UV-induced phycobilisome dismantling in the marine picocyanobacterium Synechococcus sp. WH8102

REGULAR PAPER

UV-induced phycobilisome dismantling in the marinepicocyanobacterium Synechococcus sp. WH8102

Christophe Six Æ Ludovic Joubin Æ Frederic Partensky ÆJulia Holtzendorff Æ Laurence Garczarek

Received: 13 October 2006 / Accepted: 7 April 2007

� Springer Science+Business Media B.V. 2007

Abstract The marine picocyanobacterium Synechococ-

cus sp. WH8102 was submitted to ultraviolet (UV-A and

B) radiations and the effects of this stress on reaction center

II and phycobilisome integrity were studied using a com-

bination of biochemical, biophysical and molecular biology

techniques. Under the UV conditions that were applied

(4.3 W m–2 UV-A and 0.86 W m–2 UV-B), no significant

cell mortality and little chlorophyll degradation occurred

during the 5 h time course experiment. However, pulse

amplitude modulated (PAM) fluorimetry analyses revealed

a rapid photoinactivation of reaction centers II. Indeed, a

dramatic decrease of the D1 protein amount was observed,

despite a large and rapid increase in the expression level of

the psbA gene pool. Our results suggest that D1 protein

degradation was accompanied (or followed) by the dis-

ruption of the N-terminal domain of the anchor linker

polypeptide LCM, which in turn led to the disconnection of

the phycobilisome complex from the thylakoid membrane.

Furthermore, time course analyses of in vivo fluorescence

emission spectra suggested a partial dismantling of phy-

cobilisome rods. This was confirmed by characterization of

isolated antenna complexes by SDS-PAGE and immuno-

blotting analyses which allowed us to locate the disruption

site of the rods near the phycoerythrin I—phycoerythrin II

junction. In addition, genes encoding phycobilisome com-

ponents, including a-subunits of all phycobiliproteins and

phycoerythrin linker polypeptides were all down regulated

in response to UV stress. Phycobilisome alteration could be

the consequence of direct UV-induced photodamages and/

or the result of a protease-mediated process.

Keywords Photoinhibition � Photosystem II �Phycobilisome � Phycoerythrin � Synechococcus �UV

Introduction

The impact of UV radiations on the physiology of photo-

synthetic cells, in particular cyanobacteria and algae, has

been extensively studied (see, e.g., Holzinger and Lutz

2006; Sinha et al. 2001; Xue et al. 2005). Damages to

nucleic acids, proteins, and lipids may occur either by di-

rect photochemical reaction or by indirect oxidation, due to

reactive oxygen species induced by UV-B (He and Hader

2002a, b, c; He et al. 2002). Although DNA damages are

often considered as the main lethal cause of these radia-

tions, UV also strongly affect components of the photo-

synthetic apparatus, among which light harvesting

complexes and reaction center II (RCII) constitute primary

targets. In cyanobacteria, Lao and Glazer (1996) calculated

that phycobilisome (PBS) components and chlorophyll-

binding proteins accounted for more than 99% of the UV

absorption and they estimated that UV-B damage to these

light-harvesting complexes may significantly exceed that to

DNA. The involvement of the RCII protein D1 (and to a

least extent D2) in the response to UV stress has been

clearly evidenced in higher plants (Barbato et al. 2000;

Strid et al. 1994), algae (Xiong 2001) and cyanobacteria

(Campbell et al. 1998; Sicora et al. 2006; Vass et al.

1999). In particular, cyanobacteria often possess multiple

copies of the psbA gene which encode either constitutive

D1 protein or an inducible form of this protein thought to

C. Six � L. Joubin � F. Partensky � J. Holtzendorff �L. Garczarek (&)

Station Biologique, UMR 7144 CNRS et Universite Pierre et

Marie Curie, B.P. 74, 29682 Roscoff cedex, France

e-mail: [email protected]

123

Photosynth Res

DOI 10.1007/s11120-007-9170-4

play a role in the protection of RCII from UV radiation,

possibly by increasing thermal dissipation of energy (see

e.g., Campbell et al. 1998; Sicora et al. 2006).

Phycobilisomes, the major antenna system of most

cyanobacteria and of red algae, are macrocomplexes con-

stituted of a central core and radiating rods that function in

harvesting and channeling light energy toward RCs (mostly

RCII). They consist of chromophorylated hexameric pro-

teins (phycobiliproteins) maintained together by linker

polypeptides. One of them, called LCM, allows the attach-

ment of the PBS core to the thylakoid membrane (Capuano

et al. 1991, 1993). There are four types of phycobilipro-

teins differing in their bilin (chromophore) composition.

Allophycocyanin (AP) is only present in the PBS core and

binds the blue phycobilin phycocyanobilin (PCB). The

basal part of the rods (or the whole rod in some cyano-

bacterial strains) is composed of phycocyanin (PC). This

phycobiliprotein binds only PCB or a combination of PCB

and the red phycobilin phycoerythrobilin (PEB; Ong and

Glazer 1987). Finally, the tips of the rods are often

constituted of phycoerythrin (PE) or, more rarely, of phy-

coerythrocyanin (Fuglistaller et al. 1981; Glauser et al.

1992). PE always binds PEB (Glazer 1989; Sidler 1994),

and may also bind an additional orange phycobilin, the

phycouroubilin (PUB; Ong and Glazer 1991). Each of

these chromophores display distinct absorption maxima

ranging from the blue–green to the red region of the visible

light spectrum. They are arranged within the PBSs from the

highest to the lowest-energy level in order to allow a rapid

and orientated energy transport from the rod tips to the PBS

core and in fine to the RC (Glazer 1989). Although most

linker polypeptides are not chromophorylated, they have

been shown to participate in the energy migration process

through the PBSs by modifying the absorption properties of

phycobiliproteins (Glazer 1989; Wendler et al. 1986; Yu

and Glazer 1982; Yu et al. 1981).

Until recently, most studies about UV effects on

cyanobacteria have been carried out on freshwater strains

(Lao and Glazer 1996; Rajagopal and Murthy 1996; Pan-

dey et al. 1997; Sinha et al. 1995; Rajagopal et al. 1998;

Sah et al. 1998; Rinalducci et al. 2006). These works

demonstrated that UV-B exposure inhibits O2 evolving,

induces perturbations of energy transfer and degradation of

allophycocyanin and/or phycocyanin. Also, Sah et al.

(1998) have suggested an effect of UV light on the anchor

linker polypeptide (LCM). Nevertheless, while many of the

freshwater model organisms have fairly simple PBS rods

solely constituted of PC, most Synechococcus spp. from the

marine cluster 5.1 (Fuller et al. 2003; Herdman et al. 2001)

possess a much more sophisticated PBS structure (Ong and

Glazer 1991; Six et al. 2005a; Wilbanks and Glazer 1993).

Indeed, their PBS rods often contain two types of PE, PEI

and PEII, in addition to PC. PEI binds either PEB only or

both PEB and PUB, while PEII always carries both chro-

mophores (Ong and Glazer 1991; Six et al. 2005a).

