YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

1

Lesson 8DNA Fingerprinting

Page 2: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

2

Read the following article.

Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide evidence to prove his paternal relationship with his son. He underwent the blood group typing tests and obtained proof that his blood type matched with that of his son. However, Mr. Chan was told by the Immigration Department that the blood group typing result was an insufficient evidence.

Insufficient evidence?

Page 3: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

3

Insufficient evidence?

Why was the blood group typing result not sufficient evidence?

Any other tests recommend?

Page 4: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

4

Blood group typing is much less sensitive.

May use DNA fingerprint to provide biological evidence as a proof in a paternity test.

Page 5: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

5

What is DNA?

Page 6: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

6

Structural relationship among chromosomes, DNA and genes

1. Cells are the basic building blocks of all living things.

2. In a cell, DNA (deoxyribonucleic acid) is packaged in chromosomes within the nucleus.

3. DNA is a large, polymeric molecule.

4. A gene is a segment of DNA molecule of a chromosome. It is the basic unit of heredity. Genes determine the body characteristics of an organism.

5. Each inherited characteristic is controlled by one or several genes.

Page 7: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

7

Look into DNA

• DNA looks like an incredibly long twisted ladder. This shape is called a double helix.

• The sides of the ladder are a linked chain of 5-carbon sugars and phosphate (PO4) groups (called the backbone).

• The rungs connected to the 5-carbon sugars are known as bases.

Page 8: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

8

DNA

• Each rung is made up of two bases that link together. There are four bases - adenine (A), thymine (T), guanine (G) and cytosine (C).

• Because of their chemical nature, A will only link with T and G will only link with C. No base can join with itself (i.e. NO A-A /T-T /G-G / C-C base-pairs).

Page 9: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

9

Activity 8.1What is DNA?

Refer to the Pre-lesson Reading, finish Activity 8.1 to check your understanding on DNA.

Page 10: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

10

Activity 8.1

a) There are 46 pairs of chromosomes in each nucleus of a human cell.

b) Chromosomes are made of DNA and proteins.

c) DNA determines the body characteristics of an organism.

d) DNA may be extracted from red blood cells found in a blood sample.

1.Decide whether the following statements are TRUE or FALSE.

Page 11: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

11

Activity 8.1

e) The Hair and Teeth of the same person are composed of same DNA molecules.

f) Identical twins have different base sequences of DNA .

g) In the DNA structure, adenine (A) will only link with cytosine (C) and guanine (G) will only link with thymine (T).

Page 12: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

12

Activity 8.1

Answers:a. Fb. Tc. Td. Fe. Tf. Fg. F

Page 13: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

13

Activity 8.1

2. DNA has two strands. And the sequence of one strand determines the sequence of the other. If the base sequence on one strand of DNA is:GATCCTCATAGATCCTCATA

What is the base sequence on the other strand?

Answer: GATCCTCATAGATCCTCATACTAGGAGTATCTAGGAGTAT

Page 14: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

14

Did you see DNA before?

Page 15: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

15

Activity 8.2 DNA Extraction

1. Objective of experiment

To extract DNA from strawberries with washing-up liquid.

2. Apparatus and Materials• washing-up liquid (detergent)• salt• ice-cold alcohol• ice bath

Page 16: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

16

Activity 8.2

3. Follow the procedures to extract DNA.① Grind strawberries with a pestle in the mortar.② Add about 10 mL washing-up liquid, 1/2 teaspoon salt

and approximately 30 mL tap water to the grinded strawberries. Stir the mixture gently for 1 minute.

③ Filter the mixture through a muslin cloth into a test tube, about 1/3 full, to separate strawberries from the clear liquid.

④ Double up the volume of the mixture by adding alcohol slowly into the test tube.

⑤ Leave the mixture undisturbed for 2 – 3 minutes in an ice-bath until no emergence of bubbles.

⑥ Swirl a toothpick around the interface of the two layers formed inside the test tube. Long and stringy threads can be picked up.

