos blodceller tycks kunna förändras under relativt korta tidsperioder. Av den anledningen är det sannolikt bäst att göra upprepade mätningar av en patients blodtelomerlängd.
1
I N T R O D U C T I O N TELOMERE BIOLOGY IT STARTS WITH THE END Telomeres are specialized chromosomal structures composed of tandem repeats of the DNA sequence "TTAGGG" together with specific proteins. The word telomere is derived from the Greek terms telos ("end") and meros ("part"), hence "end part". As the name hints, telomeres are located at the very end of eukaryotic chromosomes and they are essential for maintaining chromosomal stability. In humans, telomeres typically range between 5 to 15 kilobase pairs in length, and terminate in a guanine (G)-‐rich overhang of single stranded DNA [1]. Telomeric DNA is organized into loop structures which act as a protective cap, preventing chromosomal end-‐to-‐end fusions, rearrangements and exonucleolytic degradation (Figure 1) [1] [2]. Six proteins form a telomere-‐specific complex (the Shelterin complex), which promotes the formation and stabilization of these telomeric loops [2]. Normally, telomeres shorten with each cell division due to the inability of DNA polymerase to completely synthesize the lagging strand during DNA replication, the so called "end-‐replication problem" [3]. Approximately 50-‐200 base pairs are lost during each round of replication until, eventually, a critical length is reached (Hayflick's limit) [4] [5]. Functional telomeres prevent the chromosome ends from being recognized as DNA breaks by cellular DNA-‐repair systems. Critically short telomeres, however, are dysfunctional and are therefore detected as damaged DNA, leading to senescence (permanent cell cycle arrest) and/or cell death through apoptosis [6] [7]. Thus, a limited number of cell divisions can occur before senescence is triggered in a normal somatic cell. Telomere length is hence a determinant factor for cellular replicative capacity [5]. For this reason, telomeres are sometimes referred to as a "biological clock" of the cell.
2
Figure 1 – From chromosome to telomere. Simplified scheme showing the telomeric structure at the chromosome end. The G-‐rich single-‐stranded overhang is normally concealed inside the loop structure. THE TELOMERASE ENZYME The progressive loss of telomeric DNA with each cell division can be prevented in the presence of a telomere-‐elongating enzyme called telomerase [8] (Figure 2). Telomerase is a reverse transcriptase composed of the catalytic subunit hTERT and the RNA template hTR, and it acts by adding TTAGGG repeats onto the chromosome end [9]. hTR, in contrast to hTERT, is constitutively expressed in human cells; hTERT is therefore considered to be the rate-‐limiting determinant of telomerase activity [9]. Most somatic cells have undetectable levels of telomerase activity, but the enzyme is active during embryogenesis and in certain normal somatic cell types, such as germ cells, adult stem cells and in activated immune cells [10]. In addition, the majority of cancer cells (85-‐90%) [11] show telomerase activity, allowing them telomere maintenance, long-‐term growth and immortalization. Findings have indicated that telomerase acts preferentially on the shortest telomeres, most likely because these telomeres have a more disrupted structure and are more accessible to telomerase [12] [13]. There is no obvious correlation between telomere length and telomerase activity, as exemplified by the fact that most tumor cells have shorter telomeres than their corresponding normal tissue, despite telomerase activity [14].
3
Figure 2 – The telomerase enzyme. Telomerase consists of the catalytic subunit hTERT and the RNA-‐template hTR, together with associated proteins (not shown). The enzyme adds TTAGGG repeats to the 3’-‐end of telomeric DNA. FACTORS INFLUENCING TELOMERE LENGTH Telomeres differ considerably in length between individuals, across cell types and even among individual chromosome arms. At the same time, there is often a significant correlation in telomere length between different tissues within an individual [15] [16]. Several studies have indicated that telomere length is partly genetically determined and the heritability has been estimated to range from 36% to > 80% [17] [18] [19] [20] [21]. Both paternal and X-‐linked inheritance patterns have been proposed, but the paternal influence seems to be the strongest [20] [22] [23] [24]. A few loci believed to be of importance for telomere length variations have also been mapped [19] [21], but genes with direct effects on telomere length remain largely unknown. Plausible candidates are the two major genes associated with the telomerase enzyme (hTERT and hTR). Accordingly, it was recently reported that variations in these genes were associated with better telomere length maintenance [25]. However, it has also been shown that parent-‐child correlations of telomere length weaken with increasing age [24], supporting the notion that non-‐heritable/environmental factors influence telomere length dynamics during life. Apart from genetic factors, telomere maintenance is affected by e.g. oxidative
4
stress, hormones and epigenetic modifications of the chromatin [26]. Epigenetic events include telomeric histone modifications and DNA methylation of subtelomeric regions and there is evidence of an association between epigenetic alterations and telomere length deregulation [27]. Oxidative stress (i.e. imbalance between oxidative and antioxidative processes), which is often associated with inflammatory processes and tissue aging, is believed to be an important cause of telomere shortening [28]. Oxidative stress can cause DNA damage in several different ways, including oxidation of bases and formation of single/double-‐strand breaks (SSBs/DSBs) [29] [30]. Because of their G-‐richness, telomeres are highly sensitive to oxidative species [31] [32]. In addition, compared to the bulk of the genome, the repair of SSBs is less efficient in telomeres [33]. As a consequence, telomeric DNA is prone to enter replication with a higher degree of single-‐strand breaks, resulting in enhanced telomere shortening [30]. Oxidative stress has been linked to the pathology of a variety of diseases, including atherosclerosis, diabetes, neurodegenerative disorders, cancer and inflammatory diseases [34]. In accordance, such diseases have also been associated with alterations in telomere length [35]. As an example of hormonal impact, estrogen has been shown to influence telomere dynamics through several different mechanisms, including activation of the hTERT gene promoter, posttranscriptional regulation of hTERT and through antioxidative capacity [36] [37] [38]. Studies have also shown that women display longer telomeres than men and estrogen has been proposed as the most likely candidate for this gender difference [39] [40]. Components of the immune system may also influence telomere length dynamics. For example, several cytokines (i.e. signaling molecules involved in immune responses) have shown potential to activate the telomerase enzyme [41] [42] [43] [44] [45]. In recent years, a number of studies have shown that individuals with longer telomere length at baseline exhibit a faster telomere attrition rate compared to those with shorter baseline telomere length [46] [47] [48] [49] [50]. These findings may reflect a regulatory machinery giving priority to short telomeres and/or that long telomeres are more susceptible to telomere-‐damaging factors, such as oxidative stress. Altogether, the collected data indicate that telomere length is a complex trait determined by a variety of components, including genetic, epigenetic and environmental factors.
5
TELOMERE LENGTH IN PERIPHERAL BLOOD CELLS The hematopoietic and immune system -‐ an overview The blood system comprises a variety of different cell types, which can be broadly divided into red blood cells (erythrocytes), white blood cells (leukocytes) and platelets. These cells are all derived from common hematopoietic stem cells (HSCs) in the bone marrow. HSCs give rise to multipotent progenitors, which in turn give rise to oligopotent progenitors with more restricted lineage potential [51]. Ultimately, the different effector blood cells are formed, as illustrated by Figure 3.
Figure 3 -‐ Simplified diagram of hematopoiesis. The different peripheral blood cells are derived from lineage-‐committed progenitor cells (all not shown), which in turn originate from multipotent hematopoietic stem cells with self-‐renewal capacity.
6
Leukocytes, the cells of the immune system, derive from the myeloid and lymphoid lineages. More specifically, the myeloid progenitors give rise to granulocytes (i.e. neutrophils, basophils and eosinophils) and monocytes/ macrophages, whereas the lymphoid lineage produces T and B lymphocytes and natural killer (NK) cells [52]. Neutrophils normally accounts for 50-‐70% of the peripheral leukocytes, whereas circulating lymphocytes (the majority of which are T cells) comprise 20-‐40% of the blood leukocyte count. The immune system is a complex biological system that can be broadly classified into two branches: the innate and adaptive immune systems. Cells of the myeloid lineage, along with NK cells, are primarily involved in the innate immune response, serving as a first line of defense. Lymphocytes on the other hand are key players in the adaptive immune response, which relies on the recognition of specific antigens. These cells circulate between the blood and lymphoid organs throughout the body. Whereas B lymphocytes mature in the bone marrow, the maturation of T lymphocytes occurs in the thymus. T lymphocytes can be divided into two major groups: CD4+ T cells and CD8+ T cytotoxic cells. CD4+ T cells can be further subdivided into e.g. T helper subsets and regulatory T cells (Tregs). In brief, T helper cells are involved in the stimulation of cytotoxic T cells to destroy target cells infected with intracellular pathogens, and of B cells to produce pathogen-‐recognizing antibodies [53]. Tregs possess regulatory/suppressive properties and are of importance for peripheral self-‐tolerance and immune suppression [54]. Their suggested role in cancer disease will be discussed further below. Naïve mature lymphocytes are those that have not yet encountered foreign antigens. Upon contact with an antigen, an enormous number of effector cells are formed through clonal expansion of the selected naïve cell. When the immune challenge is eliminated most effector cells undergo apoptosis, but a few cells become long-‐lived memory cells that respond rapidly upon re-‐encounter with the same antigen [53]. Like other tissues, there are age-‐related changes of the immune system. For example, there is a shift in the proportion of different blood cell subpopulations with age, including a decrease in lymphocytes and an increase in monocytes, as well as a shift from naïve lymphocytes towards memory cells [55].
7
Blood telomere length in health and disease Blood telomere length, in this context referring to the telomere length of peripheral blood leukocytes, is often used as a proxy for telomere length in other normal tissues. As already mentioned, there is generally a good correlation in telomere length between different tissue compartments of an individual, and blood is an easily accessible tissue. For this reason, peripheral blood leukocytes have been in the focus of human telomere research for many years. Well-‐established features include large variations in mean blood telomere length between individuals of similar ages [17] [18] [56] [57] and a decline in telomere length over time [56] [58] [59] [60] [61], with the most rapid loss occurring during early childhood [57] [58]. Over the last decade, a large number of studies have associated alterations in blood telomere length to various age-‐related diseases, such as cardiovascular disease, diabetes and cancer [62] [63] [64] [65] [66] [67] [68]. Also lifestyle factors, such as physical activity, stress, smoking and socio-‐economic status, have been related to blood telomere length [69] [70] [71]. The majority of studies have found significant associations between short blood telomere length and disease, but the underlying mechanisms are not yet understood. Whether alterations in blood telomere length contribute directly to disease development, whether they reflect ongoing processes leading to disease or if the disease itself (or its treatment) causes changes in blood telomere length, remains to be further elucidated. It should also be mentioned that several studies have been unable to find any significant associations between blood telomere length and pathological conditions, as summarized in [72]. Telomeres and telomerase in blood cell subpopulations Clonal cell expansion is crucial for both B and T lymphocyte function and among the peripheral immune cells, only activated lymphocytes express telomerase activity [73]. These cells thus possess mechanisms for telomere maintenance, enabling them increased replicative potential. However, telomerase activity levels are not sufficient to fully inhibit telomere shortening [74]. Accordingly, memory T cells display shorter telomeres compared to their naïve counterparts [57] [75], indicating that T cell differentiation results in telomere shortening. B cells, on the other hand, exhibit a slower age-‐dependent telomere loss compared to T cells [59] [76] and telomeres in memory B cells have been found to be of similar length [77] [78] or even longer [59] than in naïve B-‐cells. These findings suggest that B cells employ
8
different mechanisms for telomere maintenance compared to T-‐cells [59] [78]. In contrast to lymphocytes and bone marrow progenitor cells, mature cells of the myeloid lineage do not undergo cell proliferation and show no expression of telomerase [79]. Telomere shortening in these cells therefore reflects telomeric loss at the progenitor cell level [26]. In accordance, the telomere length of bone marrow progenitor cells was found to correlate strongly to blood granulocyte telomere length but more weakly (although significantly) to the telomere length of lymphocytes [80]. Furthermore, granulocytes have been shown to display longer telomeres than lymphocytes in adults, and also to exhibit a slower age-‐dependent decline in telomere length [40] [57] [81]. Thus, telomeres vary in length among different immune cell subsets. Blood/leukocyte telomere length therefore represents the average telomere length of a heterogeneous group of blood cells.
9
APPROACHES FOR TELOMERE LENGTH ESTIMATION – A SUMMARY There are several methods in use for telomere length analysis. Table 1 provides a summary of advantages and disadvantages for each method. Southern blot is often described as the golden standard for telomere length measurements. In this method, DNA is cut in the subtelomeric regions by restriction enzymes to generate terminal restriction fragments (TRF). In brief, the cut DNA is separated by electrophoresis, transferred to a membrane and hybridized with a labeled telomere-‐specific probe. The resulting smear-‐like signal is converted into an actual telomere length in kilo base pairs by using various algorithms. The method is for example useful when comparing telomere lengths between and within different cell populations. A widely used approach for telomere length evaluation is the qPCR-‐based method originally developed by Richard Cawthon in 2002 [82]. This method, sometimes referred to as "Tel-‐PCR", is based on a primer design with flapping 3' ends, minimizing the risk of primer dimer formation. The method provides a ratio between the telomere repeat copy number (T) and single-‐copy gene copy number (S), which is proportional to the average telomere length. T/S ratios of unknown samples are compared to the T/S ratio of a reference DNA, generating relative values of telomere lengths. Hence, a relative telomere length value of 1 means that the sample DNA has the same T/S ratio as the reference DNA. More recently a promising multiplex version of this method was presented by Cawthon, showing a high reproducibility and a strong correlation to the Southern blot method [83]. A slot blot technique, in which denatured and filter cross-‐linked DNA is hybridized to a labeled telomere-‐specific probe, has been presented as a useful method for estimation of telomeric DNA content in formalin fixed and paraffin embedded tissues [84] [85]. Extracted DNA from such tissues is often of poor quality, making Southern blot and qPCR less suitable. The slot blot method at least provides a rough estimation of tissue telomere lengths. In Q-‐FISH (quantitative fluorescence in situ hybridization), telomeres can be visualized and quantified in metaphase spreads and interphase cells by measuring the fluorescence signal from a telomeric peptide nucleic acid probe [86] [87]. Flow-‐FISH, which is based on flow cytometric analysis, is a suitable method for telomere length analysis of cells in suspension [88] [89]. FISH and immunostaining can also be performed simultaneously, making it possible to identify specific cell types among a mixture of cells.