Synechococcus is ecologically very important in the

marine environment. As one of the two main cyanobacte-

rial genera (with Prochlorococcus) dominating the pic-

ophytoplankton (<2 lm) communities in marine

ecosystems, it plays a key role in primary production,

biogeochemical cycling and represents a basal compart-

ment of the marine food web (Partensky et al. 1999). In

oceanic waters, it has been shown that UV light can se-

verely affect photosynthesis as well as other cellular pro-

cesses (Booth et al. 2001; Hader et al. 1995; Smith et al.

1992) and because of their tiny size, picocyanobacteria are

particularly sensitive to these radiations (Llabres and

Agusti 2006).

In the present study, we have used a combination of

biochemical, biophysical and molecular biology techniques

to analyze the UV effects on the cell physiology and

integrity of pigment-binding proteins of Synechococcus sp.

WH8102, a strain representative of marine picocyanobac-

terial communities from oligotrophic areas. This organism

is emerging as a new model organism since its genome has

been fully sequenced (Palenik et al. 2003) and because it is

genetically amenable (Brahamsha 1996). We here show

that UV radiations are affecting not only its RCII but also

specific parts of its PBSs and we propose a model of the

response of the light harvesting complexes of Synecho-

coccus sp. WH8102 to UV stress.

Material and methods

Culture and UV stress conditions

Duplicate cultures of the Synechococcus sp. WH8102 clone

were grown in 8 l polycarbonate flasks (Nalgene,

Rochester, NY) in 0.2 lm filtered PCR-S11 medium

(Rippka et al. 2000) supplemented with 5 mM NaNO3.

Cells were placed under 10 lmol photons m–2 s–1 contin-

uous white light (Sylvania Daylight 58 W/154 fluorescent

bulbs) at 22�C. Five liters of an exponentially growing

(2.78 106 ± 0.66 106 cell ml–1; Fig. 1) and optically thin

culture were transferred into an 8 l quartz flask (Ellipse, La

Chapelle la Rennes, France) which transmittance is higher

than 90% for wavelengths above 260 nm. The cultures

were then incubated for 5 h under the same growth irra-

diance complemented with 4.3 W m–2 UV-A (from UVA-

351 fluorescent lamps from Q-Panel Lab products, Cleve-

land, OH) and 0.86 W m–2 UV-B (from UVB-313 lamps,

same company), as measured between 280–320 nm and

320–400 nm, respectively, using a USB2000 spectroradi-

ometer (Ocean Optics, Ew Duiven, The Netherlands). The

three remaining liters were used as non-treated controls.

Photosynth Res

123

The photosynthetically available radiations (PAR) were

measured in the 400–700 nm ranges using a QSL-2100

quantameter (Biospherical, La Jolla, CA). Aliquots of

cultures were collected at different times to study the

kinetics of the response to UV.

Flow cytometry analysis and chlorophyll relative

variation

Synechococcus cell concentrations were determined by

flow cytometry analyses. Immediately after sampling, cells

were fixed with 0.2% of glutaraldehyde (Sigma-Aldrich,

Saint-Louis, MO) for 30 min at 4�C, frozen in liquid

nitrogen and stored at –80�C. After thawing, cells were

analyzed according to Marie et al. (1999).

In addition, the time course variations of relative chl a

concentration in the culture were assessed by its room

temperature fluorescence emission at 680 nm (excitation at

440 nm) after acetone extraction of a cell pellet corre-

sponding to 1.5 ml culture.

Immunoblotting

The procedure used here is a modification of that described

by Six et al. (2005b). A volume of 100 ml of culture was

harvested by centrifugation and the cell pellet was resus-

pended in 1 ml Milli-Q water. Proteins were precipitated by

10% trichloroacetate (TCA), then resuspended in 4% so-

dium dodecyl sulfate (SDS) Laemmli denaturation buffer

(Laemmli 1970) devoid of b-mercaptoethanol. The protein

concentration was determined in each sample using the DC

protein assay kit (Bio-Rad, Hercules, CA) and equalized by

adding denaturation buffer in the denser samples. A volume

corresponding to a final concentration of 32 ll ml–1 b-

mercaptoethanol (Sigma-Aldrich) was then added and the

samples were vortexed and centrifuged at 15,294 · g for

10 min. The supernatant was heated for 2 min at 80�C and

loaded on a 12% acrylamide SDS-PAGE minigel (Bio-Rad)

and the electrophoresis ran for about 1 h at 130 V. Proteins

were then transferred overnight from the gel onto a nitro-

cellulose membrane in a Laemmli Tris-glycine buffer (pH

8.3) containing 10% methanol with an amperage of 0.5 mA

per gel cm2. Membranes were saturated during 1 h with

50% (m/v) milk in TTBS buffer (0.1% Tween, 20 mM

NaCl, 500 mM Tris) and incubated overnight at 4�C with

agitation in 0.5% milk TTBS containing rabbit primary

antibodies directed against the PE b-subunit (b-PE) of

Prochlorococcus sp. SS120 (courtesy of Wolfgang R. Hess,

University of Freiburg, Germany) or against D1 polypep-

tides (from Research Genetics, Huntsville, AL). After

rinsing with 0.5% milk TTBS, a secondary anti-rabbit

antibody coupled to horseradish peroxidase (Bio-Rad) was

applied for 2 h at room temperature. The chromogene

reaction was allowed by soaking the membrane in 50 mL

TBS buffer containing 20% methanol, 0.04% chloronaphtol

and 30 ll hydrogen peroxide 30%, with agitation.

In vivo fluorescence measurements

In vivo fluorescence emission (excitation at 495 nm) and

excitation (emission at 580 nm) spectra were recorded as

described by Six et al. (2004) using a Perkin–Elmer LS50B

spectrofluorimeter equipped with a red sensitive photo-

multiplier.

Photosystem II fluorescence was studied with a Pulse

Amplitude Modulated (PAM) fluorimeter (PhytoPAM,

Walz, Effeltrich, Germany). Fluorescence emission was

measured at 90� to the excitation source on a 2 ml culture

sample in a square quartz cell with one mirror facet in

order to amplify the signal. A reference file for the relative

excitation efficiencies corresponding to each of the four

excitation wavelengths of the PhytoPAM fluorimeter was

generated with a low light-grown Synechococcus sp.

WH8102 culture, enabling proper signal deconvolution.

The measured excitation efficiencies were the following:

0.910 at 470 nm, 1.0 at 520 nm, 0.203 at 645 nm and 0.163

at 665 nm.

After 10 min relaxation in darkness, the modulated

(non-actinic) light was switched on, allowing the deter-

mination of a basal fluorescence signal (Fo). The sample

was then submitted to a series of twenty red-light irradi-

ance steps (of 50 s each) increasing from dark to ca.

2,000 lmol photons.m–2 s–1 and a single saturating light

pulse of 4,000 lmol photons m–2 s–1 was applied after

each step. The maximal fluorescence in dark- and light-

adapted (Fm¢) samples were then determined and the

Fig. 1 Typical growth curve of Synechococcus sp. WH8102 grown

in the same environmental conditions as the experimental cultures.

