DNA What it is? Deoxyribose Nucleic Acid DNA contains genetic
information. DNA codes the proteins that our bodies make which are
necessary for survival. Thus DNA is a code for making proteins. DNA
also determines how much of these proteins each cell makes. The
order of amino acids determines what type of protein is made. Some
Common proteins are: Hemoglobin - carries oxygen from lungs to
cells Insulin - regulates metabolism Many types of enzymes -
catalyze reactions in the body, such as the breakdown of sugar for
energy. www.nature.com
DNA When human cells are present in biological evidence, their
chromosomes can be examined to determine whether the evidence comes
from a male or a female. The analysis of chromosomes is known as
karyotyping. DNA fingerprinting, also known as DNA profiling, is
used in criminal and legal cases to determine identity or
parentage, Trace the inheritance of genetic disorders, Identify the
origin of a blood, semen, or saliva in a sample, and identify
victims of war and large-scale disasters such as plane crashes,
tsunamis, and hurricanes. Three billion bases in human DNA, 99% of
DNA is identical among individuals. 1% contains significant
variation. Each persons DNA Profile is unique, Except Identical
Twins
DNA - STRUCTURE Double Helix Twisted Ladder The DNA ladder is
made up of building blocks called nucleotides. The two DNA strands
are antiparallel. The two strands are held together by hydrogen
bonds formed between the complementary bases. Sugar Phosphate
Backbone (Sides of Ladder) Nitrogenous Bases (Rungs of Ladder)
www.biosci.ohio-state.edu
RNA www.livescience.com
NUCLEOTIDES Nucleotides are biological molecules that form the
building blocks of nucleic acids (DNA and RNA). They serve to carry
packets of energy within the cell (ATP). Nucleotides play central
roles in metabolism. A nucleotide is composed of a nucleobase
(nitrogenous base), a five-carbon sugar (either ribose or
2-deoxyribose), and one or more phosphate groups. Pearson
Education, Inc
4 BASES OF DNA The nitrogenous bases found in nucleotides are
classified as pyrimidines or purines. Purines have a two ring
structure. Pyrimidine has one ring.
www.catlogue.flatknowledge.com
PAIRING OF BASE PAIRS http://en.wikipedia.org/wiki/Gene
WHERE IS DNA DNA in the nucleus is packaged into Chromosomes
(23 Pairs). DNA can be recovered from any substance that contains
cells. www.theblaze.com All types of cells in our body contain a
copy of the same DNA. DNA holds the instructions to make all things
in your body work properly.
WHERE IS DNA IT IS EVERYWHERE Examples: Blood WBC, Semen,
Saliva, Tissue, Bone, Teeth, Hair, Maggot Corps
HOW DNA DIFFER AMONG INDIVIDUALS One of the bases (letters) can
be different. Person 1 AGCTAGATCGTTATTCCGAG Person 2
AGCTAGATCGTCATTCCGAG Bases (letters) can be added or removed.
Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3
AGCTAGATCGTTTATTCCGAG Regions of DNA can be repeated a different
number of times. Person 1 GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT Person 2
GCCAGCTAGCTAGCTAGCTAGCTTTCAT Person 3
GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT
DNA FORENSIC ANALYSIS Collection of Evidence: Types of Unknown
Samples: Blood, Semen, Stains, Saliva, Hair, Tissue, Bones, Teeth
Types of Known Samples: Blood / buccal swabs from suspect / victim
/ other known person. Avoid Contamination of DNA Evidence: Use
disposable gloves and disposable instruments for handling each
sample. Avoid touching the area where you believe DNA may exist.
Avoid talking, sneezing, and coughing over evidence. Avoid touching
your face, nose, and mouth when collecting and packaging evidence.
Air-dry evidence thoroughly before packaging as moisture destroys
DNA. If wet evidence cannot be dried, it may be frozen. Put
evidence into new paper bags or envelopes. Keep samples at room
temperature and out of sun.