10
Finally, STELA (single telomere length analysis) is a PCR-‐based technique for analysis of individual telomeres, taking advantage of chromosome specific subtelomeric regions [90]. TABLE 1 -‐ A summary of methods for telomere length assessment
METHOD ADVANTAGES DISADVANTAGES Southern blot analysis
"Golden standard"; generates telomere length distributions in kilobase pairs.
Time-‐consuming; requires large amounts of DNA (5-‐10 µg); the subtelomeric region is included; variability in interpretation across laboratories.
qPCR (Tel-‐PCR)
Large sets of samples can be analyzed within relatively short time spans; requires small amounts of DNA (ng range).
Standard protocols are lacking and results are presented differently across laboratories; does not provide actual telomere lengths but rather the mean relative telomere content of a sample.
Slot blot assay
Can be used on fixed tissues where the DNA quality is poor; requires low amounts of DNA.
Provides the mean telomere content, not actual lengths; no detection of cell type-‐specific telomere lengths.
Q-‐FISH
Telomeres can be analyzed in fixed tissues and in a cell-‐specific manner; informative in analyses of metaphase spreads and interphase cells.
Many factors can affect the hybridization process; difficult to compare results across laboratories; does not provide actual telomere lengths.
Flow-‐FISH
Useful for telomere length analysis of hematopoietic cells in suspension; provides telomere length distributions; cells can be analyzed in combination with immunostaining.
Laborious; cannot be performed on fixed tissues.
STELA
Detects the telomere length of individual chromosomes; possible to visualize extremely short telomeres.
Laborious; primers have not been developed for all chromosome arms; difficult to analyze very long telomeres.
Modified after ref. [91]
11
TUMOR BIOLOGY THE HALLMARKS OF CANCER Cancer comprises a complex and diverse group of diseases with multifactorial origins. A large amount of data suggest that malignant cells arise through multistep events, reflecting an accumulation of genetic alterations, such as deletions, translocations or amplifications of DNA sequences, as well as epigenetic alterations. These changes might result in a loss of tumor suppressors and activation of oncogenes, leading to an uncontrolled cell cycle. In the year of 2000, Hanahan and Weinberg proposed six hallmarks of cancer which together enable malignant growth: evasion of growth suppressors, self-‐sufficiency in growth signals, ability to resist cell death, ability to induce angiogenesis, gain of replicative immortality, and ability of tissue invasion and metastasis [92]. These capabilities provide the basis for understanding the development and progression of diverse human tumors. Recently, the same authors presented two additional (emerging) hallmarks: deregulation of energy metabolism and evasion of immune destruction [93]. In addition, "genome instability and mutation" and "tumor-‐promoting inflammation" were described as enabling characteristics, underlying the cancer hallmarks. An overview of all proposed features is presented in Figure 4. TUMORS AND TELOMERES Telomere dysfunction has dual roles in carcinogenesis since it can either trigger or suppress tumor growth [14] (Figure 5). If functional DNA damage pathways are present, cells with critically short telomeres enter replicative senescence, which thus functions as an important tumor suppressor mechanism. However, cells with inactivated cell cycle checkpoints might circumvent this barrier and continue to divide with extremely short telomeres, along with an accumulation of genetic alterations. One mechanism through which telomeric loss causes genomic instability is via the breakage-‐fusion-‐bridge (B-‐F-‐B) cycle, which involves the fusion of uncapped chromosome ends and subsequent breakage during mitosis [94]. Since breakage occurs at a position other than the fusion site, one chromosome will experience a gain of DNA while the other will have a loss of DNA. Cells with disabled checkpoints accumulate chromosomal aberrations through recurrent B-‐F-‐B cycles, eventually leading to a crisis phase in which most cells die [94]. On rare occasion, a few cells are able to escape
12
from crisis by activating mechanisms for telomere stabilization, either through reactivation of telomerase or, more rarely, through Alternative lengthening of telomeres (ALT) which involves homologous recombination [95]. The ability of maintaining telomeres through these mechanisms is a typical feature of cancer cells, enabling them indefinite growth [96]. Gain of replicative immortality is also one of the hallmarks of cancer, as described above.
Figure 4 -‐ The hallmarks of cancer. In 2011, Hanahan and Weinberg added two "emerging hallmarks" and two "enabling characteristics" to their proposed list of common cancer traits, believed to underlie tumor development and progression [93].
Several studies have reported that telomere length in solid tumors has potential to act as a prognostic biomarker, as summarized in previous and recent reviews [68] [91] [97]. The average telomere length of a tumor reflects the combined result of various tumor-‐associated factors with impact on telomere homeostasis, which might vary depending on the specific tumor type and the tumor microenvironment. The majority of studies have shown significant associations between altered tumor telomere length and a poorer clinical outcome, but the direction of the alterations (i.e. short vs. long telomere length) appears to be tissue dependent. At the present time, the underlying mechanisms are unclear and remain to be further elucidated.
13
Figure 5 -‐ The dual role of telomere shortening in carcinogenesis. Telomere shortening to a critical length normally induces replicative senescence, causing cells to stop dividing. However, short telomeres are also associated with increased genomic instability and in the absence of functional cell cycle checkpoints, senescence may be circumvented. Subsequent activation of telomerase (or more rarely ALT) leads to telomere stabilization and limitless growth capacity, which is characteristic for cancer cells. (Figure modified after ref. [98].) THE IMMUNE SYSTEM AND CANCER During the last decade it has become clear that the immune system plays an essential role in cancer disease, but the role seems to be double-‐edged. On one hand, cells of the immune system might limit cancer development by recognizing and destroying tumor cells (so called immune surveillance). On the other hand, tumor cells can modify the immune reactivity, promote inflammation and gain ability to evade immune destruction [93]. Data from immunosuppressed patients have revealed significant increases in the incidence of a variety of tumors [99], supporting the theory that a healthy immune system is important for cancer protection. Cavallo et al. recently described three major immune hallmarks of cancer, namely the ability to thrive in a chronically inflamed microenvironment, ability to evade immune recognition, and ability to suppress immune reactivity [100]. Mechanisms for evading immune recognition include downregulation of glycoproteins of the
14
major histocompatibility complex (MHC) located on the cell membrane, thereby inhibiting the recognition of MHC-‐associated tumor peptides by T cells [100]. Suppression of immunological reactivity can be achieved by the recruitment of regulatory T cells. As mentioned above, Tregs are suppressive cells involved in the protection against autoimmunity, but they are also believed to be key players in establishing tumor immune tolerance [54]. Increased levels of Tregs have been detected in a variety of cancers [101] and they are thought to act through several mechanisms, including cytolytic activity, secretion of immunosuppressive mediators [e.g. interleukin (IL)-‐10 and transforming growth factor (TGF)-‐β], metabolic disruption of effector T cells, and suppressive interactions with dendritic cells [54] [102]. Another feature of cancerous tissue is the presence of a variety of cytokines secreted by cells in the tumor microenvironment and by the tumor cells themselves. The role of these cytokines in carcinogenesis is dual: they might inhibit tumor growth by mediating anti-‐tumor responses, but their presence might also contribute to create a tumor-‐favorable microenvironment [103] [104]. As an example, IL-‐6 has been shown to stimulate tumor growth and metastasis in several different cancers [105]. In summary, the role of the immune system in cancer disease is highly complex and there seems to be a delicate balance between antitumor activities versus tumor-‐promoting events.
15
SPECIFIC TUMOR TYPES Breast cancer Breast cancer is the most common cancer among women worldwide, affecting approximately 1 million individuals each year [106]. Nearly 8000 women are every year diagnosed with the disease in Sweden, and although the mortality has decreased (the 5-‐year survival rate being almost 90% today), the incidence has increased during the past 20 years [107]. Well known risk factors for developing breast cancer include age, a family history of breast cancer and factors associated with reproduction and estrogen exposure (such as early menarche, late menopause, nulliparity and hormone replacement therapy) [108]. Most breast cancer cases are sporadic, suggesting that lifestyle and/or environmental factors are of importance in breast cancer etiology [109] [110]. Mutations in the BRCA1 and BRCA2 genes are the most well known hereditary causes of breast cancer and associated with high-‐risk genetic predisposition [111]. An important part of breast cancer diagnostics is the triple test, including clinical examination of the breast (and lymph nodes), radiologic examination and fine needle aspiration/biopsy for histological examination [112] [113]. The most common morphological subtype, invasive ductal carcinoma, is derived from glandular ducts of the breast and accounts for ~ 75% of all breast cancers. Invasive lobular carcinoma, which arises from the lobular units of the breast glands, is the second most common subtype (5-‐15 %) [114]. Breast cancer treatment relies on surgical removal of the tumor (and sometimes axillary dissection), in combination with radiotherapy and/or systemic therapy, such as chemotherapy, endocrine treatment and targeted drugs. 70-‐80% of all breast carcinomas express the estrogen receptor (ER) and require estrogen for cell proliferation and survival [115]. The goal with endocrine therapy is therefore to block the ER or to decrease circulating estrogen levels. The monoclonal antibody Trastuzumab is an example of targeted therapy. The drug is directed against the HER2 receptor, which is overexpressed in 15-‐30% of breast cancers and associated with a worse prognosis [116]. TNM stage, i.e. primary tumor size (T), lymph node status (N) and presence of distant metastasis (M), is a well-‐established and important prognostic tool in breast cancer (as well as in other malignancies) and influences the choice of
16
treatment. However, in order to identify prognostically important subgroups, additional parameters are needed. One such parameter is the Nottingham histological grade system, which provides a combined score based on the amount of gland formation, nuclear atypia and mitotic activity [117]. Other prognostic and/or treatment predictive parameters include age, estrogen and progesterone receptor status, HER2 status and levels of the proliferation marker Ki67. In addition, lifestyle factors such as physical activity, diet and weight have been related to prognosis [118]. Still, since breast cancer comprises a heterogeneous group of tumors with varying characteristics and survival patterns, an important goal within the field of breast cancer research is to find reliable and useful biomarkers for early detection, prognosis and treatment response in breast cancer subgroups. Renal cell carcinoma Renal cell carcinoma (RCC) of the kidney accounts for ~ 2-‐3 % of all human cancers worldwide [119]. In Sweden, more than 1000 individuals are diagnosed with the disease each year, with a male-‐to-‐female ratio of ~ 2:1 [107]. Hereditary forms account for only 2-‐4 % of all RCC [120]. The majority of cases are thus sporadic and several risk factors have been identified, including cigarette smoking, obesity and hypertension [121]. The classic triad of hematuria, flank pain and abdominal mass is present in only a small fraction (10%) of the patients at diagnosis. Instead, symptoms (if present) are often diffuse and more than 50 % of the RCC tumors are detected incidentally through radiographic examination [122]. RCC is associated with a high mortality rate and approximately one third of the patients have advanced disease/distant metastases at diagnosis [122]. Similar to other cancers, RCC comprises a heterogeneous group of tumors with differences in genetics and clinical behavior. Clear cell RCC (ccRCC) is the most common histological subtype, representing 75-‐80 % of all RCC. The majority of these tumors carry a deletion of the von Hippel-‐Lindau (vHL) suppressor gene on chromosome 3p [123] [124]. Inactivation of this gene causes accumulation of hypoxia inducible factor (HIF)-‐1α, which in turn leads to various HIF-‐related events, including induction of angiogenesis via the vascular endothelial growth factor (VEGF) [125]. In accordance, ccRCC tumors are typically highly vascular. Although ccRCC is the most common form of RCC, several other histological subtypes exist. According to the Heidelberg classification, these are papillary RCC (10-‐15%), chromophobe RCC (5%), collecting duct RCC (<1%) and unclassified RCC (3-‐5%) [126].
17
Curative RCC treatment is only possible in patients with localized disease and requires complete removal of the tumor. Radical nephrectomy, which involves resection of kidney, perirenal fat and ipsilateral adrenal gland (often in combination with lymphadenectomy), is the most common approach. Nephron-‐sparing surgery is an alternative procedure, typically reserved for patients with small tumors or for patients with poor renal function or solitary kidney [127]. An obstacle to successful treatment of more advanced disease is the fact that RCC tumors are radioresistant [128] and show poor response to chemotherapy [129]. Cytokine therapy with IL-‐2 and interferon-‐α has been tried in metastatic RCC, but this treatment is fairly toxic [130] [131]. Emerging treatment strategies instead focus on targeting agents, such as anti-‐VEGF monoclonal antibodies [132] [133], multikinase inhibitors [134] and inhibitors of the mTOR pathway [135] [136]. TNM stage is the most important prognostic tool in RCC. Additional parameters in use (among others) include histological cell type, nuclear grade, vascular invasion and hemoglobin levels [127]. Due to the diverse features and unpredictable nature of RCC tumors, there is an intense search for better and more informative biomarkers. Although a large number of molecular markers have been investigated, including various tumor tissue-‐derived, immunologic and blood/urine-‐based markers, there is still a lack of clinically validated biomarkers in RCC at the present time [137] [138].
