DNA FORENSIC ANALYSIS

DNA What it is? Deoxyribose Nucleic Acid DNA contains genetic information. DNA codes the proteins that our bodies make which are necessary for survival. Thus DNA is a code for making proteins. DNA also determines how much of these proteins each cell makes. The order of amino acids determines what type of protein is made. Some Common proteins are: Hemoglobin - carries oxygen from lungs to cells Insulin - regulates metabolism Many types of enzymes - catalyze reactions in the body, such as the breakdown of sugar for energy. www.nature.com

DNA When human cells are present in biological evidence, their chromosomes can be examined to determine whether the evidence comes from a male or a female. The analysis of chromosomes is known as karyotyping. DNA fingerprinting, also known as DNA profiling, is used in criminal and legal cases to determine identity or parentage, Trace the inheritance of genetic disorders, Identify the origin of a blood, semen, or saliva in a sample, and identify victims of war and large-scale disasters such as plane crashes, tsunamis, and hurricanes. Three billion bases in human DNA, 99% of DNA is identical among individuals. 1% contains significant variation. Each persons DNA Profile is unique, Except Identical Twins

DNA - STRUCTURE Double Helix Twisted Ladder The DNA ladder is made up of building blocks called nucleotides. The two DNA strands are antiparallel. The two strands are held together by hydrogen bonds formed between the complementary bases. Sugar Phosphate Backbone (Sides of Ladder) Nitrogenous Bases (Rungs of Ladder) www.biosci.ohio-state.edu

RNA www.livescience.com

NUCLEOTIDES Nucleotides are biological molecules that form the building blocks of nucleic acids (DNA and RNA). They serve to carry packets of energy within the cell (ATP). Nucleotides play central roles in metabolism. A nucleotide is composed of a nucleobase (nitrogenous base), a five-carbon sugar (either ribose or 2-deoxyribose), and one or more phosphate groups. Pearson Education, Inc

4 BASES OF DNA The nitrogenous bases found in nucleotides are classified as pyrimidines or purines. Purines have a two ring structure. Pyrimidine has one ring. www.catlogue.flatknowledge.com

PAIRING OF BASE PAIRS http://en.wikipedia.org/wiki/Gene

WHERE IS DNA DNA in the nucleus is packaged into Chromosomes (23 Pairs). DNA can be recovered from any substance that contains cells. www.theblaze.com All types of cells in our body contain a copy of the same DNA. DNA holds the instructions to make all things in your body work properly.

WHERE IS DNA IT IS EVERYWHERE Examples: Blood WBC, Semen, Saliva, Tissue, Bone, Teeth, Hair, Maggot Corps

HOW DNA DIFFER AMONG INDIVIDUALS One of the bases (letters) can be different. Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTCATTCCGAG Bases (letters) can be added or removed. Person 1 AGCTAGATCGTTATTCCGAG Person 2 AGCTAGATCGTATTCCGAG Person 3 AGCTAGATCGTTTATTCCGAG Regions of DNA can be repeated a different number of times. Person 1 GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT Person 2 GCCAGCTAGCTAGCTAGCTAGCTTTCAT Person 3 GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT

DNA FORENSIC ANALYSIS Collection of Evidence: Types of Unknown Samples: Blood, Semen, Stains, Saliva, Hair, Tissue, Bones, Teeth Types of Known Samples: Blood / buccal swabs from suspect / victim / other known person. Avoid Contamination of DNA Evidence: Use disposable gloves and disposable instruments for handling each sample. Avoid touching the area where you believe DNA may exist. Avoid talking, sneezing, and coughing over evidence. Avoid touching your face, nose, and mouth when collecting and packaging evidence. Air-dry evidence thoroughly before packaging as moisture destroys DNA. If wet evidence cannot be dried, it may be frozen. Put evidence into new paper bags or envelopes. Keep samples at room temperature and out of sun.