The dashed line shows the cell concentration of the experimental

cultures at the beginning of the UV stress experiment which is in the

middle of the exponential phase

Photosynth Res

123

signals corresponding to the four wavelengths were de-

convoluted using the PhytoWIN software (Walz). The

effective quantum yield of photochemical energy conver-

sion (FPSII) was calculated according to Genty et al.

(1989), as follows:

UPSII ¼ (Fm0 � Ft)/Fm

0 ð1Þ

where Ft is the fluorescence steady-state level immediately

prior to the flash. The relative electron transport rate

(rETR) was calculated as follows (Genty et al. 1989):

rETR ¼ UPSII � I� 0.5 ð2Þ

where I is the irradiance in lmol photons m–2 s–1.

The photosynthetic parameters, the initial slope of the

rETR versus I curve (a), the maximal rETR (rETRmax) and

the subsaturating irradiance (Ik) were determined by fitting

the photosynthesis model for phytoplankton from Eilers

and Peters (1988).

RNA isolation and cDNA synthesis

Immediately after sampling, cells from 200 ml culture

were harvested by centrifugation (9 min, 4�C, 18,500 · g

in a Beckman Avanti J25 centrifuge), quickly resuspended

in 1 ml of culture medium and centrifuged again (4 min,

4�C, 20,800 · g in an Eppendorff 5417R centrifuge). Cell

pellets were then resuspended in 300 ll Trizol (Invitrogen,

Carlsbad, CA), quickly frozen in liquid nitrogen and kept at

–80�C. RNA extractions were performed as recommended

by the manufacturer with slight modifications. Briefly, cells

resuspended in Trizol were heated at 65�C for 15 min with

regular vortexing. This step was followed by two chloro-

form extractions (0.2 ml of chloroform per ml of Trizol)

before precipitation in 2 volumes of ethanol, as described

in the original protocol. A DNase treatment (DNAse I

FPLC purified, GE Healthcare Bio-Sciences, Uppsala,

Sweden) was performed for 30 min at room temperature

and followed by two phenol/chloroform (1:1) and one

chloroform extractions before precipitation in two volumes

of ethanol. RNA pellets were then resuspended in 20 ll

DEPC-treated water and stored at – 80�C.

Reverse transcription was carried out on 100 ng RNA

using SuperScriptII (Gibco-BRL, Gaithersburg, MD) re-

verse transcriptase. RNA was denatured for 10 min at 70�C

in presence of 20 U of RNase inhibitor (RNasine, Ambion,

Austin, TX) and 4 pmoles of primers. After cooling down

to 50�C, 10 ll of a mixture containing reverse transcriptase

(100 U), 1· reaction buffer, 10 lM DTT and dNTP

(0.25 mM each) were added to the reaction. Reverse

transcription was performed for 50 min at 42�C followed

by a 15 min denaturation step at 72�C.

Quantitative PCR

Gene specific primers (Table 1) were designed using

PrimerExpressTM software (V2.0) from Applied Biosys-

tems to amplify the major a-phycobiliprotein subunits as

well as the PE linkers from Synechococcus sp. WH8102.

Real time PCRs were performed with the GeneAmp 5700

detection system using the Sybr Green PCR master mix

(Applied Biosystems, Foster City, CA). PCRs were per-

formed on 1/100th diluted cDNA (but 1/1000th for rnpB)

in presence of 200 nM or 500 nM of primers. Reactions

were incubated for 10 min at 95�C followed by 40 cycles

of 15 s at 95�C and 1 min at 60�C and terminated with a

ramping to 95�C in order to perform a fusion curve.

Quantification of the relative fold change in mRNA

levels was calculated using the DDCT method as described

Table 1 Primers used for quantitative RT-PCR reactions for Syn-echococcus sp. WH8102. All primers are specific for the targeted

gene but the psbD and psbA primers which were designed to amplify

the two psbD gene copies and all four psbA copies present in

Synechococcus sp. WH8102, respectively

Gene Forward primer (5¢–>3¢) Reverse primer (5¢–>3¢)

apcA CGTGACCCCGATCGAAGA TGCCCAGGGAGCGATAGAG

rpcA AGCAACTCCCGAAGGCAAGT GTAGGTGATCATGCGCAGGTAGTA

cpeA CGTCTGATCAACTACTGCCTTATTG ACCTCACGAGCACCAGCAA

mpeA GCTAGCCATCAACGGTCAGAA AAACCAGCAACGTAGGTTCCA

cpeC AGGCACCATTCGAGCTGATC CGCCCGAATGATTTGTTCTT

mpeD CCGGAGGACAATGGTTCTCTAG GACATGAGCGTTCCCGAAGA

mpeE CTGCGTGCATGGACATCAG GGAGTGACGCGAGCAAGGT

mpeC TGCGGACTGCCGATTCTT GGCAAGCTCCCTCATCATGT

psbA TTCTCTCGATGAGTGGCTGTACA TGCCGATCAGGAAGTGGAA

psbD GCACTGCTCTGCGCCATT TGCTCACCGTCCTCAAACAA

rnpB TAACGGCGGTCCCAGATAGA TGTTCACGCCTCCGAAGAG

Photosynth Res

123

in the Applied Biosystems user bulletin #2 (http://

www.dna-9.int-ed.uiowa.edu/RealtimePCRdocs/Com-

par_Anal_Bulletin2.pdf). The rnpB gene, whose expression

has been shown to be unaffected by light (Mary and Vaulot

2003), was used as an internal standard to normalize the

relative transcript levels. Standard curves were generated

using diluted cDNA with a maximum dynamic range and

were used to calculate the amplification efficiency for each

set of primers. Variations of efficiency between the refer-

ence and the target genes were less than 5% for all studied

genes and each real time RT-PCR was performed in

triplicate.

PBS isolation and characterization

The procedure of PBS extraction and purification on su-

crose gradient used here is described elsewhere (Six et al.

2005a). Briefly, cells were harvested by centrifugation,

washed and resuspended in 0.75 M phosphate buffer con-

taining proteases inhibitors (n-caproic acid, benzamidin

and phenylmethylsulfonyl fluoride, 1 mM each) and bro-

ken twice using a French press system at 4�C. Most of the

membranes and hydrophobic pigments were removed after

1 h incubation in the presence of 5% Triton X-100 fol-

lowed by a centrifugation at room temperature allowing a

phase separation. The reddish aqueous layer was carefully

collected and loaded on a discontinuous sucrose gradient

(1.0–0.25 M sucrose for the control condition and 0.75–

0.25 M for the UV-treated cells; see below). The colored

bands were collected and characterized by their absorption

with a UVIKON spectrophotometer, as described by Six

et al. (2004). After a 10% TCA-induced precipitation and

resuspension in a 4% lithium dodecyl sulphate (LiDS)

denaturating buffer, the samples were heated during 2 min

at 80�C and centrifuged 10 min at 15,294 · g. The PBS

polypeptides were visualized on a Coomassie stained

LiDS-PAGE 10–20% acrylamide continuous gradient.