18
AIMS GENERAL AIM
In recent years, telomere length has gained considerable attention as a potential biological marker in a variety of diseases, cancer included. The work of this thesis has been centered around telomere length research, with a special focus on telomere length dynamics and role as a potential biomarker in cancer disease. SPECIFIC AIMS PAPER I: To investigate blood cell telomere length as a potential marker of risk and/or prognosis in breast cancer patients. PAPER II: To investigate telomere length in peripheral blood cells, tumor tissue and corresponding kidney cortex in relation to survival in patients with clear cell renal cell carcinoma. PAPER III: To investigate telomere length in relation to immunological components in patients with renal cell carcinoma. PAPER IV: To investigate changes in blood cell telomere length over time.
19
MATERIALS AND METHODS
STUDY POPULATIONS AND TISSUE SAMPLES All samples were obtained after informed consent and ethical approval. Paper I The patient group consisted of 265 newly diagnosed breast cancer patients (median age 57 years) referred to the Oncology Clinic at Umeå University Hospital, Västerbotten County, Sweden. All patients were untreated except for surgical removal of the tumor and blood samples were collected within 3 months after morphological diagnosis. Date of diagnosis ranged from 1990 to 2006. The control material consisted of two population-‐based groups (median age 55 years), both representative for the general population of Sweden: 300 women from the Northern Sweden MONICA study [139] and 146 women from the Malmö Cancer and Diet Study [140]. Data regarding ER status, tumor size and nodal status were collected from the clinical charts at the Oncology Clinic, Umeå University Hospital. Information regarding cause of death was obtained from clinical charts and death certificates with the last follow-‐up in May 2007. DNA was extracted from buffy coats (i.e. leukocytes) collected from breast cancer patients and controls of the MONICA study, and from granulocyte preparations collected from controls of the Malmö Cancer and Diet study. Paper II A total of 105 patients (61 men and 44 women, median age 65 years) with newly diagnosed clear cell RCC were included in the study. Date of diagnosis ranged from 2001 to 2007. All patients were nephrectomized at the Department of Urology, Umeå University Hospital, Umeå, Sweden. No other treatment had been given prior to blood sampling. Staging was performed according to the 2002 TNM classification system [141], nuclear grading was performed according to Fuhrman et al. [142] and histological subtype was defined according to the Heidelberg consensus [126]. Survival data were obtained from clinical charts and death certificates with the last follow-‐up in March 2008. DNA was extracted from buffy coats and from freshly frozen tissues (tumors and corresponding kidney cortex).
20
Paper III Two patient groups were included in this study, all referred to the Department of Urology, Umeå University Hospital, Umeå, Sweden. The first patient group consisted of the same ccRCC patients as described in Paper II. Serum samples for cytokine analysis were available for 102 of these patients. In addition, CHAPS (zwitterionic detergent) extracts from 35 patients were available for telomerase activity analysis. The second patient group comprised 51 patients (30 men and 21 women, median age 68 years) with RCC tumors diagnosed between 2008 and 2010. Tumor subtypes included clear cell RCC (n = 32), papillary RCC (n = 9), chromophobe RCC (n = 2) and oncocytoma (n = 8). All blood samples were collected prior to any therapy, except for surgical removal of the tumor. Paper IV The study encompassed three separate groups of individuals. The "6-‐month study" comprised 56 individuals (age 68 or 69), all sedentary, overweight and with abdominal obesity. Blood samples (whole blood) were collected twice from each individual with a 6-‐month interval. During this period, half the group received physical activity on prescription whereas the other half received minimal intervention in the form of written information about physical activity [143]. Samples from 6 individuals were later excluded due to unsuccessful qPCR, whereas the remaining 50 individuals were included in the statistical analysis. The "10-‐year study" consisted of 31 individuals (all aged ≥ 60 years to match the ages of the 6-‐month study) originally included in a previously described larger (n = 959) longitudinal study on telomere length dynamics (for more detailed information, see [46]). Data for the 31 individuals were re-‐analyzed regarding telomere length changes over time and compared with data from the 6-‐month study. The "Blood donor study" comprised blood samples (peripheral blood mononuclear cells) from five blood donors (one women and four men), with baseline ages ranging from 26 to 43 years. Samples were collected at three different occasions from each blood donor, with intervals ranging from 2 to 25 months.
21
MAGNETIC IMMUNE CELL SEPARATION (PAPER III) In paper III, leukocytes were separated into immune cell subsets using Dynabead-‐coupled antibodies (Dynal Biotech Dynabeads, Norway) against T cell marker CD3 (Cat.No. 111.51) and B cell marker CD19 (Cat.No 111.43), according to the supplier's protocol. The method is based on magnetic separation technology. DNA extraction was thereafter performed on the resulting cell fractions [T cells, B cells and the remaining myeloid (M) cells] and on whole blood. DNA was purified using the BioRobot M48 Workstation with MagAttract technology (Qiagen, Germany). A few samples were excluded due to poor DNA yield. The remaining samples were included in the telomere length analysis described below (whole blood: n = 50, B-‐fraction: n = 44, T-‐fraction: n = 50, M-‐fraction: n = 47). TELOMERE LENGTH MEASUREMENTS Telomere real-‐time PCR (Paper I-‐IV) In all papers, telomere length was assessed by a real-‐time PCR (qPCR) method first described by Richard Cawthon in 2002 [82], and later slightly modified in our lab [22] [144]. The method uses a primer design that minimizes the risk of primer dimer products. The single-‐copy gene human beta-‐globin (HBG) was used in order to normalize DNA loading. Telomere and HBG primer sequences were: CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT (Tel1b),
GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT (Tel2b),
TGTGCTGGCCCATCACTTTG (HBG3),
ACCAGCCACCACTTTCTGATAGG (HBG4).
Two 96-‐well plates were prepared for each experiment, one using telomere primers to determine the cycle threshold (Ct) value for telomere amplification, and one using HBG primers to determine the Ct value for control gene amplification. Telomere/single copy gene (T/S) values were then calculated using the formula T/S = 2-‐ΔCt, where ΔCt = average Cttelomere− average CtHBG. Relative T/S values were generated by dividing sample T/S values with the T/S value of a reference cell line DNA (CCRF-‐CEM) included in all plates. The reference DNA was also used for standard curve construction in order to monitor the PCR efficiency of each run.
22
Prior to analysis, all samples were diluted to 1.75 ng/μl in TE buffer containing Escherichia coli DNA (a genome without telomeres) (Sigma Aldrich) to stabilize the PCR reactions. Samples were thereafter denatured at 95°C and cooled at 4°C. Each sample was loaded in triplicate in optical 96-‐well plates (17.5 ng DNA/aliquot) for qPCR analysis. A negative control was included in all runs. For a detailed description of PCR reagents and cycling conditions, see [144]. All qPCR amplifications were performed in an ABI Prism 7900 HT sequence detection system (Applied Biosystems), and results were analyzed with the ABI Prism 7900 SDS Software (v.2.1-‐2.4) (Applied Biosystems). The mean inter-‐assay coefficient of variation (CV) for the method ranges between 4–8% in our laboratory [145] [146]. Southern Blot (paper IV) Six DNA samples from the Blood donor study were selected for Southern blot analysis. Briefly, DNA samples were cut over night with Hinf I and separated by electrophoresis on an agarose gel. The DNA was transferred to a Hybond-‐XL membrane (GE Healthcare/Amersham Biosciences, Sweden) and the membrane was air-‐dried and UV cross-‐linked. After pre-‐hybridization in QuikHyb solution (Stratagene, USA), a mixture of 32P-‐end labeled (TTAGGG)4-‐probe and salmon sperm DNA was added to the solution and hybridized to the DNA. After washing, the membrane was exposed to a phosphor screen and scanned in a Typhoon 9400 imager (GE Healthcare/Amersham Biosciences, Sweden). Single telomere length analysis (STELA) (paper IV) Six DNA samples from the 6-‐month study and five DNA samples from the Blood donor study were selected for telomere length analyses at the XpYp telomeres, using a modification of the STELA assay previously described [90] [147]. In brief, genomic DNA was digested by EcoRI, quantified and diluted in Tris-‐HCl. A Telorette2 linker was ligated to the telomere ends, and multiple PCR reactions were carried out with a Teltail primer (complementary to the linker) and a chromosome-‐specific telomere-‐adjacent primer, in order to amplify the XpYp telomeres. All PCR reactions were performed using an MJ PTC-‐225 thermocycler (MJ research). Thereafter, DNA fragments were resolved by agarose gel electrophoresis and detected by two separate Southern hybridizations with a random-‐primed α-‐33P labeled (Amersham Biosciences, UK) telomere repeat probe and a telomere-‐adjacent probe, along with
23
molecular weight marker probes. Subsequent phosphorimaging was performed with a Molecular Dynamics Storm 860 phosphorimager (Amersham Biosciences, UK) and molecular weights of the DNA fragments were calculated using the Phoretix 1D quantifier (Nonlinear Dynamics, UK). TELOMERASE ACTIVITY (PAPER III) CHAPS extracts (250 ng/sample) from 35 ccRCC tumors were evaluated for telomerase activity with a quantitative telomerase detection (QTD) kit (Allied Biotech Inc, USA). Assays were performed according to the manufacturer's protocol, using the ABI Prism 7900 HT sequence detection system (Applied Biosystems) for real-‐time PCR amplification. The QTD kit also includes a TSR control template to be used as a positive control and for standard curve construction. Telomerase activity was evaluated using ABI Prism SDS Software 2.4 (Applied Biosystems). FLOW CYTOMETRY (PAPER III) One of the aims in paper III was to measure peripheral levels of Tregs in patients with RCC tumors. For this purpose, blood samples were analyzed by flow cytometry for immunophenotyping. All analyses were performed within 24 (-‐ 48) hours from blood sampling. Fluorochrome-‐labeled monoclonal antibodies were targeted against: CD8-‐FITC (BDBiosciences), CD127-‐PE (BDPharmingen), CD4-‐PerCp (BDBiosciences), CD19-‐PECy7 (Beckman Coulter), CD25-‐APC (BDBiosciences), CD3-‐APCAlexa 750 (Beckman Coulter), CD16-‐Pacific Blue (BDBiosciences) and CD45-‐AmCyan (BDBiosciences). Briefly, 50 µl of each blood sample was incubated with antibodies. Samples were then lysed with ammonium chloride, followed by repeated centrifugation and washing in PBS. Analyses were performed on a FACSCantoII flow cytometer with the FACSDiva software (BD Biosciences). Lymphoid cells were identified according to their strong CD45 expression and low side scatter and Tregs were identified as the CD4+CD25highCD127low/-‐ cell subset population. MULTIPLEX CYTOKINE ANALYSIS (PAPER III) Cytokines from 102 ccRCC patients were analyzed in previously stored serum samples. A 17-‐plex human cytokine panel was used with the Bio-‐PlexTM Suspension Array System (Bio-‐Rad, Hercules, USA). The following cytokines
24
were included in the 17-‐plex panel: IL-‐1β, IL-‐2, IL-‐4, IL-‐5, IL-‐6, IL-‐7, IL-‐8, IL-‐10, IL-‐12, IL-‐13, IL-‐17, granulocyte colony-‐stimulating factor (G-‐CSF), granulocyte-‐macrophage colony-‐stimulating factor (GM-‐CSF), interferon-‐gamma (IFN-‐γ), monocyte chemotactic protein-‐1 (MCP-‐1), macrophage inflammatory protein-‐1 beta (MIP-‐1β) and tumor necrosis factor-‐alpha (TNF-‐α). Assays were performed according to the manufacturer’s instructions, except that each serum sample was diluted 1:3 in sample diluent [148]. An internal control, consisting of four pooled patient serum samples, was included in each run. All samples were assayed in duplicate and analyzed with a Luminex 200 Labmap system (Luminex, Austin, USA). Data was evaluated using the Bio-‐Plex Manager software version 4.1.1 (Bio-‐Rad). Three patients were found to be extreme high outliers and were removed from further analysis. The remaining 99 patients were included in the statistical calculations. STATISTICAL ANALYSIS SPSS version 15.0 (Paper I-‐II) or PASW statistics 18.0 (Paper III-‐IV) were used for statistical analyses. Continuous data were checked for normality (and ln-‐transformed if required) before using parametric tests. Nonparametric tests were used when data were not normally distributed and/or samples sizes were small. Correlations between continuous variables were investigated with Pearson's correlation coefficient, Spearman’s rank correlation or partial correlation with covariate adjustment. Odds ratios for breast cancer risk (paper I) were calculated by binary logistic regression. Between-‐group differences were investigated by Student's t-‐test (paired or unpaired), Mann-‐Whitney U-‐test or ANCOVA (analysis of covariance) with covariate adjustment. Survival analysis was performed using Kaplan-‐Meier with the log-‐rank test and hazard ratios were obtained by multivariate Cox regression analysis. Statistical significance refers to P ≤ 0.05 (two-‐tailed).
25
RESULTS
The main results for each paper are presented below. More detailed data and figures can be found in the original articles of this thesis. PAPER I Telomere length in peripheral blood is associated with risk and outcome in breast cancer patients. In paper I, the ability of blood telomere length to predict cancer risk and survival was explored in patients with breast cancer, the most common malignancy in women worldwide. In total, 265 newly diagnosed breast cancer patients and 446 female controls were included in the study. Both groups showed a significant age-‐dependent decline in telomere length. However, the breast cancer patients displayed significantly longer blood telomere length compared to controls, regardless of age. Adjusted odds ratios (OR) for breast cancer risk were found to increase with increasing telomere length, with a maximal OR of 5.17 for the quartile with the longest telomeres. Interestingly, we also found that blood telomere length was a predictive factor for cancer-‐specific death. Patients < 50 years of age (approximate menopausal age) with telomere lengths above median had a significantly worse outcome compared to patients with shorter telomeres. For patients ≥ 50 years of age a trend towards a similar pattern was observed. Analyses of subgroups based on tumor size and nodal status (two established prognostics factors) showed that telomere length carried prognostic information for patients with advanced disease. More specifically, long blood telomeres were associated with a worse survival among node-‐positive patients and patients with a tumor size above median. Telomere length was not related to survival in node-‐negative patients or in patients with smaller tumors, but due to few events in these groups the statistical calculations should be interpreted with caution. Multivariate Cox regression analysis, including age, blood telomere length, nodal status and tumor size, verified blood telomere length as a significant independent prognostic factor. Blood telomere length was also investigated in relation to ER status. The mean telomere length value was slightly higher in the ER+ group compared to the ER-‐ group, but the difference was not statistically significant. In both groups, telomere lengths above median were associated with a worse outcome.