STEPS INVOLVED IN SAMPLE PROCESSING Sample Obtained from Crime
Scene or Paternity Investigation Biology DNA Quantitation DNA
Extraction PCR Amplification of Multiple STR markers Technology
Separation and Detection of PCR Products (STR Alleles) Sample
Genotype Determination Genetics Comparison of Sample Genotype to
Other Sample Results If match occurs, comparison of DNA profile to
population databases Generation of Case Report with Probability of
Random Match
VARIATIONS IN DNA PROFILE Mini-satellites - repeated sequences,
10100 base pairs ...CCTGACTTAGGATTGCCA... Short Tandem Repeats
(STRs) repeated sequences, 29 base pairs Single Nucleotide
Polymorphisms (SNPs) - Single Nucleotide A, T, C or G in the genome
differs between members of a biological species or paired
chromosomes.
When the amount of evidence left at a crime scene is very
small, it is considered to be trace evidence. The use of the
polymerase chain reaction (PCR) technique we can generate multiple
identical copies from trace amounts of original DNA evidence. This
enables forensic scientists to make billions of DNA copies from
small amounts of DNA in just a few hours. The DNA produced with PCR
can be analyzed using DNA fingerprinting techniques.
Thermal Cycling Temperatures Temperature 94 oC 72 oC 60 oC 94
oC 94 oC 94 oC 72 oC 60 oC 72 oC 60 oC Single Cycle Time The
denaturation time in the first cycle is lengthened to ~10 minutes
when using AmpliTaq Gold to perform a hot-start PCR Typically 25-35
cycles performed during PCR
STEPS OF DNA FINGERPRINTING Extraction: DNA is extracted from
cells or tissues of the body. Restriction Fragments: DNA is cut by
restriction enzymes. Restriction enzymes recognize a unique pattern
of DNA bases (restriction sites) and will cut the DNA at that
specific location. Restriction fragments of varying lengths are
formed when the DNA is cut. Amplification: Specifically chosen DNA
fragments are amplified using polymerase chain reaction.
Electrophoresis: DNA is loaded into the wells found in an agarose
gel. When an electric current is passed through the gel, the
negatively charged DNA fragments (pieces of DNA) migrate toward the
positive end of the gel. DNA fragments are separated by size, with
the smallest DNA fragments moving the fastest through the gel.
Transfer DNA to Nylon sheet by soaking them overnight. Probing is
done by adding radioactive or coloured probes to nylon sheet to
produce a pattern called DNA fingerprint. DNA Fingerprint is built
using several probes (5-10) probes symaltaneously.
DNA - PROFILING Short Tandem Repeat (STR) Restriction Fragment
Length Polymorphism (RFLP) In order to study the structure of DNA,
the molecules are broken up into smaller fragments by enzymes
called restriction enzymes . Restriction enzymes do not break up
the DNA molecule randomly but cut it at particular sites producing
fragments. restriction enzymes cut the DNA in different places and
so produce fragments which are easier to analyse base on their
length. Polymorphism means many forms. STR technology is used to
evaluate specific regions (loci) within nuclear DNA. Variability in
STR regions can be used to distinguish one DNA profile from
another. Short because usually 1-4 nucleotides in length. Tandem
because they occur one after another. Repeat because they are
repeats of same DNA sequence.
RFLP - ELECTROPHORESIS Electrophoresis is a separations
technique that is based on the mobility of ions in an electric
field. Positively charged ions migrate towards a negative electrode
and negatively-charged ions migrate toward a positive electrode.
Electrophoresis was made possible by the discovery that nucleotide
fragments can be separated by moving them through a porous material
(agarose) within an electric field and DNA bands must be stained to
make them visible. Ethidium bromide-stained DNA will fluoresce when
illuminated with UV light.
RFLP - ELECTROPHORESIS The smallest fragments will move the
fastest because they are able to move through the pores in the
gelatin faster. Bands will be produced on the gelatin where the
fragments accumulate. The shortest fragments will accumulate near
one end of the gelatin and the longer, slower-moving ones will
remain near the other end. In the diagram below, four samples of
DNA were placed on the gelatin. After an electric current was
applied for a period of time, the fragments separated. Notice that
sample D on the right does not match the other three samples.