Results

Cell concentration and chlorophyll

The concentration of Synechococcus sp. WH8102 cells, as

determined by flow cytometric analysis, did not signifi-

cantly vary during the 5 h of UV exposure in the experi-

mental culture and cells were able to grow normally when

returned to control conditions (not shown). This indicates

that the UV dose received by the cells did not cause any

significant mortality. Fluorescence emission at 680 nm

(with excitation at 440 nm) of acetone extracts indicated

that the relative chl a concentration in the UV-stressed

cultures slightly decreased (by 10%) during the UV stress

(not shown). This degradation can reasonably be attributed

to a large extent to the degradation of the D1 protein (see

below).

Reaction center II and phycoerythrins

Immunoreactions on whole cell proteins using antibodies

directed against b-PE and D1 (PsbA) allowed analyzing the

variations of the relative quantity of these proteins

throughout UV exposure (Fig. 2a). We first studied the

specificity of the antibody raised against Prochlorococcus

marinus SS120 b-PE subunits using phycobiliprotein

complexes purified from Synechococcus sp. WH8102 by

isoelectric focusing, as described by Six et al. (2005a).

These assays showed that this antibody cross-reacted with

both PEI (CpeB) and PEII (MpeB; data not shown). During

the UV stress, the relative PE concentration of Synecho-

coccus sp. WH8102 cells remained nearly unchanged,

providing evidence that there was no degradation of these

proteins during the stress. In contrast, the relative amount

of the RCII polypeptide D1 decreased dramatically until

becoming barely discernible after 5 h of UV exposure

(Fig. 2a).

a

0 15 45 150 300

β -PE

D1

UV exposure (min)

Irradiance (µmol photons.m-2

.s-1

)

0 500 1000 1500 2000

RT

Er

0

10

20

30

40

50

60

70

80

0

15

45

150

b0 min

15 min

45 min

150 min

Fig. 2 (a)

Immunoreactions against

D1 (PsbA) and b-PE (MpeB

and CpeB) proteins after 0,

15, 45, 150, and 300 min

exposure of Synechococcussp. WH8102 cultures to UV

stress; (b) Variations of

relative electron transport

rate versus irradiance

curves (fitted with Eilers

and Peters (1988)’s model)

at 0, 15, 45, and 150 min of

UV exposure

Photosynth Res

123

Photochemistry

Prior to the UV treatment, Synechococcus sp. WH8102

acclimated to low light (10 lmol photons m–2 s–1) exhib-

ited a maximal FPSII of ca. 0.45. This value sharply de-

clined over the experiment until total inhibition after 5 h of

UV exposure (Table 2). Analysis of the Photosynthesis/

Irradiance curves fitted with the Eilers and Peters model

(Eilers and Peters 1988) confirmed important changes in

the photochemistry of Synechococcus sp. WH8102

(Fig. 2b). Indeed, the rETRmax followed the same trend as

FPSII (Table 2). Moreover, the optimal photosynthetic

irradiance Ik also decreased from 373 lmol to 190 lmol

photons m–2 s–1. It must be noted that these Ik values ap-

pear very high given that cells were preacclimated under

low light. This could suggest that cells were strongly light-

limited under these growth conditions, and therefore nee-

ded ca. 35-fold of their growth irradiance to achieve an

optimal compromise between light capture and electron

transport capacity. More likely, the fluorescence parame-

ters measured by the PhytoPAM fluorimeter (Fig. 2b) in

fact correspond to the light saturation profile of the sole

PSII rather than the light saturation profile of photosyn-

thesis in general.

Gene expression

Transcript levels of genes encoding RCII and phycobilisome

structural components also showed a strong reaction to UV

stress (Fig. 3). The high induction of genes encoding D1 and

D2 clearly supports the rapid degradation and regeneration

of these RCII proteins. Globally, the psbA gene pool (our

primer set amplified all four psbA genes present in Syn-

echococcus sp. WH8102) was however ca. 8-fold more in-

duced than was the psbD gene pool (two almost identical

psbD genes are found in the WH8102 genome). For both

gene types, a maximum of differential expression was ob-

served after 45 min of UV stress then gradually decreased till

the end of the stress (Fig. 3a), likely due to a progressive

decrease of the cell metabolism during the stress.

In contrast, the phycobiliprotein a-subunit genes were

already strongly down regulated after 15 min of UV

exposure (Fig. 3b) and, despite some variability among

replicates as well as over the course of the experiment, it

seems that the level of inhibition was more or less related

to the position of the encoded protein within the PBS.

Table 2 Variations of photosystem II fluorescence parameters in Synechococcus sp. WH8102 during UV exposure

Time

(min)

Fmax a rETRmax Imax

(lmol photons m–2 s–1)

Ik

(lmol photons m–2 s–1)

0 0.43 ± 0.01 0.215 ± 0.007 74.0 ± 7.1 1,025 ± 7 373 ± 2

15 0.30 ± 0.03 0.130 ± 0.004 37.0 ± 2.9 785 ± 35 289 ± 13

45 0.10 ± 0.02 0.045 ± 0.007 12.5 ± 0.7 715 ± 261 287 ± 39

150 0.04 ± 0.00 0.018 ± 0.003 3.5 ± 0.7 480 ± 28 190 ± 28

300 0 – 0 – –

01

10

100

psbA

psbD

0.01

0.1

1

10

apcA

rpcA

cpeA

mpeA

Time (min)

0.001

0.01

0.1

1

10cpeC

mpeD

mpeE

mpeC

a

b

c

)U

A(n

oisse rpxe

evitaleR

30025020015010050

0 30025020015010050

0 30025020015010050

Fig. 3 Real time analyses of the relative expression of genes

encoding (a) the reaction center II proteins PsbA (D1) and PsbD

(D2), (b) the phycobiliprotein a-subunits (MpeA, CpeA, RpcA and

ApcA) and (c) the phycoerythrin linker polypeptides MpeC, MpeD,

MpeE and CpeC in Synechococcus sp. WH8102 during the time

course of UV exposure

Photosynth Res

123

Thus, it appears that genes encoding phycobiliproteins lo-

cated in the PBS core (apcA, encoding AP a-subunit) and at

the base of the rods (rpcA, encoding PC a-subunit) were

less inhibited than were genes encoding phycobiliproteins

located at the tip of the rod, i.e., cpeA and mpeA, encoding

the a-subunits of PEI and PEII, respectively. A similar

hierarchy seemingly occurred among the genes encoding

PE linkers (Fig. 3c), with cpeC encoding one of the PEI

rod linker being less inhibited than was mpeD encoding the

PEI-PEII rod linker, itself being less inhibited than the

genes encoding the PEII linkers MpeC and MpeE. It is also

worth noting that linker polypeptide genes were about 10-

fold more repressed than were a-subunits (compare

Fig. 3b, c).