26
PAPER II Blood telomere length, in contrast to telomere length in tumors and kidney cortex, predicts survival in clear cell renal cell carcinoma. The aim of paper II was to investigate whether telomere length can be a predictor for survival in newly diagnosed patients with clear cell RCC, the most common form of kidney cancer. The study included 105 patients, 61 men and 44 women. Telomere length was evaluated in peripheral blood cells as well as in tumor samples and in corresponding kidney cortex. Comparison between the three tissue compartments showed that tumor samples displayed significantly shorter telomeres compared to kidney cortex and blood. In addition, blood telomeres were significantly shorter than the telomeres of kidney cortex. At the same time, all three tissues were found to correlate positively with each other regarding telomere length. In contrast, no significant correlations were observed between telomere length values and various clinical parameters, such as haemoglobin, albumin or erythrocyte sedimentation rate. Tumor size, however, correlated positively with tumor telomere length and tumor/non-‐tumor (T/N) telomere ratio. An age-‐dependent decline in telomere length was observed in all tissue compartments. As expected, established prognostic parameters (such as TNM stage, nuclear grade and anaemia) were associated with survival in our patient group. Interestingly, and similar to our breast cancer patients, blood telomere length was also associated with outcome. Patients with long blood telomere length (4th quartile) had a significantly poorer outcome compared to patients with shorter telomeres, irrespective of age. Analysis restricted to subgroups revealed a highly significant association between long blood telomeres and poor survival among non-‐metastatic patients, whereas patients with distant metastasis had a poor outcome regardless of the telomere length status. Blood telomere length was verified as an independent prognostic factor in a multivariate Cox regression model, including age, TNM stage and blood telomere length. In contrast, telomere length in tumor tissue or kidney cortex could not predict outcome per se. There was, however, a trend to shorter survival in patients with a high T/N telomere ratio.
27
PAPER III Telomere length is associated with immunological parameters in patients with renal cell carcinoma. Immunological components are of importance in cancer disease and may also influence telomere length. One of the aims of paper III was to investigate peripheral levels of various cytokines in relation to telomere length in peripheral blood, ccRCC tumors and corresponding kidney cortex, using the same group of ccRCC patients as described in paper II. In addition, we hypothesized that our previous findings of an association between long blood telomeres and a poorer cancer-‐specific survival could reflect a suppressed immune system (with fewer cell divisions) in a subset of our patients. We therefore investigated telomere length in whole blood and in blood cell subpopulations in relation to peripheral levels of Treg cells (CD4+CD25highCD127low/-‐). 99 ccRCC patients of the cytokine study were included in the statistical evaluation. Among the seventeen cytokines analysed, eight analytes were detected above threshold in ≥ 10 % of the patients and were included for further statistical evaluation. These were IL-‐5, IL-‐6, IL-‐7, IL-‐8, IL-‐10, G-‐CSF, MCP-‐1 and MIP-‐1β. Three of these cytokines (IL-‐7, IL-‐8 and IL-‐10) showed a significant positive correlation with tumor telomere length and with T/N telomere ratio. No significant correlations were found between cytokine levels and telomere length of peripheral blood cells or normal kidney cortex. Tumor telomerase activity (TA) could be measured in only a subset of the patients (n = 35). In these patients, tumor TA was found to correlate inversely to the cytokines IL-‐7 and IL-‐8, as well as to T/N telomere ratio. In contrast, no significant correlations were observed between tumor TA and telomere lengths in blood, kidney cortex or tumors. The Treg study comprised 51 RCC patients with various RCC subtypes, the majority with clear cell RCC (n = 32). Calculations were performed on the total group in order to gain more statistical power, but restricting the analyses to the ccRCC subgroup did not change the results. Data evaluation revealed that whole blood and the M cell fraction displayed significantly longer telomere length compared to the B and T cell fractions. No significant telomere length differences were observed between B and T cells, or between the M fraction and whole blood. An age-‐dependent decline in telomere length was found among the T cells, but not in the other cell fractions.
28
Interestingly, peripheral Treg levels correlated positively with whole blood telomere length. Furthermore, the strongest correlation was found between Treg levels and telomere length of the T cell fraction. Thus, patients with a higher number of Tregs had longer T cell telomeres. In contrast, no significant correlations were observed between Tregs and telomere length of the other cell subsets (B and M cells). PAPER IV Peripheral blood telomeres fluctuate in length over time and marked changes can occur within months. Telomere length is believed to be influenced by a number of factors, intrinsic as well as extrinsic. In a previous longitudinal study with approximately 10 years follow-‐up time [46], we showed that the rate of telomere shortening in blood cells was associated with baseline telomere length. More specifically, individuals with long telomeres at baseline exhibited the most pronounced telomere shortening and vice versa. In paper III, we aimed to further investigate blood telomere length changes over time, using shorter follow-‐up periods. In our 6-‐month study, 50 individuals (15 men and 35 women) were included in the statistical analysis. All participants were of a similar age (68-‐69 years) and overweight. Blood samples had been collected twice at a 6-‐month interval, during which period half of the group received physical activity on prescription (PAP) and the other half minimal intervention treatment. Statistical evaluation showed no significant differences between the PAP vs. minimal intervention groups regarding baseline or follow-‐up telomere lengths. Further statistical calculations were therefore performed on the group as a whole. Among the 50 individuals, 25 exhibited a decrease in telomere length over time whereas 25 displayed elongated/stable telomeres. The latter group had significantly shorter median telomere length at baseline compared to those who experienced telomere shortening. Correlation analysis revealed significant correlations between monthly telomere changes and baseline telomere length, which is in concordance with our previous longitudinal 10-‐year study [46]. We therefore reanalyzed data from that study, including only individuals ≥ 60 years of age to better match the ages of the 6-‐month study. The monthly telomere changes were found to be considerably smaller in the 10-‐year study compared to the 6-‐month study. At the same time, telomere length values at baseline correlated significantly with follow-‐up values in the 6-‐month study,
29
but not in the 10-‐year study. No significant correlations were observed between telomere length and body mass index (BMI), neither at baseline nor at follow-‐up. We also investigated telomere length dynamics in a separate material consisting of five blood donors. Three samples collected at different occasions with varying time spans were available from each donor. In the first evaluation round, telomere length was measured by qPCR. Four of the donors exhibited only small fluctuations in telomere length over time, but one donor showed a marked decrease in telomere length over a 6-‐month period. This finding was further evaluated by additional methods for telomere length measurements (Southern blot and STELA), generating similar results. For the donor with a marked loss in telomere length, there was a considerable decrease in telomere heterogeneity over the 6-‐month period, with a noteworthy loss of the longest telomeres.
30
DISCUSSION BLOOD TELOMERE LENGTH AS A RISK MARKER IN MALIGNANCY (PAPER I) Over the last decade, telomere length has gained considerable attention as a potential marker of cancer risk. Two meta-‐analyses were recently published regarding telomere length in surrogate tissue (predominantly peripheral blood cells) and associations with cancer [149] [150]. For the majority of cancer types investigated, e.g. kidney, bladder and gastric cancers, significant associations between short telomere length and cancer risk were reported. However, the results from this research field are not uniform and for breast cancer in particular the results are highly inconsistent. Our finding of an association between long blood telomere length and increased risk of breast cancer was recently supported by Gramatges et al. [151]. Similarly to our observation, they found that breast cancer patients had significantly longer blood telomere length than unaffected controls, with an increasing risk for breast cancer for each longer quartile. In contrast, other studies have observed either no association between telomere length and breast cancer risk [152] [153] [154] [155] or an increased (but not always statistically significant) risk among breast cancer patients with short telomere lengths [152] [156] [157]. The conflicting results may have several causes and various plausible explanations have been presented. One potentially important factor is differences in the study design. For example, the two meta-‐analyses mentioned above found that the association of telomere length and risk of various cancers were stronger in retrospective studies compared to prospective studies. The latter study type is considered more powerful, less potentially biased and better suited for examining a possible exposure-‐disease relationship. On the downside, it requires a more costly and time-‐consuming design and the number of prospective studies within the field are sparse (as summarized in refs. [158] and [159]). Another possible explanation for the inconsistent data includes differences in the methodology used for telomere length measurements. Although qPCR has been the method of choice in the majority of studies, standardized protocols are lacking. In addition, some studies have measured telomere length in buffy coats or whole blood, others in lymphocytes or other specific blood cell subtypes. Another important factor to consider is the timing for sample collection. In our breast cancer study, only untreated patients (except for surgical removal of the tumor) were included and all blood samples were collected within 3 months after morphological diagnosis. None of the patients had received radiotherapy or systemic therapy
31
prior to blood sampling, factors that may have an impact on telomere length dynamics [160] [161] [162] [163]. Several retrospective studies lack information on the timing of sample collection or treatment initiation, and it cannot be ruled out that reverse causation bias influenced the associations observed in some of these studies. Telomere shortening might thus have occurred predominantly after diagnosis as a result of e.g. treatment effects. Other contributing factors to the discrepancy could be differences regarding sample size or tumor type, measurement errors, and variability in potentially confounding factors. Nevertheless, several plausible biological mechanisms have been presented to explain the observed associations between altered blood telomere length and cancer risk. As mentioned in the introduction, there is a connection between short telomeres and genetic instability. The genetic disorder dyskeratosis congenita, which is characterized by e.g. bone marrow failure, is associated with very short telomeres and a significantly increased (11-‐fold) risk of cancer [164]. Bladder cancer, which is a smoking-‐related cancer, has been associated with short blood telomere length in several studies [149] [150]. It is possible that telomere shortening in these patients reflects an increased burden of oxidative stress due to smoking [165]. As for long blood telomere length and increased cancer risk, we speculated that prolonged estrogen exposure could be an important factor in our breast cancer study, since breast cancer is a hormone-‐related cancer. Several studies have reported that women display longer telomere length than men [39] [166] [167] [168] [169] [170]. In addition, postmenopausal women receiving hormone replacement therapy were found to have significantly longer telomeres compared to those without such treatment [171]. As previously mentioned, estrogen has the ability to up-‐regulate telomerase and it is also capable of reducing oxidative stress [36] [37] [38]. In our breast cancer group, women with ER+ breast cancer had slightly longer mean telomere length compared to ER-‐ patients, but the difference was not statistically significant. Long blood telomere length has also been associated with increased risk of melanoma [172], hepatocellular carcinoma [173] and non-‐Hodgkin lymphoma [174]. It has been suggested that long telomeres may favor delayed cell senescence due to enhanced replicative potential, thereby increasing the risk of acquiring genetic abnormalities along the way [158] [174]. However, the exact role of telomere length in surrogate tissues in relation to cancer risk remains largely unknown and the cause-‐and-‐effect question remains open. To further explore this topic, large prospective studies are warranted. In a previous longitudinal study conducted by our group [46], blood telomere length was evaluated at baseline and after approximately 10 years follow-‐up time, where after controls were compared with those who
32
had developed cancer after the second blood draw. Surprisingly, we could not detect any significant differences in blood telomere length or attrition rates between the control and patient groups. However, the latter group comprised patients with a variety of different cancers. Thus, there is still the possibility that altered blood telomere length is associated with increased risk of specific tumor types. A recent longitudinal study by Cui et al. [175] showed that both very short and very long blood telomere lengths were associated with increased risk of colorectal cancer, adding further complexity to the issue. Still, whether an altered blood telomere length reflects an overall altered telomere profile, whether it is a marker of immune dysfunction and/or whether the cancer disease itself affects the telomere length of leukocytes (or their progenitors) remains to be further explored. TELOMERE LENGTH AS A PROGNOSTIC INDICATOR FOR CANCER SURVIVAL (PAPER I + II) There is growing evidence that telomere length has potential to act as a prognostic marker in malignancy. The majority of studies have focused on telomere length investigations in tumor samples, and the research field has been previously reviewed [68] [91] [97]. Many of these studies have reported associations between altered tumor telomere length and a poorer outcome, but the type of alteration (long or short telomere length) seems to depend on the histological type of tumor. For example, short tumor telomere length was related to a poor outcome in sarcoma [176], and reduced telomere DNA content (measured by a slot blot method) was associated with a worse survival in breast and prostate cancer [177] [178] [179] [180] [181]. As for hematological malignancies, the collected data indicate that short telomere length is coupled to progressive disease and a worse outcome [68]. In contrast, long tumor telomere length and a high T/N telomere ratio have been associated with advanced disease in patients with e.g. hepatocellular carcinoma [182], colorectal carcinoma [183] [184], head and neck tumors [185] and Barrett carcinoma [186]. In our patients with ccRCC (paper II), the majority of tumors displayed significantly shorter telomeres than the corresponding tumor-‐free kidney cortex, which is consistent with previous results in various cancer types [14]. Surprisingly, tumor telomere length per se was not associated with survival when comparing patients with long vs. short telomere length (based on quartiles). We did, however, observe a trend towards a poorer outcome in
33
patients with an increased T/N telomere ratio. In addition, both tumor telomere length and T/N telomere ratio correlated positively and significantly with tumor size, suggesting that long tumor telomere length might reflect telomere stabilization and tumor progression. One of the main aims of paper I and II was to investigate blood telomere length as a possible prognostic tool in malignancy. In contrast to tumor tissue, blood is easily accessible, minimally invasive and inexpensively collected. As discussed above, a large number of studies have investigated blood telomere length as a possible marker of cancer risk. However, studies investigating the prognostic value of this parameter in cancer patients were previously lacking. Most interestingly, we found that blood telomere length carried independent prognostic information in both breast cancer (paper I) and ccRCC (paper II). More specifically, patients with long blood telomeres had a worse survival in both patient groups. In our breast cancer patients, the association between blood telomere length and outcome was strongest for node-‐positive patients and for patients with large tumors, whereas the prognosis was good regardless of the telomere length status in patients with local disease/small tumors. Our ccRCC patients with metastatic disease showed a generally poor outcome and blood telomere length was not associated with survival in this group. Instead, blood telomere length was found to be a significant prognostic marker in nonmetastatic patients. Consistent with our findings in breast and kidney cancer, Liu et al. [187] recently reported that hepatocellular carcinoma (HCC) patients with long blood telomeres had a poorer survival. Furthermore, the association was strongest in patients with large tumors, which is in accordance with our findings in the breast cancer group. In addition, and similar to our observations, blood telomere length was unrelated to various clinical features. Together, these findings indicate that leukocyte telomere length may serve as a prognostic biological marker in various cancer types. Assessing this parameter might hence be helpful in identifying subgroups of patients with a poorer/better outcome, which in turn could influence the choice of treatment. A complicating factor, however, is the large variation in blood cell telomere length among individuals of the same age, making it difficult to set a reference range for "normal" vs. "pathological" telomere lengths. An important question is therefore to what extent blood telomere length can be informative not only at a group level, but also at the individual level. Further research is needed to clarify this issue. The reason behind the observed association between long leukocyte telomeres and a poorer survival remains to be clarified as well. We speculated that immunological components, such as cytokines and suppressive immune cells, could be of importance and in paper III we aimed to explore this hypothesis further.