STEPS INVOLVED IN SAMPLE PROCESSING Sample Obtained from Crime Scene or Paternity Investigation Biology DNA Quantitation DNA Extraction PCR Amplification of Multiple STR markers Technology Separation and Detection of PCR Products (STR Alleles) Sample Genotype Determination Genetics Comparison of Sample Genotype to Other Sample Results If match occurs, comparison of DNA profile to population databases Generation of Case Report with Probability of Random Match

VARIATIONS IN DNA PROFILE Mini-satellites - repeated sequences, 10100 base pairs ...CCTGACTTAGGATTGCCA... Short Tandem Repeats (STRs) repeated sequences, 29 base pairs Single Nucleotide Polymorphisms (SNPs) - Single Nucleotide A, T, C or G in the genome differs between members of a biological species or paired chromosomes.

When the amount of evidence left at a crime scene is very small, it is considered to be trace evidence. The use of the polymerase chain reaction (PCR) technique we can generate multiple identical copies from trace amounts of original DNA evidence. This enables forensic scientists to make billions of DNA copies from small amounts of DNA in just a few hours. The DNA produced with PCR can be analyzed using DNA fingerprinting techniques.

Thermal Cycling Temperatures Temperature 94 oC 72 oC 60 oC 94 oC 94 oC 94 oC 72 oC 60 oC 72 oC 60 oC Single Cycle Time The denaturation time in the first cycle is lengthened to ~10 minutes when using AmpliTaq Gold to perform a hot-start PCR Typically 25-35 cycles performed during PCR

STEPS OF DNA FINGERPRINTING Extraction: DNA is extracted from cells or tissues of the body. Restriction Fragments: DNA is cut by restriction enzymes. Restriction enzymes recognize a unique pattern of DNA bases (restriction sites) and will cut the DNA at that specific location. Restriction fragments of varying lengths are formed when the DNA is cut. Amplification: Specifically chosen DNA fragments are amplified using polymerase chain reaction. Electrophoresis: DNA is loaded into the wells found in an agarose gel. When an electric current is passed through the gel, the negatively charged DNA fragments (pieces of DNA) migrate toward the positive end of the gel. DNA fragments are separated by size, with the smallest DNA fragments moving the fastest through the gel. Transfer DNA to Nylon sheet by soaking them overnight. Probing is done by adding radioactive or coloured probes to nylon sheet to produce a pattern called DNA fingerprint. DNA Fingerprint is built using several probes (5-10) probes symaltaneously.

DNA - PROFILING Short Tandem Repeat (STR) Restriction Fragment Length Polymorphism (RFLP) In order to study the structure of DNA, the molecules are broken up into smaller fragments by enzymes called restriction enzymes . Restriction enzymes do not break up the DNA molecule randomly but cut it at particular sites producing fragments. restriction enzymes cut the DNA in different places and so produce fragments which are easier to analyse base on their length. Polymorphism means many forms. STR technology is used to evaluate specific regions (loci) within nuclear DNA. Variability in STR regions can be used to distinguish one DNA profile from another. Short because usually 1-4 nucleotides in length. Tandem because they occur one after another. Repeat because they are repeats of same DNA sequence.

RFLP - ELECTROPHORESIS Electrophoresis is a separations technique that is based on the mobility of ions in an electric field. Positively charged ions migrate towards a negative electrode and negatively-charged ions migrate toward a positive electrode. Electrophoresis was made possible by the discovery that nucleotide fragments can be separated by moving them through a porous material (agarose) within an electric field and DNA bands must be stained to make them visible. Ethidium bromide-stained DNA will fluoresce when illuminated with UV light.

RFLP - ELECTROPHORESIS The smallest fragments will move the fastest because they are able to move through the pores in the gelatin faster. Bands will be produced on the gelatin where the fragments accumulate. The shortest fragments will accumulate near one end of the gelatin and the longer, slower-moving ones will remain near the other end. In the diagram below, four samples of DNA were placed on the gelatin. After an electric current was applied for a period of time, the fragments separated. Notice that sample D on the right does not match the other three samples.