Phycobilisome fluorescence properties

Changes in the patterns of in vivo fluorescence emission

with excitation at 495 nm (i.e., at the PUB excitation

maximum) during UV exposure revealed strong variations

of the PBS fluorescence properties (Fig. 4). During the first

hour, the height of the PC and terminal acceptor (TA)

peaks (fluorescence emission maxima at 650 and 680 nm,

respectively) doubled, indicating a progressive uncoupling

of PBSs from RCs, whereas there was little variation of the

PE fluorescence maximum. During the following hours, the

PC and TA maxima kept on increasing, but the PE maxi-

mum also started to dramatically increase to finally reach

about 300% of its initial fluorescence after 5 h of UV

exposure, indicating a partial PBS dismantling. Concomi-

tantly, a marked shift of the position of the PE emission

maximum (from 563 nm at time 0 to 570 nm after 5 h of

UV exposure) was observed. When the culture was left for

24 h under UV light, the whole cell fluorescence emission

spectrum was similar to that of isolated PEII complexes

(compare Fig. 4 in this study to Fig 7B in Six et al. 2005a).

This spectrum showed lower fluorescence compared to

those in the first hours of UV stress, likely due to phyco-

biliprotein degradation.

Characterization of intact phycobilisomes from UV

treated cells

After whole PBS extraction, the separation of PBS frac-

tions on sucrose gradient revealed strikingly distinct pat-

terns between the control and UV-treated cells (Fig. 5a).

Indeed, the main pinkish PBS band of UV-stressed cells

(band A¢) was observed at a lower density (0.62 M sucrose)

than that of control cells (band A; 0.75 M sucrose). This

indicates that UV-treated PBSs are lighter than the non-

treated controls. Moreover, the UV-stressed samples pre-

sented an additional brightly orange fluorescing band (B) at

the top of the tube (0.25 M sucrose). Absorption spectra

normalized at the PCB maximum (ca. 630 nm) of bands A

and A¢ are shown in Fig. 5b. UV-treated PBSs (band A¢)showed a lower relative content in both PUB and PEB (the

PE chromophores) than those of the control culture (band

A). The upper orange band B was devoid of PCB chro-

mophores as shown by the very weak absorption at 630 nm

and its absorption properties were very similar to those of

isolated PEII complexes (Six et al. 2005a).

LiDS-PAGE gel revealed clear differences in the PBS

linker composition of the sucrose gradient bands (Fig. 6)

between control (band A) and UV-treated PBSs (band A¢).The most notable difference was the quasi disappearance in

the latter of the PEII-associated linkers MpeC and MpeE,

which are the two most distal linker polypeptides in the

PBS rods (Six et al. 2005a). Compared to the control, UV-

treated PBSs also exhibited a lower proportion of LCM, the

large-sized core-membrane anchor linker polypeptide, and

a larger proportion of LCM¢, its degradation product. It is

noteworthy that LCM¢ also seems to be present in a sig-

nificant amount in the orange fraction B observed at the top

of the UV-stressed cells sucrose gradient, although precise

assignment of bands to proteins is more difficult in this

fraction, since the upper part of the gradient contains many

non-PBS proteins. At last, fraction B also displayed a broad

band centered around 17 kDa, mainly attributable to PEII aand b-subunits since, according to absorption measure-

ments, PEII was predominant in this fraction (no PCB,

PUB:PEB ~ 2.3).

Wavelength (nm)

550 600 650 700 7500

10

20

30

40

50

60

70

80PE

PC

TA

0

15

45

90

150

30024 h

min

min

min

min

min

min

)U

A(ytis

netnI

ecnecser

oul

F

Fig. 4 In vivo fluorescence emission spectra with excitation at

495 nm (PUB maximum) of Synechococcus sp. WH8102 after 0,

15, 45, 90, 150, 300 min, and 24 h of UV exposure, showing the

phycoerythrin (PE), phycocyanin (PC) and terminal acceptor (TA)

emission fluorescence maxima

Photosynth Res

123

Discussion

The UV stress applied in this study was chosen with a high

ratio of UV light to growth irradiance (10 lmol photons

m–2 s–1 PAR, 4.3 W m–2 UV-A, 0.83 W m–2 s–1 UV-B),

compared to natural conditions in order to maximize the

response of Synechococcus sp. WH8102 cells but without

leading to significant cell mortality. In the field, such a UV

dose would be found in the first 10–20 m of the eupotic

layer depending on the tropic status of the area but would

be associated with a PAR of ca. 750–1,500 lmol quan-

ta m–2 s–1. Although limiting the ecological interpreta-

tions, this strategy allowed us to better see the specific

effects of UV light on the photosynthetic apparatus—and

in particular on the structure of PBSs which have a maxi-

mum complexity at low light—independently from those

of high light acclimation, which was studied in previous

papers (Six et al. 2004, 2005a).

These UV conditions resulted in a strong disturbance in

the photosynthetic performances of PSII, as indicated by

the large decrease in rETRmax as well as the progressive

inhibition of the a parameter of Photosynthesis—Irradiance

curves, usually reflecting the light-harvesting capacities of

the PSII (Table 2 and Fig. 2b). Decrease of the photosyn-

thetic apparatus efficiency is also confirmed by the

Wavelength (nm)

400 450 500 550 600 650 700

)U

A( ecna

bros

ba evitaleR

0

2

4

6

8

10

12

14

16

18AA'B

PUB

PEB

PCB

ba Control UV stress(300 min)

0.75

0.75

1.00

0.62

0.62 0.50

0.50 0.37

0.250.25

)M( es

orcu

S )M (

es

orc

uS

A A’

B

Fig. 5 (a) Sucrose gradient

after ultracentrifugation of

phycobilisomes (PBS) at time 0

(left tube) and after 300 min of

UV exposure (right tube),

showing the three distinct PBS

fractions A (intact PBS), A¢(damaged PBS after 300 min

UV exposure) and B

(disconnected complexes

after 300 min UV exposure);

(b) absorbance properties of

these fractions

LCM’LCM

FNR

MpeCCpeC

CpcG1-2CpeE

αβ-subunits

MpeE

MpeD

150

10075

50

37

25

20

15

10

(kDa)

A BA’

Fig. 6 Coomassie-stained LiDS-PAGE gel of the PBS fractions from

the sucrose gradients shown on Fig. 5: A (intact PBS before UV

exposure), A¢ (damaged PBS after 300 min UV exposure) and B

(disconnected complexes fraction after 300 min UV exposure). The

identity of bands in the control has been determined in a previous

study (Six et al. 2005a). Mpe: components of phycoerythrin II, Cpe:

components of phycoerythrin I, Cpc: components of phycocyanin

PSII PSII

Initial conditions UV stress situation (300 min)

PEIIPEIR-PC

AP

Linker

PSII PSII

Fig. 7 Schematic

representation of UV effects on

the PBSs of Synechococcus sp.

WH8102. The rod structure is

taken from the model of Six

et al. (2005a). The arrow points

the anchor LCM linker

polypeptide, see text for

description

Photosynth Res

123

photoinactivation of the RCII complex which began rap-

idly after transferring cells under UV light. Indeed Western

blotting using an antibody targeting the D1 protein indi-

cates a rapid degradation of this protein, although the

expression of the psbA gene pool was highly induced (40-

to 80-fold) shortly after exposing the cells to UV (Figs. 2a,

3a). Thus the acceleration of the D1 biosynthesis turnover

was not fast enough to compensate for the rapid degrada-

tion of this complex under UV light, as previously ob-

served in other organisms (Wilson and Greenberg 1993).