34
THE IMPACT OF IMMUNOLOGICAL FACTORS ON TELOMERE LENGTH (PAPER III) The immune system plays a complex role in cancer since it can be involved in antitumoral responses, as well as in tumor progression. There is also a link between immunological components and telomere length homeostasis. For example, oxidative stress (which is associated with chronic inflammation) can cause enhanced telomere shortening, whereas several cytokines appear capable of inducing telomerase expression [41] [42] [43] [44] [45]. In recent years, the role of suppressive Treg cells in cancer disease has gained considerable attention. They are believed to be important for self-‐tolerance but there is also growing evidence that Tregs suppress antitumoral immunity and promote tumor growth [54], and they have been detected in increased levels in a variety of cancers [101]. Based on our findings in paper I and II, where significant associations were observed between long blood telomere length and poorer cancer-‐specific survival, we speculated that a subset of patients could have a suppressed immune response, e.g. through the action of Tregs. At least in theory, decreased proliferation of immune cells would lead to less telomere attrition. We also hypothesized that a relationship might exist between serum levels of cytokines and telomere length of peripheral leukocytes and tumor tissue. Interestingly, we found that three cytokines (IL-‐7, IL-‐8 and IL-‐10) correlated significantly and positively with tumor telomere length and T/N telomere ratio in our ccRCC patients. As with other correlation analyses, the observed correlations reveal nothing about cause and effect, but it cannot be excluded that a functional link exists between these parameters. We also found that IL-‐7, IL-‐8 and T/N telomere ratio were significantly associated with tumor telomerase activity. However, these correlations were all inverse. Hence, the relationship between the above-‐mentioned cytokines and tumor telomere length does not seem to be explained by increased telomerase activity. As for tumor telomere length and telomerase activity, a trend towards a negative correlation was observed. This might seem contradictory, but telomerase expression does not necessarily correlate positively with telomere length. In fact, negative correlations between these variables have been observed in e.g. hematologic malignancies [188] [189]. In contrast to the tumor tissue, no significant associations were observed between serum cytokines and telomere length of leukocytes or nontumorous kidney cortex. Although we cannot exclude that associations might exist
35
between cytokines and telomere length of specific immune cell subsets, the investigated cytokines do not seem to explain the association between long blood telomeres and a poor survival in ccRCC. In our parallel Treg study, encompassing patients with various RCC subtypes, Treg cells were analyzed by flow cytometry and defined as the CD4+CD25highCD127low/-‐-‐cell subset. Tregs are comprised of at least two subtypes, natural and inducible Tregs, which both express the forkhead transcription factor Foxp3 (a nuclear protein) [190]. Compared to cell surface staining, intracellular staining is a more time-‐consuming process. In recent years the cell surface marker CD127 (the IL7-‐receptor α chain) has proven useful in distinguishing Tregs from activated conventional T-‐cells, showing a significant inverse correlation with Foxp3 expression [191] [192] [193] [194]. We therefore used the CD4+CD25highCD127low/-‐ -‐phenotype when defining the Treg population. Most interestingly, and in line with our hypothesis, peripheral Treg levels correlated positively with leukocyte telomere length. This finding is also consistent with recent observations from Liu and colleagues [187]. As mentioned above, Liu et al. found that long blood telomere length was associated with poor survival in HCC patients. However, they also found that patients with long blood telomeres had increased levels of Tregs. In our study, telomere length was measured not only in whole blood but also in immune cell subsets. Of special interest is our observation that Treg levels correlated most strongly with the telomere length of the T cell subset. Effector T cells are important targets for Treg-‐mediated suppression and the association is therefore plausible. It is also reasonable to think that a suppressed immunological response with fewer cell divisions could result in less telomere shortening and reduced antitumoral activity. Taken together, the results of paper III indicate that immunological components, such as cytokines and Tregs, are associated with telomere length in patients with RCC. Although not providing any definite answers, our Treg findings may give a clue to our observation that long blood telomere length is associated with a poorer cancer survival.
36
TELOMERE LENGTH DYNAMICS IN LEUKOCYTES AND THEIR SUBSETS (PAPER III + IV) Leukocytes constitute a heterogeneous group of blood cells with different immunological functions. When telomere length is analyzed in whole blood or buffy coats (the leukocyte concentrate), the received data therefore represent the average telomere length of a diverse set of cells. As discussed in the introduction, telomere length dynamics differ between different immune cell subsets. In paper III, significantly longer mean telomere length was found in whole blood and in the myeloid cell fraction (predominantly granulocytes) compared to the lymphocyte fractions (B and T cells), which is in line with previous findings [40] [57] [81]. The result is also in accordance with our observation in paper I, where no difference in mean telomere length was found between the MONICA controls (buffy coats) and the controls of the Malmö diet and cancer study (granulocytes). Granulocyte telomere length has been shown to correlate highly with the telomere length of myeloid bone marrow cells [80], and it can be assumed to reflect the proliferation and replicative history of hematopoietic progenitor cells. The age-‐dependent decline seems to follow a biphasic curve in both lymphocytes and granulocytes, with the fastest decline occurring in newborns and in the elderly [195]. Additionally, previous reports have shown that the decline in telomere length with age is more rapid in lymphocytes compared to granulocytes [40] [57] [81]. This may partly be explained by the increase in memory T cell number with age, since memory T cells have shorter telomeres compared to naïve T cells [57] [75]. In contrast, memory B cells have similar or even longer telomere lengths compared to their naïve counterpart [59] [77] [78]. In the patient group with various RCC tumors in Paper III, only T cell telomere length was significantly associated with age. Further, no significant difference in mean telomere length was found between the B and T cell fractions, but the inter-‐individual variation in telomere length was larger within the B cell fraction. The lack of correlation between whole blood telomere length and age could partly be due to the relatively small sample size, since significant age-‐related correlations were found in our larger breast cancer and ccRCC patient groups (Paper I and II respectively). Nevertheless, the overall pattern regarding telomere length differences in immune cell subsets in our RCC patients is similar to the findings of previous studies with healthy individuals. In recent years, a growing number of studies have reported significant associations between baseline telomere length and telomere attrition rates
37
[46] [47] [48] [49] [50], showing that individuals with longer telomeres tend to exhibit a faster age-‐dependent decline in telomere length. In our previous study with 10 years follow-‐up time [46], a strong correlation between these two parameters were observed. We speculated that the results might reflect a telomere maintenance machinery giving priority to short telomeres and/or that long telomeres are more susceptible to e.g. oxidative stress, leading to faster telomere shortening. In paper IV, we again observed significant correlations even though the follow-‐up time was considerably shorter (6 months) and the group of participants was much smaller and more homogenous (all of similar age and obese). No differences were observed between individuals receiving physical activity on prescription vs. those receiving minimal intervention treatment. In the whole group of fifty individuals, half of the participants experienced telomere shortening (as compared to two-‐third in the 10-‐year study). In a recent diabetes prevention study from Finland [50], in which overweight individuals with impaired glucose tolerance were randomized into either a lifestyle intervention group or a control group (receiving general dietary/lifestyle advice), leukocyte telomere length was found to increase in two-‐thirds of the participants over a 4.5 year period, with similar patterns in both groups. Individuals with the shortest baseline telomeres exhibited the largest increase in telomere length. The results are similar to our findings of paper IV, but the underlying mechanisms remain unclear. What should also be pointed out is that, although the correlation between baseline telomere length and monthly changes was statistically significant in the 6-‐month study, the correlation was far from absolute. Hence, not all individuals with longer blood telomeres experienced a more rapid telomere shortening compared to those with shorter telomeres. Interestingly, however, the monthly changes were larger in the 6-‐month study compared to the 10-‐year study. As mentioned already, the actual telomere length is the result of various factors with impact on telomere length homeostasis, such as telomerase expression, replication rates, oxidative stress etc. There is also a large heterogeneity in telomere length at individual chromosome ends within a cell [195]. At a population level, the collected data from the field indicate that leukocyte telomere length shortens with age. At the individual level, mean blood telomere length appears to follow a more oscillating pattern, which levels out at longer follow-‐up periods. Even though the majority of individuals are likely to exhibit only small fluctuations over shorter time spans, our findings in paper IV indicate that some individuals might experience marked telomere length changes within months. In the blood donor study, one donor exhibited a substantial decrease in telomere length over a 6-‐month period where after the telomere length
38
remained stable over the following 12 months. The qPCR result was further confirmed by Southern blot and STELA. By permitting analysis of individual chromosome arms (XpYp), STELA revealed a considerable decrease in telomere heterogeneity and a loss of the longest telomeres. An important question to address is whether additional factors might have influenced or confounded the estimated blood telomere length values. For example, a change in the proportion of different immune cell subsets between two samplings may, at least in theory, affect the average telomere length of a blood sample. In a recent review [196], potential mechanisms behind leukocyte telomere lengthening are discussed. The author suggests that telomerase-‐mediated lengthening could be called “actual lengthening”, whereas an observed increase in telomere length due to a redistribution of leukocyte subsets might be called “pseudo-‐lengthening”. Another factor to consider is "regression to the mean" (RTM) -‐ a statistical phenomenon where random variations in repeated data looks like real changes [197]. More specifically, if an extreme value is generated in the first analysis due to measurement error, the second analysis is likely to generate a value closer to the mean. There are strategies to avoid a potential RTM, e.g. by a randomized design and by using the mean of multiple measurements [197]. For this reason, each sample was analyzed twice at different occasions in the 6-‐month study and the mean value of the two qPCR measurements was used. In the blood donor study, each sample was measured three times. The mean inter-‐assay coefficient of variation (CV) was low (6.7% and 5.3% respectively), indicating a high reproducibility for the method. The reliability of the qPCR method has been a topic of discussion among researchers within the field, and standardized protocols are warranted. The method, however, is well established in our lab, generating satisfactory intra-‐ and inter-‐assay CVs [145] [146] [198] and correlating very well with the Southern blot method [199]. Nevertheless, when investigating telomere length changes between different time points, the variability of available measurement techniques should also be taken into account, along with other factors that might influence the analysis. In summary, the results of paper III and IV support previous findings that leukocyte telomere length is a complex trait, showing a dynamic character and differing between immune cell subsets. To what extent e.g. lifestyle changes, ageing and disease may affect telomere length dynamics in these cells remain to be further elucidated, preferably by using a study design where telomere length is measured repeatedly over time.
39
CONCLUDING SUMMARY • Significantly longer blood telomere length was found in our breast cancer
patients compared to controls. Breast cancer risk increased with increasing telomere length, with the highest risk for the quartile with the longest telomeres. At the present time, the collected results from this research area are inconsistent and large prospective studies are warranted to elucidate the role of blood telomere length as a potential marker of breast cancer risk.
• Blood telomere length was found to be an independent prognostic
indicator in both breast cancer patients and patients with RCC. For both cancer types, long blood telomere length was associated with a worse survival, indicating a potential role for this parameter as a prognostic marker in malignancy. Further research is needed in order to clarify whether blood telomere length may act as a prognostic tool also at the individual level.
• Significant associations were observed between certain immunological
components and telomere length in patients with RCC. More specifically, three cytokines (IL-‐7, IL-‐8 and IL-‐10) correlated positively with tumor telomere length. Moreover, whole blood and T cell telomere length showed significant positive correlations with peripheral levels of Treg cells. The association between increased Tregs and long blood telomere length might reflect a suppressed immune response with less cell proliferation (leading to decreased telomere shortening) and reduced antitumoral activity. The finding thus provides a possible underlying mechanism for our observation that long blood telomere length is associated with a poorer cancer survival.
• Changes in blood telomere length over a 6-‐month period were significantly
correlated with telomere length values at baseline and follow-‐up. In some individuals, marked changes in mean blood telomere length were observed within months, supporting the notion that leukocyte telomere length is a dynamic character.