Page 17: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

17

Activity 8.2 Questions (optional)

1. What is the purpose of grinding the strawberries?

To break down the cell wall, cellular membranes and nuclear membranes.

2. Where is the DNA of the strawberries?

In the cell nucleus.

3. What is the function of detergent in step 2?Soap dissolves cell membranes so that DNA is liberated.

Page 18: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

18

Activity 8.2 Questions (optional)

4. What is the function of salt in step 2?

Salt solution helps the DNA strands come together.

5. What happens when alcohol is added to the solution in step 4?

DNA is soluble in water and will appear clear in water. But DNA is insoluble in non-polar solvent, such as alcohol. Therefore, DNA will precipitate (solidify and appear) out of alcohol. Of course, this is not pure DNA.

Page 19: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

19

Follow-up Discussion

Write down your answers on a piece of paper.

Page 20: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

20

Activity 8.2 Follow-up Discussion Questions

1. Do you think your results would be different if you use a vegetable or fruit other than strawberries, say, onion, kiwi fruit, broccoli, banana (without skin)? Explain.

2. Do different organisms have the same DNA?

3. At a crime scene what evidence would you collect in order to extract DNA? List as many as possible.

Page 21: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

21

Activity 8.2

3. Blood (white blood cells), saliva, skin scalp, hair and etc.

Note that DNA is found in nearly every cell in the body. But one significant exception is red blood cells (lack cell nuclei).

Answers:

1. DNA can be easily extracted from many different plants. The amount of DNA extracted depends upon many factors, including the number of cells crushed, and whether the cells can be easily broken apart.

2. Though all DNA molecules are made up of similar chemical components, different organisms have different DNA molecules due to the different base sequences of the bases — A, T, G, and C, which makes a specific organism have distinctive characteristics.

Page 22: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

22

Where should you collect DNA evidence?

Page 23: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

23

Collection of DNA Evidence

1. Before the collection of evidence close-ups of any biological evidence should be photographed and its location relative to the entire crime scene needs to be recorded through notes, sketches, and photographs.

2. All clothing from both the victim and suspect should be collected and sent to the laboratory for examination. Why?

Page 24: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

24

Collection of DNA Evidence

Answer:

Because the criminal may have wiped his or her hands on materials not readily apparent to the investigator. In addition, blood may exist in less-than-obvious places.

Page 25: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

25

Activity 8.3 Collection & Preservation of DNA EvidenceGuess (i) the possible locations of DNA on the collected evidence from a crime scene and (ii) the possible sources of DNA.

Evidence Possible locations of DNA on the evidence

Sources of DNA

e.g. Eyeglasses Ear pieces Sweat, skin

Baseball bat

Facial tissue

Dirty laundry

Used cigarette

Blanket, pillow, sheet

Bite mark

Fingernail, partial fingernail

Page 26: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

26

Activity 8.3

AnswersEvidence Possible locations of DNA

on the evidenceSources of DNA

Eyeglasses Ear pieces Sweat, skin

Baseball bat Handle Sweat, skin, blood

Facial tissue Surface area Mucus, blood, sweat, semen

Dirty laundry Surface area Blood, sweat, semen

Used cigarette Cigarette butt Saliva

Bottle, can, glass Sides, mouthpiece Saliva, sweat

Blanket, pillow, sheet Surface area Sweat, hair, semen, urine, saliva

Bite mark Person’s skin Saliva

Fingernail, partial fingernail Scrapings Blood, sweat, tissue

Page 27: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

27

Preservation of DNA Evidence

• Paper bags or other “breathable” containers should be used. Because biologic evidence must never be packaged in airtight containers because moisture can build up, which promotes the growth of bacteria that can degrade DNA.

• All precautions against contamination must be taken. These include – wearing face marks, shoe covers and gloves; – using tools such as tweezers to collect evidence.

Page 28: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

28

Precautions in handling biological evidence

• All body fluids must be assumed to be infectious; hence, wearing disposable latex gloves while handling the evidence is required to prevent being infected.