DNA PROFILING USING STRS: AN OVERVIEW STRs are Short Tandem
Repeats of patterns of nucleotides spread throughout our DNA The
number of repeats at a certain distinct region (locus, plural=loci)
of DNA is highly variable from person to person allowing their use
in human identity testing The number of nucleotides involved in the
repeats can vary between 9 and 80 (called variable number of
repeats, VNTRs, or minisatellites) or between 2 and 5 (called
microsatellites, SHORT tandem repeats, STRs) Several loci along our
DNA have been identified as possessing STRs (thanks in part to the
Human Genome Project), and the DNA profiling community has selected
13 regions for identity analysis These 13 loci ALL contain 4
nucleotide (tetrameric) repeats Through population studies, the
numbers and types (nucleotides involved) of these repeats at these
loci have been analyzed affording probability estimates in certain
ethnicities AATG AATG AATG AATG AATG AATG AATG 7 short, tandem
(back to back) repeats of the nucleotide sequence AATG DNA
molecule
SHORT TANDEM REPEAT (STR) It can start with a much smaller
sample of DNA. STR analysis examines how often base pairs repeat in
specific loci, or locations, on a DNA strand. These can be
dinucleotide, trinucleotide, tetranucleotide or pentanucleotide
repeats -- that is, repetitions of two, three, four or five base
pairs. The Federal Bureau of Investigation has chosen 13 specific
STR loci to serve as the standard for DNA analysis. The likelihood
that any two individuals (except identical twins) will have the
same 13-loci DNA profile can be as high as 1 in 1 billion or
greater.
INHERITANCE OF ALLELES
Variable Number of Tandem Repeat (VNTR) loci are chromosomal
regions in which a short DNA sequence motif (such as GC or AGCT) is
repeated a variable number of times end-to-end at a single location
(tandem repeat). In this example, Locus A is a tandem repeat of the
motif GC: there are four alleles, with two, three, four, or five
repeats (A2, A3, A4, and A5, respectively). Locus B is a tandem
repeat of the motif AGCT: there are only two alleles, with two or
three repeats (B2 and B3, respectively). The example shows a DNA
fingerprint that includes both loci simultaneously. Individual #1
is heterozygous at Locus A (A2 / A5) and homozygous at Locus 2 (B2
/ B2: note that this genotype gives a single-banded phenotype in
the fingerprint). Individual #2 is heterozygous at both loci: (A4 /
A3 and B3 / B2) respectively). The two individuals are
distinguishable at either locus.
EXAMPLE DNA fingerprinting using STRs. The DNA of two suspects
is compared to DNA recovered from the crime scene.
http://www.randomhouse.com /
EXAMPLE http://evolution.berkeley.edu
MITROCONDRIAL - DNA Sometimes, a sample can be old and will no
longer have nuclear material in the cell, which poses a problem for
the other types of DNA analysis. With mitochondrial DNA analysis,
however, mitochondrial DNA can be removed, thus having important
ramifications for cases that were not solved over many years.
Inherited from the mother only Advantages: More sensitive (less DNA
needed), degrades slower than nuclear DNA Can be used in cases
where nuclear DNA cannot (hair without root, skeletal remains)
Disadvantages: All people of same maternal line will be
indistinguishable (less discriminatory) More work, more time
consuming, more costly www.wisegeek.com
APPLICATIONS 1) Diagnosis and Developing cures for inherited
disorders: DNA fingerprinting is used to diagnose inherited
disorders in both prenatal and newborn babies in hospitals around
the world. These disorders may include cystic fibrosis, hemophilia,
Huntington's disease, familial Alzheimer's, sickle cell anemia,
thalassemia, and many others. Early detection of such disorders
enables the medical staff to prepare themselves and the parents for
proper treatment of the child. In some programs, genetic counselors
use DNA fingerprint information to help prospective parents
understand the risk of having an affected child. In other programs,
prospective parents use DNA fingerprint information in their
decisions concerning affected pregnancies.
APPLICATIONS 2)Biological Evidence to Identify Criminals: Where
fingerprints are not available but biological specimens are
available like blood or semen stains, hair, or items of clothing at
the scene of the crime then these items may prove to be valuable
sources of DNA of the criminal. Since the year 1987, innumerable
cases have been solved with the help of DNA fingerprint evidence.
3) Paternity disputes : Another important use of DNA fingerprints
in the court system is to establish paternity in custody and child
support litigation. In these applications, DNA fingerprints bring
an unprecedented, nearly perfect accuracy to the determination. 4)
Personal Identification : DNA maybe the best way to identify a
person as all body tissues and organs contain the same DNA type.
The specimen required also is very small. In fact the US army has
been doing DNA fingerprinting of all its soldiers and has a huge
databank.