DNA PROFILING USING STRS: AN OVERVIEW STRs are Short Tandem Repeats of patterns of nucleotides spread throughout our DNA The number of repeats at a certain distinct region (locus, plural=loci) of DNA is highly variable from person to person allowing their use in human identity testing The number of nucleotides involved in the repeats can vary between 9 and 80 (called variable number of repeats, VNTRs, or minisatellites) or between 2 and 5 (called microsatellites, SHORT tandem repeats, STRs) Several loci along our DNA have been identified as possessing STRs (thanks in part to the Human Genome Project), and the DNA profiling community has selected 13 regions for identity analysis These 13 loci ALL contain 4 nucleotide (tetrameric) repeats Through population studies, the numbers and types (nucleotides involved) of these repeats at these loci have been analyzed affording probability estimates in certain ethnicities AATG AATG AATG AATG AATG AATG AATG 7 short, tandem (back to back) repeats of the nucleotide sequence AATG DNA molecule

SHORT TANDEM REPEAT (STR) It can start with a much smaller sample of DNA. STR analysis examines how often base pairs repeat in specific loci, or locations, on a DNA strand. These can be dinucleotide, trinucleotide, tetranucleotide or pentanucleotide repeats -- that is, repetitions of two, three, four or five base pairs. The Federal Bureau of Investigation has chosen 13 specific STR loci to serve as the standard for DNA analysis. The likelihood that any two individuals (except identical twins) will have the same 13-loci DNA profile can be as high as 1 in 1 billion or greater.

INHERITANCE OF ALLELES

Variable Number of Tandem Repeat (VNTR) loci are chromosomal regions in which a short DNA sequence motif (such as GC or AGCT) is repeated a variable number of times end-to-end at a single location (tandem repeat). In this example, Locus A is a tandem repeat of the motif GC: there are four alleles, with two, three, four, or five repeats (A2, A3, A4, and A5, respectively). Locus B is a tandem repeat of the motif AGCT: there are only two alleles, with two or three repeats (B2 and B3, respectively). The example shows a DNA fingerprint that includes both loci simultaneously. Individual #1 is heterozygous at Locus A (A2 / A5) and homozygous at Locus 2 (B2 / B2: note that this genotype gives a single-banded phenotype in the fingerprint). Individual #2 is heterozygous at both loci: (A4 / A3 and B3 / B2) respectively). The two individuals are distinguishable at either locus.

EXAMPLE DNA fingerprinting using STRs. The DNA of two suspects is compared to DNA recovered from the crime scene. http://www.randomhouse.com /

EXAMPLE http://evolution.berkeley.edu

MITROCONDRIAL - DNA Sometimes, a sample can be old and will no longer have nuclear material in the cell, which poses a problem for the other types of DNA analysis. With mitochondrial DNA analysis, however, mitochondrial DNA can be removed, thus having important ramifications for cases that were not solved over many years. Inherited from the mother only Advantages: More sensitive (less DNA needed), degrades slower than nuclear DNA Can be used in cases where nuclear DNA cannot (hair without root, skeletal remains) Disadvantages: All people of same maternal line will be indistinguishable (less discriminatory) More work, more time consuming, more costly www.wisegeek.com

APPLICATIONS 1) Diagnosis and Developing cures for inherited disorders: DNA fingerprinting is used to diagnose inherited disorders in both prenatal and newborn babies in hospitals around the world. These disorders may include cystic fibrosis, hemophilia, Huntington's disease, familial Alzheimer's, sickle cell anemia, thalassemia, and many others. Early detection of such disorders enables the medical staff to prepare themselves and the parents for proper treatment of the child. In some programs, genetic counselors use DNA fingerprint information to help prospective parents understand the risk of having an affected child. In other programs, prospective parents use DNA fingerprint information in their decisions concerning affected pregnancies.

APPLICATIONS 2)Biological Evidence to Identify Criminals: Where fingerprints are not available but biological specimens are available like blood or semen stains, hair, or items of clothing at the scene of the crime then these items may prove to be valuable sources of DNA of the criminal. Since the year 1987, innumerable cases have been solved with the help of DNA fingerprint evidence. 3) Paternity disputes : Another important use of DNA fingerprints in the court system is to establish paternity in custody and child support litigation. In these applications, DNA fingerprints bring an unprecedented, nearly perfect accuracy to the determination. 4) Personal Identification : DNA maybe the best way to identify a person as all body tissues and organs contain the same DNA type. The specimen required also is very small. In fact the US army has been doing DNA fingerprinting of all its soldiers and has a huge databank.

DNA FORENSIC ANALYSIS

Education

polymerase

dna fingerprint

short tandem

restriction

dna profile

restriction

dna fingerprint

dna profiling