Page 29: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

29

Can DNA be cut?

Page 30: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

30

Restriction Enzymes

• A common use of restriction enzymes is to generate a "fingerprint" of a particular DNA molecule.

• DNA may be cut by some special naturally-occurring proteins called restriction enzymes.

• Each restriction enzyme only identifies and “cuts” at a very specific sequence (recognition site) in the DNA strand.

• Restriction enzymes typically recognise a symmetrical sequence of DNA, such as the site GAATTC.

Page 31: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

31

Example 1

• The top strand is the same as the bottom strand when you read backwards.

• When the enzyme EcoRI cuts the strand between G and A, it leaves overhanging chains:

• These are termed "sticky ends" because the base pairs formed between the two overhanging portions will glue the two pieces together, even though the backbone is cut.

Read to the left

Read to the right

Page 32: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

32

Example 2

GGATCC

CCTAGG

When the enzyme Bam HI cuts the strand between G and G, it leaves overhanging chains:

Another symmetrical sequence of DNA, GGATCC:

G GATCC

CCTAG G

Page 33: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

33

Activity 8.4 Restriction Enzymes

• In the worksheet, different DNA samples with their restriction sites are given. Answer the following questions:

How many times does the specified base sequence appear?

How many fragments would result from a restriction digestion of the DNA sample with the given enzyme?

List all the fragments formed.

Page 34: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

34

Activity 8.4

Answers:1. a. The strand is cut into four pieces.

b. Fragments produced:

2. Hae III,

Bam HI

Page 35: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

35

How to separate DNA fragments?

Page 36: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

36

Electrophoresis

• DNA fragments of different sizes can be separated by using gel electrophoresis.

• DNA fragments carry negative charges. When there is a current flow, DNA fragments move towards the anode.

Source: Science Education Section, CDI, EDB.

Page 37: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

37

Outline of Electrophoresis

Page 38: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

38

Outline of Electrophoresis

1. DNA fragments are loaded into “wells” in a gel. The gel floats in a buffer solution within a chamber between two electrodes.

2. When an electric current is passed through the chamber, negatively charged fragments move towards the positive terminal.

3. Shorter DNA fragments (smaller size) move faster than the longer ones (bigger size).

4. In a given time, DNA fragments are separated into bands according to their size.

“wells”

Source: Science Education Section, CDI, EDB.

Source: Science Education Section, CDI, EDB.

Page 39: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

39

Electrophoresis demonstration

• The steps for Electrophoresis are demonstrated in the following video:

http://cd1.edb.hkedcity.net/cd/science/biology/resources/L&t2/practical.htm

(Video Clips: DNA Gel Electrophoresis)

Page 40: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

40

DNA Analysis Technique

Restriction Fragment Length Polymorphism (RFLP)

Page 41: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

41

RFLP

• It was the first commercial technique of DNA analysis.

• It can be used in paternity cases or criminal cases to determine the source of a DNA sample.

Page 42: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

42

RFLP

• Steps1. It uses restriction enzymes to cut DNA.

2. DNA fragments of different lengths are produced.

Page 43: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

43

RFLP

3. Using gel electrophoresis, the fragments are separated so that fragments with different lengths can be separated. This provides a pattern of bands.

Page 44: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

44

RFLP

4. Cover specific radioactive probes over the gel. The probes contain a match for the DNA sequence that the test is looking for.

Page 45: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

45

RFLP

5. Put a film under the gel to record. Allow signal exposure in dark room.

6. DNA fingerprints are now ready for analysis and comparison.For animation, you may browse http://ihome.cuhk.edu.hk/~z045513/

(Virtual Lab. Topic: 7. RFLP)

Page 46: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

46

Another DNA Analysis Technique

To learn more, you may surf the following websites:• Polymerase Chain Reaction (PCR)

( http://users.ugent.be/~avierstr/principles/pcr.html )• Short Tandem Repeats (STRs)

( http://www.cstl.nist.gov/biotech/strbase/intro.htm )• Mitochondrial DNA (mDNA)

( http://ghr.nlm.nih.gov/handbook )

Page 47: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

47

RFLP Vs PCR

Advantage of using RFLP (more often used in forensic work):

Can individualise a specimen to a narrow portion of the population-possibly one person in billions

Disadvantage of using RFLP:Requires a larger sample than PCR; more time-

consuming and labour intensive; uses radioactive reagents that require special lab. Procedures.