• For blood telomere length to be informative at the individual level,
repeated measurements over time should be considered rather than measuring telomere length at a single occasion. Also, given the fact that leukocytes comprise a heterogeneous group of immune cells, telomere length analysis in specific blood cell subsets might be a preferable approach in future studies.
40
ACKNOWLEDGEMENTS
In English Research is all about teamwork and without the help and support from enthusiastic co-workers, this thesis would not have existed. Therefore, to all colleagues worldwide who have, in any way, been involved in my projects: THANK YOU! I would also like to express my gratitude to all my colleagues at the Department of Medical Biosciences for creating such an enjoyable and inspiring working environment. You rock! In Swedish Jag skulle ju varken bli forskare eller läkare...eller bo i Norrland. Tur livet inte alltid blir som man tänkt sig! :) Ett stort antal personer har betytt oerhört mycket för mig under mina år som doktorand i Umeå och jag vill därför rikta ett varmt tack till följande: Min handledare Göran Roos - Självfallet vill jag rikta det första och absolut största tacket till dig Göran! Under hela resans gång har du stått vid min sida och jag har alltid känt att jag kan prata med dig i alla lägen. Jag är även oändligt tacksam över att vi hittat vägar för att kunna kombinera mina doktorand- och läkarstudier. Ett STORT tack för allt! Börje Ljungberg - Vår trevliga samarbetspartner som hann bli officiell bihandledare lagom till disputationen. Tack för allt gott samarbete Börje! Roosgruppens medarbetare: Magnus B - Min trogna rumskompis som utan tvekan hör till de smartaste och roligaste personer jag känner. Tack för alla skratt, vintips och allmänt intelligenta kommentarer! Kattis N - Ex-labbpartner, mentor och "storasyster", som har bidragit med ovärderlig hjälp till detta arbete (och som tillsammans med maken Andreas dessutom förgyllde mina praktikveckor i Östersund). Tack för allt!
41
Helene S - Gruppens förträffliga nytillskott som jag lärt känna i rekordfart. Och min hittills enda walkie-talkie-kompis! Jag förstår inte hur jag klarat mig utan dig tidigare Helene!?! Sofie D - Oumbärlig gruppmedlem som ställer upp i alla lägen. Även känd som gruppens chokladoholic. Du är grym! Ravi - Rumskompis nummer två; alltid glad och hjälpsam och expert på de senaste Apple-prylarna. Emma A - Gruppens bak- och stickexpert! Emma, nu när din halvt utslagna tand fixats och min brutna näsa läkt kanske vi vågar börja träna med varandra igen? Linda K – Alltid lugn som en filbunke och en riktig hejare på gener! Pawel G - Ex-medlem, tidigare rumskompis och den snällaste ortopeden i stan! Aihong - Du är en riktig kämpe och vi håller alla våra tummar för dig! Pia O, Elisabeth G, Ingegerd S och Stamcellslabb – Stort tack för all labbhjälp! Och tack till alla andra trevliga som samarbetar med gruppen (Magnus H, Susann H, Statistik-Mattias och alla jag glömt nämna)! Tack även till Richard P - för att du alltid livar upp stämningen och för att du låtit bli att placera mig i källaren (trots upprepade hot :P) och till Thomas B - för att du tillslut fick mig att "vakna" och söka till läkarprogrammet! Jag har även lärt känna fantastiska människor på biomedicin- och läkarprogrammen. Utan er hade jag aldrig varit där jag är idag. Annalena L och Vincy E - Två av mina allra bästa vänner! I love you guys! Lisa W, Johan W och Fariba J - Ex-biomedicinare och mina (numera utexaminerade) "mentorer" på läkarprogrammet. Tack för oumbärlig hjälp och support!! Emma F, Anna S och Anna M - Mina hemskt trevliga fika-partners och de första läkarstudenter jag lärde känna. . Min nuvarande klass på läkarprogrammet och övriga vänner från biomedicin - Ni vet vilka ni är! Gänget på Farmakologen - Tack för att ni alltid får mig på gott humör! Speciellt tack till Stisse J - för att du är bäst helt enkelt! :)
42
Jag vill även rikta ett särskilt tack till alla fina människor som jag fått förmånen att jobba tillsammans med genom mina uppdrag för biomedicin- och läkarprogrammen. Ingen nämnd, ingen glömd! Och sist men förstås inte minst... Min familj, min släkt och mina vänner i Stockholm/Täby/Södern. Ni betyder ALLT! Mamma, Pappa, Patrik och Henke - Alltid stöttande, tröstande och närvarande - trots alla mil som skiljer oss åt! Min fantastiska släkt Johanna W - Min soulmate o tillika kusin. Annelie o Johan, Malin o Magnus, Maria F, Kattis G, Yvonne C - Förhoppningsvis vänner för livet! Karin H.E. - fantastisk (ex-)granne och nära vän till familjen. Eva o Oskar - Mina fina svärföräldrar. Min Gustav - The love of my life. Tack för att du står ut med mig precis som jag är! ♥
43
R E F E R E N C E S
1. Hug, N. and J. Lingner, Telomere length homeostasis. Chromosoma, 2006. 115(6): p. 413-‐25.
2. Palm, W. and T. de Lange, How shelterin protects mammalian telomeres. Annu Rev Genet, 2008. 42: p. 301-‐34.
3. Olovnikov, A.M., A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol, 1973. 41(1): p. 181-‐90.
4. Hayflick, L. and P.S. Moorhead, The serial cultivation of human diploid cell strains. Exp Cell Res, 1961. 25: p. 585-‐621.
5. Allsopp, R.C., et al., Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci U S A, 1992. 89(21): p. 10114-‐8.
6. Vaziri, H., Critical telomere shortening regulated by the ataxia-‐telangiectasia gene acts as a DNA damage signal leading to activation of p53 protein and limited life-‐span of human diploid fibroblasts. A review. Biochemistry (Mosc), 1997. 62(11): p. 1306-‐10.
7. d'Adda di Fagagna, F., et al., A DNA damage checkpoint response in telomere-‐initiated senescence. Nature, 2003. 426(6963): p. 194-‐8.
8. Greider, C.W. and E.H. Blackburn, Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell, 1985. 43(2 Pt 1): p. 405-‐13.
9. Cong, Y.S., W.E. Wright, and J.W. Shay, Human telomerase and its regulation. Microbiol Mol Biol Rev, 2002. 66(3): p. 407-‐25, table of contents.
10. Shay, J.W. and A.F. Gazdar, Telomerase in the early detection of cancer. J Clin Pathol, 1997. 50(2): p. 106-‐9.
11. Chen, C.H. and R.J. Chen, Prevalence of telomerase activity in human cancer. J Formos Med Assoc, 2011. 110(5): p. 275-‐89.
12. Samper, E., J.M. Flores, and M.A. Blasco, Restoration of telomerase activity rescues chromosomal instability and premature aging in Terc-‐/-‐ mice with short telomeres. EMBO Rep, 2001. 2(9): p. 800-‐7.
13. Hemann, M.T., et al., The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell, 2001. 107(1): p. 67-‐77.
14. Hackett, J.A. and C.W. Greider, Balancing instability: dual roles for telomerase and telomere dysfunction in tumorigenesis. Oncogene, 2002. 21(4): p. 619-‐26.
15. Friedrich, U., et al., Telomere length in different tissues of elderly patients. Mech Ageing Dev, 2000. 119(3): p. 89-‐99.
16. Gardner, J.P., et al., Telomere dynamics in macaques and humans. J Gerontol A Biol Sci Med Sci, 2007. 62(4): p. 367-‐74.
17. Jeanclos, E., et al., Telomere length inversely correlates with pulse pressure and is highly familial. Hypertension, 2000. 36(2): p. 195-‐200.
18. Slagboom, P.E., S. Droog, and D.I. Boomsma, Genetic determination of telomere size in humans: a twin study of three age groups. Am J Hum Genet, 1994. 55(5): p. 876-‐82.
44
19. Andrew, T., et al., Mapping genetic loci that determine leukocyte telomere length in a large sample of unselected female sibling pairs. Am J Hum Genet, 2006. 78(3): p. 480-‐6.
20. Njajou, O.T., et al., Telomere length is paternally inherited and is associated with parental lifespan. Proc Natl Acad Sci U S A, 2007. 104(29): p. 12135-‐9.
21. Vasa-‐Nicotera, M., et al., Mapping of a major locus that determines telomere length in humans. Am J Hum Genet, 2005. 76(1): p. 147-‐51.
22. Nordfjall, K., et al., Telomere length and heredity: Indications of paternal inheritance. Proc Natl Acad Sci U S A, 2005. 102(45): p. 16374-‐8.
23. Nawrot, T.S., et al., Telomere length and possible link to X chromosome. Lancet, 2004. 363(9408): p. 507-‐10.
24. Nordfjall, K., et al., Large-‐scale parent-‐child comparison confirms a strong paternal influence on telomere length. Eur J Hum Genet, 2010. 18(3): p. 385-‐9.
25. Atzmon, G., et al., Evolution in health and medicine Sackler colloquium: Genetic variation in human telomerase is associated with telomere length in Ashkenazi centenarians. Proc Natl Acad Sci U S A, 2010. 107 Suppl 1: p. 1710-‐7.
26. Kaszubowska, L., Telomere shortening and ageing of the immune system. J Physiol Pharmacol, 2008. 59 Suppl 9: p. 169-‐86.
27. Blasco, M.A., The epigenetic regulation of mammalian telomeres. Nat Rev Genet, 2007. 8(4): p. 299-‐309.
28. Saretzki, G. and T. Von Zglinicki, Replicative aging, telomeres, and oxidative stress. Ann N Y Acad Sci, 2002. 959: p. 24-‐9.
29. Mastalerz-‐Migas, A., et al., What influences the level of oxidative stress as measured by 8-‐hydroxy-‐2'-‐deoxyguanosine in patients on hemodialysis? J Physiol Pharmacol, 2006. 57 Suppl 4: p. 199-‐205.
30. Passos, J.F., G. Saretzki, and T. von Zglinicki, DNA damage in telomeres and mitochondria during cellular senescence: is there a connection? Nucleic Acids Res, 2007. 35(22): p. 7505-‐13.
31. Oikawa, S., S. Tada-‐Oikawa, and S. Kawanishi, Site-‐specific DNA damage at the GGG sequence by UVA involves acceleration of telomere shortening. Biochemistry, 2001. 40(15): p. 4763-‐8.
32. Henle, E.S., et al., Sequence-‐specific DNA cleavage by Fe2+-‐mediated fenton reactions has possible biological implications. J Biol Chem, 1999. 274(2): p. 962-‐71.
33. Petersen, S., G. Saretzki, and T. von Zglinicki, Preferential accumulation of single-‐stranded regions in telomeres of human fibroblasts. Exp Cell Res, 1998. 239(1): p. 152-‐60.
34. Durackova, Z., Some current insights into oxidative stress. Physiol Res, 2010. 59(4): p. 459-‐69.
35. Aviv, A., A.M. Valdes, and T.D. Spector, Human telomere biology: pitfalls of moving from the laboratory to epidemiology. Int J Epidemiol, 2006. 35(6): p. 1424-‐9.
36. Aviv, A., Telomeres, sex, reactive oxygen species, and human cardiovascular aging. J Mol Med (Berl), 2002. 80(11): p. 689-‐95.
45
37. Kyo, S., et al., Estrogen activates telomerase. Cancer Res, 1999. 59(23): p. 5917-‐21.
38. Kimura, A., et al., Induction of hTERT expression and phosphorylation by estrogen via Akt cascade in human ovarian cancer cell lines. Oncogene, 2004. 23(26): p. 4505-‐15.
39. Benetos, A., et al., Telomere length as an indicator of biological aging: the gender effect and relation with pulse pressure and pulse wave velocity. Hypertension, 2001. 37(2 Part 2): p. 381-‐5.
40. Aubert, G., et al., Collapse of telomere homeostasis in hematopoietic cells caused by heterozygous mutations in telomerase genes. PLoS Genet, 2012. 8(5): p. e1002696.
41. Akiyama, M., et al., Cytokines modulate telomerase activity in a human multiple myeloma cell line. Cancer Res, 2002. 62(13): p. 3876-‐82.
42. Hu, B.T. and R.A. Insel, Up-‐regulation of telomerase in human B lymphocytes occurs independently of cellular proliferation and with expression of the telomerase catalytic subunit. Eur J Immunol, 1999. 29(11): p. 3745-‐53.
43. Igarashi, H. and N. Sakaguchi, Telomerase activity is induced in human peripheral B lymphocytes by the stimulation to antigen receptor. Blood, 1997. 89(4): p. 1299-‐307.
44. Kawauchi, K., K. Ihjima, and O. Yamada, IL-‐2 increases human telomerase reverse transcriptase activity transcriptionally and posttranslationally through phosphatidylinositol 3'-‐kinase/Akt, heat shock protein 90, and mammalian target of rapamycin in transformed NK cells. J Immunol, 2005. 174(9): p. 5261-‐9.
45. Wallace, D.L., et al., Prolonged exposure of naive CD8+ T cells to interleukin-‐7 or interleukin-‐15 stimulates proliferation without differentiation or loss of telomere length. Immunology, 2006. 119(2): p. 243-‐53.
46. Nordfjall, K., et al., The individual blood cell telomere attrition rate is telomere length dependent. PLoS Genet, 2009. 5(2): p. e1000375.
47. Aviv, A., et al., Leukocyte telomere dynamics: longitudinal findings among young adults in the Bogalusa Heart Study. Am J Epidemiol, 2009. 169(3): p. 323-‐9.
48. Ehrlenbach, S., et al., Influences on the reduction of relative telomere length over 10 years in the population-‐based Bruneck Study: introduction of a well-‐controlled high-‐throughput assay. Int J Epidemiol, 2009. 38(6): p. 1725-‐34.