The light-harvesting capacity of PSII was also strongly

affected by the UV stress, as indicated by analyses per-

formed on the PBS itself. The LCM is a large

PCB-chromophorylated linker polypeptide, the N-terminal

region of which contains an external loop thought to be

involved in the attachment of the PBS to the photosynthetic

membrane (Sidler 1994). It has also been suggested to be

the terminal energy acceptor (TA) of the PBS (Gindt et al.

1994). This peculiar linker polypeptide is thus a key ele-

ment in the PBS-RC interaction. Interestingly, LiDS-PAGE

gel analysis showed that in Synechococcus sp. WH8102,

the level of the LCM linker polypeptide declined after

300 min UV exposure, being partially replaced by its

degradation product LCM¢ which is about 20 kDa shorter

than LCM and likely lacks the N-terminus domain,

including the thylakoid binding loop (Fig. 6). This strongly

suggests that a large number of PBSs may get disconnected

from the thylakoid membrane during UV stress, therefore

disrupting the electron transfer to the RCs. Poppe et al.

(2003) visualized by transmission electronic microscopy

such a release of antenna complexes in the rhodophyte

Phycodrys austrogeorgica. Rajagopal et al. (1998) also

reported a UV-induced degradation of the LCM linker

polypeptide in Spirulina platensis and it has been proposed

that this linker polypeptide could be the main site of UV-B

lesion in the PBSs of Synechococcus sp. PCC 7942 (Pan-

dey et al. 1997). Thus, it is likely that LCM alteration in-

duced by UV stress in Synechococcus sp. WH8102 led to

the release of antenna complexes in the cytosol.

Our results suggest that D1 disappearance occurred

concomitantly with perturbation of the energy transport at

the base of the PBS (probably due to the LCM degradation),

within the first 150 min of UV exposure. Thus, the reaction

center destruction and the LCM disruption may be linked,

both phenomena leading to the disconnection of PBSs. The

precise mechanism of PSII photoinhibition is still a con-

troversial subject. It has recently been proposed that the

oxygen evolving complex is damaged first by direct

absorption of UV radiations which would disrupt the

manganese cluster; then D1 degradation would occur as a

second step due to oxidative stress, either resulting from

the accumulation of P680+, a strong oxidant, or due to the

presence of reactive oxygen species (Ohnishi et al. 2005;

Zsiros et al. 2006; Nishiyama et al. 2006; Hakala et al.

2005). If this scenario is true, it is possible that disruption

of PBS linkage could occur third, as a result from the RC

core degradation.

The results presented here allowed us to better charac-

terize the effects of UV stress on the PBSs themselves.

After 90 min of UV exposure, the fluorescence emission

spectra showed a large increase in PE fluorescence (Fig. 4).

Araoz and Hader reported that a Nostoc sp. strain isolated

in a high-altitude lake responded to excess UV by changing

the rod PBS composition and synthesizing PE (Araoz and

Hader 1999; 1997). In another study, Araoz et al. (1998)

also observed in this strain a drastic increase in PE fluo-

rescence upon UV exposure and again interpreted this re-

sult as indicating PE synthesis. Our interpretation of the

UV-induced PE fluorescence increase in Synechococcus sp.

WH8102 is however quite different. We believe that it

mainly translates the release of PE components from the

whole PBS structure, since free phycobiliproteins fluoresce

much more brightly than coupled ones.

Further evidence of PBS disruption was provided by

analyses of PBS fractions. Indeed, absorption spectrum of

the UV-induced fraction B (Fig. 5b) indicates that it con-

tains a large quantity of PE subunits. Moreover, the main

PBS fraction of UV-treated cells (band A¢) migrated higher

in the sucrose density gradient than the control one (band

A; Fig. 5a), indicating a smaller size of the PBSs after UV

exposure. Disappearance of the PEII-associated linker

polypeptides MpeC and MpeE, the most distal linkers of

the rod, strongly suggests that this smaller PBS size is due

to the release of the two distal PEII hexamers of the rods,

while the rest of the PBS structure remained unaffected

(Fig. 6). Furthermore, under UV stress, genes encoding

distal PBS components and linkers were more strongly

repressed than those encoding proximal or internal com-

ponents of the rods (Fig. 3). Similar down regulation of

PBS genes has been observed in Synechocystis sp. PCC

6803 in response to both high light and UV stresses (Hihara

et al. 2001; Huang et al. 2002).

Such a dissociation of PBS components in response to

UV-B had been previously reported in other cyanobacteria,

including Anabaena sp. PCC 7120 (Lao and Glazer 1996),

Synechococcus sp. PCC 7942 (Sah et al. 1998) and Syn-

echocystis sp. PCC 6803 (Rinalducci et al. 2006). In these

freshwater strains, UV radiations affected either both PC

and AP or mainly PC in the two latter studies. However,

our results are difficult to directly compare with these

studies given that Synechococcus sp. WH8102 possesses a

more sophisticated antenna system. Indeed, Anabaena sp.

PCC 7120 PBSs are composed of AP, PC and phy-

coerythrocyanin, a PC derivative (Ducret et al. 1996),

while Synechococcus sp. PCC 7942 and Synechocystis sp.

PCC 6803 possess only AP and PC. Thus, the particular

Photosynth Res

123

sensitivity of PEs to UV stress in Synechococcus sp.

WH8102 may be due to an intrinsic property of these

phycobiliproteins. Indeed, PEI possesses more bilin

attachment sites (5 per subunit) than AP and PC and PEII is

the phycobiliprotein which binds the highest number of

chromophores so far described (6 binding sites per subunit

in WH8102, Ong and Glazer 1991). Moreover, the PEII

linkers themselves have the peculiarity to bind PUB mol-

ecules (Six et al. 2005a; Wilbanks and Glazer 1993).

The data set presented here allowed us drawing a ten-

tative model of the UV-induced alterations on the PBSs of

Synechococcus sp. WH8102. On Fig. 7, a schematic PBS is

shown with a rod composition in accordance with the

model recently proposed by Six et al. (2005a). After pro-

longed UV exposure, PSII photoinhibition and/or LCM

degradation lead to PBS disconnection from the thylakoid

membrane and some (aPEII bPEII)6-MpeC and (aPEII bPEII)6-

MpeE complexes are released from the whole structure.

Several studies have focused on the role of NblA and

NblB polypeptides in the degradation of the PBSs of

Synechococcus sp. PCC 7942 and Synechocystis sp. PCC

6803 during nitrogen starvation (Collier and Grossman

1994; Dolganov and Grossman 1999). These polypeptides

which possess sequence motifs related to the phycobilin

lyases family are believed to be involved the sequential

dismantling of PBS complexes. There are no close homo-

logues of these genes in the Synechococcus sp. WH8102

genome and therefore they cannot be involved in the UV-

induced PBS complexes disruption in this strain. The dis-

connection of PBSs from the RCs as well as the release of

highly fluorescent phycobiliproteins in the cytosol likely

constitute a photoprotective mechanism as this prevents

excess photons to reach the RCII, dissipating excess actinic

light as fluorescence. Whether this process is due to UV-

induced photodegradation (direct or indirect through ROS

induced by UV-B) and/or the consequence of a still

unidentified protease activity remains to be investigated.