Page 48: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

48

PCR Vs RFLP

Advantages of using PCR:Faster and simpler to use and may be

applied to exceedingly tiny samples-as small as a billionth of a gram of DNA

Disadvantage of using PCR:Results of PCR are less dramatic than

those of RFLP, being discriminatory on the order of one individual in thousands rather than the potential billions with RFLP

(Crime Science: Methods of Forensic Detection (p.203))

Page 49: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

49

What is the use of DNA fingerprinting?

• More than 99% of the base sequence in DNA is the same in all humans. Less than 1% is unique to each individual.

• Scientists make use of this difference to generate DNA fingerprints which are specific to different individuals.

Page 50: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

50

Try to match two DNA fingerprints

Page 51: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

51

Warm-up exercise

In the following simulation,

http://www.pbs.org/wgbh/nova/sheppard/lab02.html– decide which two fingerprints match each

other;– drag the right-most DNA fingerprint over the

suspects’ fingerprints to find a match.

Page 52: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

52

Activity 8.5 DNA Fingerprint Analysis

Case 1

Mr. Chan’s family consists of mom, dad and four kids. The parents have one daughter and one son together, another daughter is from the mother’s previous marriage, and the other son is adopted. Here are the DNA analysis results:

1. Which child is adopted? Why?

2. Which child is from the mother’s previous marriage? Why?

3. Who are the own children of Mr and Mrs Chan?

Page 53: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

53

Activity 8.5

Answers:• Child 4 is adopted.• Child 2 is the child from the mother’s

previous marriage.• Child 1 and Child 3 are own children of

Mr and Mrs Chan.

Page 54: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

54

Activity 8.5

Case 2A blood sample from a crime scene was collected. DNA samples of the victim and the potential suspects (June, Scarlet and John) were also collected for DNA analysis. The DNA profile is shown. Now, you should be able to identify the potential murderer.

Page 55: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

55

Activity 8.5

Answers:

• All of the DNA fragments of Scarlet can be found in the crime scene sample making her the most likely suspect.

Page 56: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

56

Activity 8.5

Extended discussions:

1. Both June and Scarlet have the same DNA fragments (“8” and “12”), why?

2. Why DNA evidence must be combined with the traditional forms of evidence such as eyewitness accounts?

Page 57: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

57

Activity 8.5

Answers:1. This pattern may arise if the two women are related or i

f this pattern were common in population.2. Someone’s DNA is found at a crime scene does not m

ean that they committed the crime because of the following reasons:(i) The DNA sample may be contaminated by the environment.(ii) The sample may be a mixture of more than one person’s DNA.(iii) The DNA evidence may be degraded or broken down.

Page 58: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

58

Activity 8.6Ethical and Non-ethical Issues

Write down your answers on a piece of paper.

Page 59: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

59

Activity 8.6 Group Discussions

1. Do white blood cells give more accurate test result for paternity than cheek cells?

2. What are the legal and ethical issues on the use of DNA fingerprinting in society?

3. DNA fingerprinting can be used to convict someone of a crime. What would be the difficulty in using this technique to identify criminals if the suspects were father and son / twin brothers?

4. Other than forensic science, list out the other uses of DNA analysis. Describe each use briefly.

Page 60: 1 Lesson 8 DNA Fingerprinting. 2 Read the following article. Mr. Chan applied for permission for his son to come to HK to live with him, he had to provide.

60

References

• Nickell, J. and Fischer, J.F. (1999). Crime Science: Methods of Forensic Detection. Kentucky: The University Press of Kentucky.


Related Documents