49. Farzaneh-‐Far, R., et al., Telomere length trajectory and its determinants in persons with coronary artery disease: longitudinal findings from the heart and soul study. PLoS One, 2010. 5(1): p. e8612.
50. Hovatta, I., et al., Leukocyte telomere length in the Finnish Diabetes Prevention Study. PLoS One, 2012. 7(4): p. e34948.
51. Seita, J. and I.L. Weissman, Hematopoietic stem cell: self-‐renewal versus differentiation. Wiley Interdiscip Rev Syst Biol Med, 2010. 2(6): p. 640-‐53.
52. Weng, N.P., Telomeres and immune competency. Curr Opin Immunol, 2012. 24(4): p. 470-‐5.
46
53. Weng, N.P., Telomere and adaptive immunity. Mech Ageing Dev, 2008. 129(1-‐2): p. 60-‐6.
54. Facciabene, A., G.T. Motz, and G. Coukos, T-‐regulatory cells: key players in tumor immune escape and angiogenesis. Cancer Res, 2012. 72(9): p. 2162-‐71.
55. Sansoni, P., et al., The immune system in extreme longevity. Exp Gerontol, 2008. 43(2): p. 61-‐5.
56. Iwama, H., et al., Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum Genet, 1998. 102(4): p. 397-‐402.
57. Rufer, N., et al., Telomere fluorescence measurements in granulocytes and T lymphocyte subsets point to a high turnover of hematopoietic stem cells and memory T cells in early childhood. J Exp Med, 1999. 190(2): p. 157-‐67.
58. Frenck, R.W., Jr., E.H. Blackburn, and K.M. Shannon, The rate of telomere sequence loss in human leukocytes varies with age. Proc Natl Acad Sci U S A, 1998. 95(10): p. 5607-‐10.
59. Martens, U.M., et al., Telomere maintenance in human B lymphocytes. Br J Haematol, 2002. 119(3): p. 810-‐8.
60. Brummendorf, T.H., et al., Telomere length dynamics in normal individuals and in patients with hematopoietic stem cell-‐associated disorders. Ann N Y Acad Sci, 2001. 938: p. 293-‐303; discussion 303-‐4.
61. Robertson, J.D., et al., Dynamics of telomere shortening in neutrophils and T lymphocytes during ageing and the relationship to skewed X chromosome inactivation patterns. Br J Haematol, 2000. 109(2): p. 272-‐9.
62. Brouilette, S., et al., White cell telomere length and risk of premature myocardial infarction. Arterioscler Thromb Vasc Biol, 2003. 23(5): p. 842-‐6.
63. Brouilette, S.W., et al., Telomere length, risk of coronary heart disease, and statin treatment in the West of Scotland Primary Prevention Study: a nested case-‐control study. Lancet, 2007. 369(9556): p. 107-‐14.
64. Fitzpatrick, A.L., et al., Leukocyte telomere length and cardiovascular disease in the cardiovascular health study. Am J Epidemiol, 2007. 165(1): p. 14-‐21.
65. Samani, N.J., et al., Telomere shortening in atherosclerosis. Lancet, 2001. 358(9280): p. 472-‐3.
66. Gardner, J.P., et al., Rise in insulin resistance is associated with escalated telomere attrition. Circulation, 2005. 111(17): p. 2171-‐7.
67. Sampson, M.J., et al., Monocyte telomere shortening and oxidative DNA damage in type 2 diabetes. Diabetes Care, 2006. 29(2): p. 283-‐9.
68. Svenson, U. and G. Roos, Telomere length as a biological marker in malignancy. Biochim Biophys Acta, 2009. 1792(4): p. 317-‐23.
69. Valdes, A.M., et al., Obesity, cigarette smoking, and telomere length in women. Lancet, 2005. 366(9486): p. 662-‐4.
70. Cherkas, L.F., et al., The association between physical activity in leisure time and leukocyte telomere length. Arch Intern Med, 2008. 168(2): p. 154-‐8.
71. Epel, E.S., et al., Accelerated telomere shortening in response to life stress. Proc Natl Acad Sci U S A, 2004. 101(49): p. 17312-‐5.
47
72. Nordfjall, K., et al., Telomere length is associated with obesity parameters but with a gender difference. Obesity (Silver Spring), 2008. 16(12): p. 2682-‐9.
73. Hodes, R.J., K.S. Hathcock, and N.P. Weng, Telomeres in T and B cells. Nat Rev Immunol, 2002. 2(9): p. 699-‐706.
74. Bodnar, A.G., et al., Mechanism of telomerase induction during T cell activation. Exp Cell Res, 1996. 228(1): p. 58-‐64.
75. Weng, N.P., et al., Human naive and memory T lymphocytes differ in telomeric length and replicative potential. Proc Natl Acad Sci U S A, 1995. 92(24): p. 11091-‐4.
76. Son, N.H., et al., Lineage-‐specific telomere shortening and unaltered capacity for telomerase expression in human T and B lymphocytes with age. J Immunol, 2000. 165(3): p. 1191-‐6.
77. Weng, N.P., L. Granger, and R.J. Hodes, Telomere lengthening and telomerase activation during human B cell differentiation. Proc Natl Acad Sci U S A, 1997. 94(20): p. 10827-‐32.
78. Son, N.H., et al., Stable telomere length and telomerase expression from naive to memory B-‐lymphocyte differentiation. Mech Ageing Dev, 2003. 124(4): p. 427-‐32.
79. Weng, N., Interplay between telomere length and telomerase in human leukocyte differentiation and aging. J Leukoc Biol, 2001. 70(6): p. 861-‐7.
80. Spyridopoulos, I., et al., Telomere gap between granulocytes and lymphocytes is a determinant for hematopoetic progenitor cell impairment in patients with previous myocardial infarction. Arterioscler Thromb Vasc Biol, 2008. 28(5): p. 968-‐74.
81. Hoffmann, J., et al., Telomere length-‐heterogeneity among myeloid cells is a predictor for chronological ageing. Exp Gerontol, 2009. 44(5): p. 363-‐6.
82. Cawthon, R.M., Telomere measurement by quantitative PCR. Nucleic Acids Res, 2002. 30(10): p. e47.
83. Cawthon, R.M., Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res, 2009. 37(3): p. e21.
84. Bryant, J.E., et al., Measurement of telomeric DNA content in human tissues. Biotechniques, 1997. 23(3): p. 476-‐8, 480, 482, passim.
85. Fordyce, C.A., C.M. Heaphy, and J.K. Griffith, Chemiluminescent measurement of telomere DNA content in biopsies. Biotechniques, 2002. 33(1): p. 144-‐6, 148.
86. Martens, U.M., et al., Short telomeres on human chromosome 17p. Nat Genet, 1998. 18(1): p. 76-‐80.
87. Poon, S.S., et al., Telomere length measurements using digital fluorescence microscopy. Cytometry, 1999. 36(4): p. 267-‐78.
88. Rufer, N., et al., Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat Biotechnol, 1998. 16(8): p. 743-‐7.
89. Hultdin, M., et al., Telomere analysis by fluorescence in situ hybridization and flow cytometry. Nucleic Acids Res, 1998. 26(16): p. 3651-‐6.
48
90. Baird, D.M., et al., Extensive allelic variation and ultrashort telomeres in senescent human cells. Nat Genet, 2003. 33(2): p. 203-‐7.
91. Heaphy, C.M. and A.K. Meeker, The potential utility of telomere-‐related markers for cancer diagnosis. J Cell Mol Med, 2011. 15(6): p. 1227-‐38.
92. Hanahan, D. and R.A. Weinberg, The hallmarks of cancer. Cell, 2000. 100(1): p. 57-‐70.
93. Hanahan, D. and R.A. Weinberg, Hallmarks of cancer: the next generation. Cell, 2011. 144(5): p. 646-‐74.
94. Murnane, J.P., Telomeres and chromosome instability. DNA Repair (Amst), 2006. 5(9-‐10): p. 1082-‐92.
95. Dunham, M.A., et al., Telomere maintenance by recombination in human cells. Nat Genet, 2000. 26(4): p. 447-‐50.
96. Shay, J.W. and W.E. Wright, Senescence and immortalization: role of telomeres and telomerase. Carcinogenesis, 2005. 26(5): p. 867-‐74.
97. Bisoffi, M., C.M. Heaphy, and J.K. Griffith, Telomeres: prognostic markers for solid tumors. Int J Cancer, 2006. 119(10): p. 2255-‐60.
98. Lechel, A., M.P. Manns, and K.L. Rudolph, Telomeres and telomerase: new targets for the treatment of liver cirrhosis and hepatocellular carcinoma. J Hepatol, 2004. 41(3): p. 491-‐7.
99. Grulich, A.E., et al., Incidence of cancers in people with HIV/AIDS compared with immunosuppressed transplant recipients: a meta-‐analysis. Lancet, 2007. 370(9581): p. 59-‐67.
100. Cavallo, F., et al., 2011: the immune hallmarks of cancer. Cancer Immunol Immunother, 2011. 60(3): p. 319-‐26.
101. Zou, W., Regulatory T cells, tumour immunity and immunotherapy. Nat Rev Immunol, 2006. 6(4): p. 295-‐307.
102. Vignali, D.A., L.W. Collison, and C.J. Workman, How regulatory T cells work. Nat Rev Immunol, 2008. 8(7): p. 523-‐32.
103. Salazar-‐Onfray, F., M.N. Lopez, and A. Mendoza-‐Naranjo, Paradoxical effects of cytokines in tumor immune surveillance and tumor immune escape. Cytokine Growth Factor Rev, 2007. 18(1-‐2): p. 171-‐82.
104. Dranoff, G., Cytokines in cancer pathogenesis and cancer therapy. Nat Rev Cancer, 2004. 4(1): p. 11-‐22.
105. Ogata, A., et al., IL-‐6 triggers cell growth via the Ras-‐dependent mitogen-‐activated protein kinase cascade. J Immunol, 1997. 159(5): p. 2212-‐21.
106. Althuis, M.D., et al., Global trends in breast cancer incidence and mortality 1973-‐1997. Int J Epidemiol, 2005. 34(2): p. 405-‐12.
107. Socialstyrelsen, Cancer incidence in Sweden 2010. 2011. 108. Clemons, M. and P. Goss, Estrogen and the risk of breast cancer. N Engl J Med,
2001. 344(4): p. 276-‐85. 109. Chia, K.S., et al., Profound changes in breast cancer incidence may reflect
changes into a Westernized lifestyle: a comparative population-‐based study in Singapore and Sweden. Int J Cancer, 2005. 113(2): p. 302-‐6.
110. Gram, I.T., et al., Breast cancer risk among women who start smoking as teenagers. Cancer Epidemiol Biomarkers Prev, 2005. 14(1): p. 61-‐6.
49
111. Loman, N., et al., Family history of breast and ovarian cancers and BRCA1 and BRCA2 mutations in a population-‐based series of early-‐onset breast cancer. J Natl Cancer Inst, 2001. 93(16): p. 1215-‐23.
112. Morris, A., et al., Accurate evaluation of palpable breast masses by the triple test score. Arch Surg, 1998. 133(9): p. 930-‐4.
113. Osuch, J.R., V.L. Bonham, and L.L. Morris, Primary care guide to managing a breast mass: step-‐by-‐step workup. Medscape Womens Health, 1998. 3(5): p. 4.
114. Weigelt, B., F.C. Geyer, and J.S. Reis-‐Filho, Histological types of breast cancer: how special are they? Mol Oncol, 2010. 4(3): p. 192-‐208.
115. Ali, S. and R.C. Coombes, Endocrine-‐responsive breast cancer and strategies for combating resistance. Nat Rev Cancer, 2002. 2(2): p. 101-‐12.
116. Ryden, L., et al., HER2 status in hormone receptor positive premenopausal primary breast cancer adds prognostic, but not tamoxifen treatment predictive, information. Breast Cancer Res Treat, 2008. 109(2): p. 351-‐7.
117. Elston, C.W. and I.O. Ellis, Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-‐term follow-‐up. Histopathology, 1991. 19(5): p. 403-‐10.
118. McTiernan, A., M. Irwin, and V. Vongruenigen, Weight, physical activity, diet, and prognosis in breast and gynecologic cancers. J Clin Oncol, 2010. 28(26): p. 4074-‐80.
119. Siegel, R., D. Naishadham, and A. Jemal, Cancer statistics, 2012. CA Cancer J Clin, 2012. 62(1): p. 10-‐29.
120. Cairns, P., Renal cell carcinoma. Cancer Biomark, 2010. 9(1-‐6): p. 461-‐73. 121. Dhote, R., et al., Risk factors for adult renal cell carcinoma: a systematic
review and implications for prevention. BJU Int, 2000. 86(1): p. 20-‐7. 122. Cohen, H.T. and F.J. McGovern, Renal-‐cell carcinoma. N Engl J Med, 2005.
353(23): p. 2477-‐90. 123. Gnarra, J.R., et al., Mutations of the VHL tumour suppressor gene in renal
carcinoma. Nat Genet, 1994. 7(1): p. 85-‐90. 124. Nickerson, M.L., et al., Improved identification of von Hippel-‐Lindau gene
alterations in clear cell renal tumors. Clin Cancer Res, 2008. 14(15): p. 4726-‐34.
125. Kaelin, W.G., Jr., The von Hippel-‐Lindau tumor suppressor protein and clear cell renal carcinoma. Clin Cancer Res, 2007. 13(2 Pt 2): p. 680s-‐684s.