Acknowledgements This work was supported by the Region

Bretagne (program IMPALA), the national program PROOF-UVECO,

the EU programs MARGENES (QLRT-2001-01226) and SynChips, a

flagship project of the European Network of Excellence Marine Ge-

nomics Europe. We warmly thank Jean-Claude Thomas (Ecole Nor-

male Superieure, Paris) for his kind contribution to the biochemical

characterization of phycobilisome fractions and Douglas A. Campbell

(Mount Allison University, NB Canada) for his useful comments.

References

Araoz R, Hader DP (1999) Phycoerythrin synthesis is induced by

solar UV-B in the cyanobacterium Nostoc. Plant Physiol

Biochem 37:223–229

Araoz R, Hader DP (1997) Ultraviolet radiation induces both

degradation and synthesis of phycobilisomes in Nostoc sp.: a

spectroscopic and biochemical approach. FEMS Microbiol Ecol

23:301–313

Araoz R, Shelton M, Lebert M et al (1998) Differential behaviour of

two cyanobacterium species to UV radiation. Artificial UV

radiation induces phycoerythrin synthesis. J Photochem Photo-

biol B 44:175–183

Barbato R, Bergo E, Szabo I et al (2000) Ultraviolet B exposure of

whole leaves of barley affects structure and functional organi-

zation of photosystem II. J Biol Chem 275:10976–10982

Booth MG, Jeffrey WH, Miller RV (2001) RecA expression in

response to solar UVR in the marine bacterium Vibrio natrie-gens. Microb Ecol 42:531–539

Brahamsha B (1996) A genetic manipulation system for oceanic

cyanobacteria of the genus Synechococcus. Appl Env Microbiol

62:1747–1751

Campbell D, Eriksson MJ, Oquist G et al (1998) The cyanobacterium

Synechococcus resists UV-B by exchanging photosystem II

reaction-center D1 proteins. Proc Natl Acad Sci USA 95:364–

369

Capuano V, Braux AS, Tandeau de Marsac N et al (1991) The

‘‘anchor polypeptide’’ of cyanobacterial phycobilisomes. Molec-

ular characterization of the Synechococcus sp. PCC 6301 apcEgene. J Biol Chem 266:7239–7247

Capuano V, Thomas JC, Tandeau de Marsac N et al (1993) An

in vivo approach to define the role of the LCM, the key

polypeptide of cyanobacterial phycobilisomes. J Biol Chem

268:8277–8283

Collier JL, Grossman AR (1994) A small polypeptide triggers

complete degradation of light-harvesting phycobiliproteins in

nutrient-deprived cyanobacteria. EMBO J 13:1039–1047

Dolganov N, Grossman AR (1999) A polypeptide with similarity to

phycocyanin alpha-subunit phycocyanobilin lyase involved in

degradation of phycobilisomes. J Bact 181:610–617

Ducret A, Sidler W, Wehrli E et al (1996) Isolation, characterization

and electron microscopy analysis of a hemidiscoidal phycobili-

some type from the cyanobacterium Anabaena sp. PCC 7120.

Eur J Biochem 236:1010–1024

Eilers PH, Peters JCH (1988) A model for the relationship between

light intensity and the rate of photosynthesis in phytoplankton.

Ecol Model 42:199–215

Fuglistaller P, Widmer H, Sidler W et al (1981) Isolation and

characterisation of phycoerythrocyanin and chromatic adaptation

of the thermophilic cyanobacterium Mastigocladus laminosus.

Arch Microbiol 129:268–274

Fuller NJ, Marie D, Partensky F et al (2003) Clade-specific 16S

ribosomal DNA oligonucleotides reveal the predominance of a

single marine Synechococcus clade throughout a stratified water

column in the Red Sea. Appl Env Microbiol 69:2430–2443

Genty B, Briantais J, Baker N (1989) The relationship between the

quantum yield of photosynthetic electron transport and quench-

ing of chlorophyll fluorescence. Biochim Biophys Acta 990:97–

92

Gindt YM, Zhou J, Bryant DA et al (1994) Spectroscopic studies of

phycobilisome subcore preparations lacking key core chromo-

phores: assignment of excited state energies to the LCM, beta-18

and alpha AP-B chromophores. Biochim Biophys Acta

1186:153–162

Glauser M, Bryant DA, Frank G et al (1992) Phycobilisome structure

in the cyanobacteria Mastigocladus laminosus and Anabaena sp.

PCC 7120. Eur J Biochem 205:907–915

Glazer AN (1989) Light guides—Directional energy transfer in a

photosynthetic antenna. J Biol Chem 264:1–4

Hader DP, Worrest RC, Kumar HD et al (1995) Effect of increase

solar ultraviolet radiation on aquatic systems. Ambio 24:174–

180

Photosynth Res

123

Hakala M, Tuominen I, Keranen M, Tyystjarvi T, Tyystjarvi E (2005)

Evidence for the role of the oxygen-evolving manganese

complex in photoinhibition of Photosystem II. Biochim Biophys

Acta 1706:68–80

He YY, Hader DP (2002) Involvement of reactive oxygen species in

the UV-B damage to the cyanobacterium Anabaena sp. J

Photochem Photobiol B Biol 66:73–80

He YY, Hader DP (2002) Reactive oxygen species and UV-B: effect

on cyanobacteria. Photochem Photobiol Sci 1:729–736

He YY, Hader DP (2002) UV-B-induced formation of reactive

oxygen species and oxidative damage of the cyanobacterium

Anabaena sp.: protective effects of ascorbic acid and N-acetyl-L-

cysteine. J Photochem Photobiol B Biol 66:115–124

He YY, Klisch M, Hader DP (2002) Adaptation of cyanobacteria to

UV-B stress correlated with oxidative stress and oxidative

damage. Photochem Photobiol 76:188–196

Herdman M, Castenholz RW, Waterbury JB et al (2001) Form-genus

XIII. Synechococcus. In: Boone DR, Castenholz RW (eds)

Bergey’s manual of systematic bacteriology, 2d edn, vol 1.

Springer-Verlag, New York, pp 508–512

Hihara Y, Kamei A, Kanehisa M et al (2001) DNA microarray

analysis of cyanobacterial gene expression during acclimation to

high light. Plant Cell 13:793–806

Holzinger A, Lutz C (2006) Algae and UV irradiation: effects on

ultrastructure and related metabolic functions. Micron 37:190–

207

Huang LX, McCluskey MP, Ni H et al (2002) Global gene expression

profiles of the cyanobacterium Synechocystis sp. strain PCC

6803 in response to irradiation with UV-B and white light. J Bact

184:6845–6858

Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:680–685

Lao K, Glazer AN (1996) Ultraviolet-B photodestruction of a light-

harvesting complex. Proc Natl Acad Sci USA 93:5258–5263

Llabres M, Agusti S (2006) Picophytoplankton cell death induced by

UV radiation: evidence for oceanic Atlantic communities.