126. Kovacs, G., et al., The Heidelberg classification of renal cell tumours. J Pathol, 1997. 183(2): p. 131-‐3.
127. Koul, H., et al., Molecular aspects of renal cell carcinoma: a review. Am J Cancer Res, 2011. 1(2): p. 240-‐254.
128. DiBiase, S.J., et al., Palliative irradiation for focally symptomatic metastatic renal cell carcinoma: support for dose escalation based on a biological model. J Urol, 1997. 158(3 Pt 1): p. 746-‐9.
129. Yagoda, A., B. Abi-‐Rached, and D. Petrylak, Chemotherapy for advanced renal-‐cell carcinoma: 1983-‐1993. Semin Oncol, 1995. 22(1): p. 42-‐60.
50
130. Mignogna, C., et al., Prognostic significance of multidrug-‐resistance protein (MDR-‐1) in renal clear cell carcinomas: a five year follow-‐up analysis. BMC Cancer, 2006. 6: p. 293.
131. Yang, J.C., et al., Randomized study of high-‐dose and low-‐dose interleukin-‐2 in patients with metastatic renal cancer. J Clin Oncol, 2003. 21(16): p. 3127-‐32.
132. Yang, J.C., et al., A randomized trial of bevacizumab, an anti-‐vascular endothelial growth factor antibody, for metastatic renal cancer. N Engl J Med, 2003. 349(5): p. 427-‐34.
133. Melichar, B., et al., First-‐line bevacizumab combined with reduced dose interferon-‐alpha2a is active in patients with metastatic renal cell carcinoma. Ann Oncol, 2008. 19(8): p. 1470-‐6.
134. Motzer, R.J., et al., Sunitinib versus interferon alfa in metastatic renal-‐cell carcinoma. N Engl J Med, 2007. 356(2): p. 115-‐24.
135. Hudes, G., et al., Temsirolimus, interferon alfa, or both for advanced renal-‐cell carcinoma. N Engl J Med, 2007. 356(22): p. 2271-‐81.
136. Figlin, R.A., et al., Analysis of PTEN and HIF-‐1alpha and correlation with efficacy in patients with advanced renal cell carcinoma treated with temsirolimus versus interferon-‐alpha. Cancer, 2009. 115(16): p. 3651-‐60.
137. Sun, M., et al., Prognostic factors and predictive models in renal cell carcinoma: a contemporary review. Eur Urol, 2011. 60(4): p. 644-‐61.
138. Shariat, S.F. and E. Xylinas, Biomarkers in personalised treatment of renal-‐cell carcinoma. Lancet Oncol, 2012. 13(8): p. 751-‐2.
139. Stegmayr, B., V. Lundberg, and K. Asplund, The events registration and survey procedures in the Northern Sweden MONICA Project. Scand J Public Health Suppl, 2003. 61: p. 9-‐17.
140. Berglund, G., et al., The Malmo Diet and Cancer Study. Design and feasibility. J Intern Med, 1993. 233(1): p. 45-‐51.
141. Sobin LH, W.C., Eds: International Union Against Cancer (UICC). TNM classification of malignant tumours. 6th ed2002: New York: Wiley-‐Liss.
142. Fuhrman, S.A., L.C. Lasky, and C. Limas, Prognostic significance of morphologic parameters in renal cell carcinoma. Am J Surg Pathol, 1982. 6(7): p. 655-‐63.
143. Kallings, L.V., et al., Beneficial effects of individualized physical activity on prescription on body composition and cardiometabolic risk factors: results from a randomized controlled trial. Eur J Cardiovasc Prev Rehabil, 2009. 16(1): p. 80-‐4.
144. Nordfjall, K., et al., hTERT (-‐1327)T/C polymorphism is not associated with age-‐related telomere attrition in peripheral blood. Biochem Biophys Res Commun, 2007. 358(1): p. 215-‐8.
145. Svenson, U., B. Ljungberg, and G. Roos, Telomere length in peripheral blood predicts survival in clear cell renal cell carcinoma. Cancer Res, 2009. 69(7): p. 2896-‐901.
146. Svenson, U., et al., Blood cell telomere length is a dynamic feature. PLoS One, 2011. 6(6): p. e21485.
147. Capper, R., et al., The nature of telomere fusion and a definition of the critical telomere length in human cells. Genes Dev, 2007. 21(19): p. 2495-‐508.
51
148. Kokkonen, H., et al., Up-‐regulation of cytokines and chemokines predates the onset of rheumatoid arthritis. Arthritis Rheum, 2010. 62(2): p. 383-‐91.
149. Ma, H., et al., Shortened telomere length is associated with increased risk of cancer: a meta-‐analysis. PLoS One, 2011. 6(6): p. e20466.
150. Wentzensen, I.M., et al., The association of telomere length and cancer: a meta-‐analysis. Cancer Epidemiol Biomarkers Prev, 2011. 20(6): p. 1238-‐50.
151. Gramatges, M.M., et al., Longer relative telomere length in blood from women with sporadic and familial breast cancer compared with healthy controls. Cancer Epidemiol Biomarkers Prev, 2010. 19(2): p. 605-‐13.
152. Pooley, K.A., et al., Telomere length in prospective and retrospective cancer case-‐control studies. Cancer Res, 2010. 70(8): p. 3170-‐6.
153. Zheng, Y.L., et al., Telomere length in blood cells and breast cancer risk: investigations in two case-‐control studies. Breast Cancer Res Treat, 2010. 120(3): p. 769-‐75.
154. Barwell, J., et al., Is telomere length in peripheral blood lymphocytes correlated with cancer susceptibility or radiosensitivity? Br J Cancer, 2007. 97(12): p. 1696-‐700.
155. De Vivo, I., et al., A prospective study of relative telomere length and postmenopausal breast cancer risk. Cancer Epidemiol Biomarkers Prev, 2009. 18(4): p. 1152-‐6.
156. Shen, J., et al., Short telomere length and breast cancer risk: a study in sister sets. Cancer Res, 2007. 67(11): p. 5538-‐44.
157. Shen, J., et al., Telomere length, oxidative damage, antioxidants and breast cancer risk. Int J Cancer, 2009. 124(7): p. 1637-‐43.
158. Hou, L., et al., Surrogate tissue telomere length and cancer risk: shorter or longer? Cancer Lett, 2012. 319(2): p. 130-‐5.
159. Prescott, J., et al., Epidemiologic evidence for a role of telomere dysfunction in cancer etiology. Mutat Res, 2012. 730(1-‐2): p. 75-‐84.
160. Engelhardt, M., et al., Telomerase activity and telomere length in pediatric patients with malignancies undergoing chemotherapy. Leukemia, 1998. 12(1): p. 13-‐24.
161. Schroder, C.P., et al., Telomere length in breast cancer patients before and after chemotherapy with or without stem cell transplantation. Br J Cancer, 2001. 84(10): p. 1348-‐53.
162. Lee, J.J., et al., Telomere length shortening in non-‐Hodgkin's lymphoma patients undergoing chemotherapy. Ann Hematol, 2003. 82(8): p. 492-‐5.
163. Unryn, B.M., et al., Acceleration of telomere loss by chemotherapy is greater in older patients with locally advanced head and neck cancer. Clin Cancer Res, 2006. 12(21): p. 6345-‐50.
164. Alter, B.P., et al., Cancer in dyskeratosis congenita. Blood, 2009. 113(26): p. 6549-‐57.
165. van der Vaart, H., et al., Acute effects of cigarette smoke on inflammation and oxidative stress: a review. Thorax, 2004. 59(8): p. 713-‐21.
52
166. Mayer, S., et al., Sex-‐specific telomere length profiles and age-‐dependent erosion dynamics of individual chromosome arms in humans. Cytogenet Genome Res, 2006. 112(3-‐4): p. 194-‐201.
167. Aviv, A., et al., Menopause modifies the association of leukocyte telomere length with insulin resistance and inflammation. J Clin Endocrinol Metab, 2006. 91(2): p. 635-‐40.
168. Cherif, H., et al., Ageing and telomeres: a study into organ-‐ and gender-‐specific telomere shortening. Nucleic Acids Res, 2003. 31(5): p. 1576-‐83.
169. Bischoff, C., et al., The heritability of telomere length among the elderly and oldest-‐old. Twin Res Hum Genet, 2005. 8(5): p. 433-‐9.
170. McGrath, M., et al., Telomere length, cigarette smoking, and bladder cancer risk in men and women. Cancer Epidemiol Biomarkers Prev, 2007. 16(4): p. 815-‐9.
171. Lee, D.C., et al., Effect of long-‐term hormone therapy on telomere length in postmenopausal women. Yonsei Med J, 2005. 46(4): p. 471-‐9.
172. Han, J., et al., A prospective study of telomere length and the risk of skin cancer. J Invest Dermatol, 2009. 129(2): p. 415-‐21.
173. Liu, J., et al., Longer leukocyte telomere length predicts increased risk of hepatitis B virus-‐related hepatocellular carcinoma: a case-‐control analysis. Cancer, 2011. 117(18): p. 4247-‐56.
174. Lan, Q., et al., A prospective study of telomere length measured by monochrome multiplex quantitative PCR and risk of non-‐Hodgkin lymphoma. Clin Cancer Res, 2009. 15(23): p. 7429-‐33.
175. Cui, Y., et al., Association of Leukocyte Telomere Length with Colorectal Cancer Risk: Nested Case-‐Control Findings from the Shanghai Women's Health Study. Cancer Epidemiol Biomarkers Prev, 2012.
176. Avigad, S., et al., Short telomeres: a novel potential predictor of relapse in Ewing sarcoma. Clin Cancer Res, 2007. 13(19): p. 5777-‐83.
177. Griffith, J.K., et al., Reduced telomere DNA content is correlated with genomic instability and metastasis in invasive human breast carcinoma. Breast Cancer Res Treat, 1999. 54(1): p. 59-‐64.
178. Fordyce, C.A., et al., Telomere content correlates with stage and prognosis in breast cancer. Breast Cancer Res Treat, 2006. 99(2): p. 193-‐202.
179. Heaphy, C.M., et al., Telomere DNA content predicts breast cancer-‐free survival interval. Clin Cancer Res, 2007. 13(23): p. 7037-‐43.
180. Donaldson, L., et al., Association between outcome and telomere DNA content in prostate cancer. J Urol, 1999. 162(5): p. 1788-‐92.
181. Fordyce, C.A., et al., Association between cancer-‐free survival and telomere DNA content in prostate tumors. J Urol, 2005. 173(2): p. 610-‐4.
182. Oh, B.K., et al., High telomerase activity and long telomeres in advanced hepatocellular carcinomas with poor prognosis. Lab Invest, 2008. 88(2): p. 144-‐52.
183. Gertler, R., et al., Telomere length and human telomerase reverse transcriptase expression as markers for progression and prognosis of colorectal carcinoma. J Clin Oncol, 2004. 22(10): p. 1807-‐14.
53
184. Garcia-‐Aranda, C., et al., Correlations of telomere length, telomerase activity, and telomeric-‐repeat binding factor 1 expression in colorectal carcinoma. Cancer, 2006. 106(3): p. 541-‐51.
185. Patel, M.M., et al., Clinical usefulness of telomerase activation and telomere length in head and neck cancer. Head Neck, 2002. 24(12): p. 1060-‐7.
186. Gertler, R., et al., Telomere length and telomerase subunits as diagnostic and prognostic biomarkers in Barrett carcinoma. Cancer, 2008. 112(10): p. 2173-‐80.
187. Liu, H.Q., et al., Leukocyte telomere length predicts overall survival in hepatocellular carcinoma treated with transarterial chemoembolization. Carcinogenesis, 2012. 33(5): p. 1040-‐5.
188. Sellmann, L., et al., Telomeres and prognosis in patients with chronic lymphocytic leukaemia. Int J Hematol, 2011. 93(1): p. 74-‐82.
189. Wu, K.D., et al., Telomerase and telomere length in multiple myeloma: correlations with disease heterogeneity, cytogenetic status, and overall survival. Blood, 2003. 101(12): p. 4982-‐9.
190. Curotto de Lafaille, M.A. and J.J. Lafaille, Natural and adaptive foxp3+ regulatory T cells: more of the same or a division of labor? Immunity, 2009. 30(5): p. 626-‐35.
191. Banham, A.H., Cell-‐surface IL-‐7 receptor expression facilitates the purification of FOXP3(+) regulatory T cells. Trends Immunol, 2006. 27(12): p. 541-‐4.
192. Hartigan-‐O'Connor, D.J., et al., Human CD4+ regulatory T cells express lower levels of the IL-‐7 receptor alpha chain (CD127), allowing consistent identification and sorting of live cells. J Immunol Methods, 2007. 319(1-‐2): p. 41-‐52.
193. Seddiki, N., et al., Expression of interleukin (IL)-‐2 and IL-‐7 receptors discriminates between human regulatory and activated T cells. J Exp Med, 2006. 203(7): p. 1693-‐700.
194. Liu, W., et al., CD127 expression inversely correlates with FoxP3 and suppressive function of human CD4+ T reg cells. J Exp Med, 2006. 203(7): p. 1701-‐11.
195. Aubert, G. and P.M. Lansdorp, Telomeres and aging. Physiol Rev, 2008. 88(2): p. 557-‐79.
196. Epel, E., How "reversible" is telomeric aging? Cancer Prev Res (Phila), 2012. 5(10): p. 1163-‐8.
197. Barnett, A.G., J.C. van der Pols, and A.J. Dobson, Regression to the mean: what it is and how to deal with it. Int J Epidemiol, 2005. 34(1): p. 215-‐20.
198. Svenson, U., et al., Breast cancer survival is associated with telomere length in peripheral blood cells. Cancer Res, 2008. 68(10): p. 3618-‐23.
199. Grabowski, P., et al., Telomere length as a prognostic parameter in chronic lymphocytic leukemia with special reference to VH gene mutation status. Blood, 2005. 105(12): p. 4807-‐12.