Limnol Oceanogr 51:21–29

Marie D, Brussaard C, Partensky F et al (1999) Flow cytometric

analysis of phytoplankton, bacteria and viruses. In: Robinson JP

et al (eds) Current protocols in cytometry. International Society

for Analytical Cytology, John Wiley and Sons, New York, pp

11.11.11–11.11.15

Mary I, Vaulot D (2003) Two-component systems in Prochlorococ-cus MED4: Genomic analysis and differential expression under

stress. FEMS Microbiol Lett 226:135–144

Nishiyama Y, Allakhverdiev SI, Murata N (2006) A new paradigm

for the action of reactive oxygen species in the photoinhibition of

photosystem II. Biochim Biophys Acta 1757:742–749

Ohnishi N, Allakhverdiev SI, Takahashi S et al (2005) Two-step

mechanism of photodamage to photosystem II: step 1 occurs at

the oxygen-evolving complex and step 2 occurs at the photo-

chemical reaction center. Biochemistry 44:8494–8499

Ong LJ, Glazer AN (1987) R-phycocyanin II, a new phycocyanin

occurring in marine Synechococcus species. J Biol Chem

262:6323–6327

Ong LJ, Glazer AN (1991) Phycoerythrins of marine unicellular

cyanobacteria. I. Bilin types and locations and energy transfer

pathways in Synechococcus spp. phycoerythrins. J Biol Chem

266:9515–9527

Palenik B, Brahamsha B, Larimer FW et al (2003) The genome of a

motile marine Synechococcus. Nature 424:1037–1042

Pandey R, Chauhan S, Singhal GS (1997) UVB-induced photodam-

age to phycobilisomes of Synechococcus sp. PCC 7942. J

Photochem Photobiol B 40:228–232

Partensky F, Hess WR, Vaulot D (1999) Prochlorococcus, a marine

photosynthetic prokaryote of global significance. Microbiol Mol

Biol Rev 63:106–127

Poppe F, Schmidt R, Hanelt D et al (2003) Effects of UV radiation on

the ultrastructure of several red algae. Physiol Res 51:11–19

Rajagopal S, Murthy SDS (1996) Short term effect of ultraviolet-B

radiation on photosystem 2 photochemistry in the cyanobacte-

rium Synechococcus 6301. Biol Plant 38:129–132

Rajagopal S, Jha IB, Murthy SDS et al (1998) Ultraviolet-B effects on

Spirulina platensis cells: modification of chromophore-protein

interaction and energy transfer characteristics of phycobilisomes.

Biochem Biophys Res Commun 249:172–177

Rinalducci S, Hideg E, Vass I et al (2006) Effect of moderate UV-B

irradiation on Synechocystis PCC 6803 biliproteins. Biochem

Biophys Res Commun 341:1105–1112

Rippka R et al (2000) Prochlorococcus marinus Chisholm et al. 1992

subsp. pastoris subsp. nov. strain PCC 9511, the first axenic

chlorophyll a2/b2-containing cyanobacterium (Oxyphotobacte-

ria). Int J Syst Evol Microbiol 50:1833–1847

Sah JF, Krishna KB, Srivastava H et al (1998) Effects of ultraviolet-B

radiation on phycobilisomes of Synechococcus PCC 7942:

Alterations in conformation and energy transfer characteristics.

Biochem Mol Biol Int 44:245–257

Sicora C, Appleta SE, Brown CM et al (2006) Cyanobacterial psbAfamilies in Anabaena and Synechocystis encode trace, constit-

utive and UVB-induced D1 isoforms. Biochim Biophys Acta

1757:47–56

Sidler WA (1994) Phycobilisome and phycobiliprotein structure. In:

Bryant DA (ed) The molecular biology of cyanobacteria. Kluwer

Academic Publishers, Netherlands, pp 139–216

Sinha RP, Klisch M, Groniger A et al (2001) Responses of aquatic

algae and cyanobacteria to solar UV-B. Plant Ecol 154:219,

221–219, 236

Sinha RP, Lebert M, Kumar A et al (1995) Spectroscopic and

biochemical analyses of UV effects on phycobiliproteins of

Anabaena sp and Nostoc carmium. Botanica Acta 108:87–92

Six C, Thomas JC, Brahamsha B et al (2004) Photophysiology of the

marine cyanobacterium Synechococcus sp. WH8102, a new

model organism. Aquatic Microbial Ecol 35:17–29

Six C, Thomas J-C, Thion L et al (2005) Two novel phycoerythrin-

associated linker proteins in the marine cyanobacterium Syn-echococcus sp. strain WH8102. J Bact 187:1685–1694

Six C, Worden AZ, Rodriguez F et al (2005) New insights into the

nature and phylogeny of prasinophyte antenna proteins: Ostreo-coccus tauri, a case study. Mol Biol Evol 22:2217–2230

Smith RC et al (1992) Ozone depletion: ultraviolet radiation and

phytoplankton biology in antarctic waters. Science 255:952–959

Strid A, Chow WS, Anderson JM (1994) UV-B damage and

protection at the molecular level in plant. Photosynth Res

39:475–489

Vass I, Kirilovsky D, Etienne AL (1999) UV-B radiation-induced

donor- and acceptor-side modifications of photosystem II in the

cyanobacterium Synechocystis sp. PCC 6803. Biochem USA

38:12786–12794

Wendler J, John W, Scheer H et al (1986) Energy transfer in trimeric

C-phycocyanin studied by picosecond fluorescence kinetics.

Photochem Photobiol 44:79–85

Wilbanks SM, Glazer AN (1993) Rod structure of a phycoerythrin II-

containing phycobilisome. II. Complete sequence and bilin

attachment site of a phycoerythrin c subunit. J Biol Chem

268:1236–1241

Wilson MI, Greenberg BM (1993) Specificity and photomorphogenic

nature of ultraviolet-B-induced cotyledon curling in Brassicanapus L. Plant Physiol 102:671–677

Photosynth Res

123

Xiong FS (2001) Evidence that UV-B tolerance of the photosynthetic

apparatus in microalgae is related to the D1-turnover mediated

repair cycle in vivo. J Plant Physiol 158:285–294

Xue L, Zhang Y, Zhang T et al (2005) Effects of enhanced

ultraviolet-B radiation on algae and cyanobacteria. Crit Rev

Microbiol 31:79–89

Yu MH, Glazer AN (1982) Cyanobacterial phycobilisomes. Role of

the linker polypeptides in the assembly of phycocyanin. J Biol

Chem 257:3429–3433

Yu MH, Glazer AN, Williams RC (1981) Cyanobacterial phycobili-

somes. Phycocyanin assembly in the rod substructures of

Anabaena variabilis phycobilisomes. J Biol Chem 256:13130–

13136

Zsiros O, Allakhverdiev SI, Higashi S et al (2006) Very strong UV-A

light temporally separates the photoinhibition of photosystem II

into light-induced inactivation and repair. Biochim Biophys Acta

1757:123–129

Photosynth Res

123