Page 1
1
Title: CmPEX6, a gene involved in peroxisome biogenesis, is essential for 1
parasitism and conidiation by the sclerotial parasite Coniothyrium minitans 2
3
Wei Wei,a, b Wenjun Zhu,a, b Jiasen Cheng,b Jiatao Xie,b Bo Li,b Daohong Jiang,a, b 4
Guoqing Li,a, b Xianhong Yi,b Yanping Fub﹡ 5
State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, 6
Wuhan 430070, Hubei Province, P R Chinaa;The Provincial Key Lab of Plant 7
Pathology of Hubei Province, College of Plant Science and Technology, Huazhong 8
Agricultural University, Wuhan, 430070, Hubei Province, P R Chinab 9
10
Dr. Yanping Fu, Associate Professor 11
Plant Pathology 12
College of Plant Science and Technology 13
Huazhong Agricultural University 14
Wuhan, 430070, Hubei Province 15
P R China 16
Tel: 86-27-87280487; Fax: 86-27-87397735 17
E-mail: [email protected] 18
MS information: 19
Runing title: CmPEX6 is essential for parasitism and conidiation 20
Abstract: 230 words; Main text (excluding abstracts, key words, acknowledgement, 21
references and figure legends): 5186 words; Figures, 7; Supplemental figures, 3; Table, 22
1. 23
24
Copyright © 2013, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00375-13 AEM Accepts, published online ahead of print on 5 April 2013
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 2
2
ABSTRACT Coniothyrium minitans is a sclerotial parasite of the plant pathogenic 25
fungus Sclerotinia sclerotiorum, and conidial production and parasitism are two 26
important aspects for commercialization of this biological control agent. To 27
understand the mechanism of conidiation and parasitism at molecular level, we 28
constructed a T-DNA insertional library with the wild type strain ZS-1. A 29
conidiation-deficient mutant ZS-1TN22803 was uncovered through screening of this 30
library. This mutant could produce pycnidia on potato dextrose agar (PDA), but most 31
were immature and did not bear conidia. Moreover, this mutant lost ability to 32
parasitize or rot the sclerotia of S. sclerotiorum. Analysis of the T-DNA flanking 33
sequences revealed that a peroxisome biogenesis factor 6 (PEX6) homolog of 34
Saccharomyces cerevisiae, named CmPEX6, was disrupted by the T-DNA insertion in 35
this mutant. Targeted gene replacement and gene complementation tests confirmed 36
that a null mutation of the CmPEX6 was responsible for the phenotype of 37
ZS-1TN22803. Further analysis showed that both ZS-1TN22803 and the targeted 38
replacement mutants could not grow on PDA medium containing oleic acid, and 39
produced much less nitric oxide (NO) and hydrogen peroxide (H2O2) than the wild 40
type strain ZS-1. The conidiation of ZS-1TN22803 was partially restored by adding 41
acetyl-CoA or glyoxylic acid into growth media. Our results suggest that fatty acid 42
β-oxidation, reactive oxygen and nitrogen species, and possible other unknown 43
pathways in peroxisomes may be involved in conidiation and parasitism by C. 44
minitans. 45
46
Key words: Coniothyrium minitans, PEX6, peroxisome, fatty acid β-oxidation, 47
Sclerotinia sclerotiorum 48
49 Introduction Coniothyrium minitans, a mycoparasite of the plant fungal pathogen 50
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 3
3
Sclerotinia sclerotiorum, can parasitize and decay both hyphae and sclerotia of 51
Sclerotinia spp.. It also reduces the germination of sclerotia and inhibits further 52
infection by S. sclerotiorum hyphae, and thereby its existence in crop fields may play 53
a very important role in suppressing Sclerotinia diseases (3, 4, 21, 35, 43). The 54
antagonistic properties have made C. minitans a well-known biological control 55
microorganism, and several formulations based on C. minitans have been developed 56
and registered commercially (35, 46). 57
Coniothyrium minitans is a coelomycete fungus producing conidia in pycnidia. 58
Understanding the conidiation of C. minitans at the molecular level may help to 59
improve the efficiency of conidial production, which is important for the commercial 60
use of biological control agents. Asexual reproduction of fungi which do not have a 61
sexual stage in their life cycle is essential for survival and spread in nature; however, 62
many previous studies on conidiation have focused on hyphomycete fungi 63
(unenclosed conidia), such as Aspergillus nidulans, Neurospora crassa and 64
Magnaporthe oryzae, and little is known about conidiation in coelomycetes except for 65
the chestnut blight fungus Cryphonectria parasitica (1, and reviewed in 19). Studies 66
on the conidiation of C. minitans may improve our understanding of the general 67
nature of asexual reproduction by coelomycetes. 68
Conidiation by C. minitans can be divided into five stages: hyphal growth (48 69
hpi), primordial formation (60 hpi), pycnidial initiation (72 hpi), pycnidial formation 70
(84 hpi) and pycnidial maturation (96 hpi) (20, 30). Several genes and pathways 71
regulating C. minitans conidiation have recently been elucidated, including signaling 72
mediated by nitric oxide, cGMP, cAMP, MAP kinase cascade, and the PIF1 DNA 73
helicase gene, as well as many cell wall degrading enzymes (fCWDE) such as beta-1, 74
3-glucanase, chitinase and so on (10, 20, 27, 30, 33, 48). 75
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 4
4
The interaction between C. minitans and its host S. sclerotiorum also attracts 76
extensive research interests due to the potential use of hyperparasitism-associated 77
genes in the resistance improvement of crops against fungal diseases, especially 78
Sclerotinia diseases. Oxalic acid, a pathogenicity factor of S. sclerotiorum, is likely to 79
be a signal for this interaction. C. minitans produces antifungal substances with 80
increasing activity at low pH caused by oxalic acid and produces beta-1, 3-glucanase, 81
a fCWDE at higher pH after oxalic acid is degraded (11, 32, 47). Theoretically, the 82
interactions between C. minitans and S. sclerotiorum may be similar to that between 83
the plant pathogen and host plants, and many similar pathways are likely to be 84
involved in this hyperparasitism. 85
Peroxisomes are single-membrane-bound organelles widely existing in 86
eukaryotic cells and play a pivotal role in various metabolic pathways and 87
developmental processes of plants, fungi and mammals (18, 23, 26, 29). These 88
pathways are associated with a suite of cellular functions including detoxification of 89
H2O2, β-oxidation of fatty acids and utilization of amino acids (37, 38). Peroxisomes 90
are the site for the generation of superoxide (O2•-) and nitric oxide (•NO) radicals in 91
plants (7, 8), while in filamentous fungi, peroxisomes also have other specific 92
functions. In Podospora anserina, mutations in pex2 (a peroxisome-associated gene) 93
affected karyogamy and meiocyte formation, causing a specific block in sexual 94
development (28). In Penicillium chrysogenum, peroxisomes are known to participate 95
in the last step of penicillin biosynthesis (26). In Colletotrichum lagenarium and M. 96
oryzae, peroxisomal metabolic pathways contribute to appressorial melanization, 97
generation of appressorial turgor, and subsequent host invasion (2, 15, 41). In 98
Alternaria alternata, peroxisomes are involved in conidiation, plant invasion and 99
tissue colonization (14). Peroxisomes may also play a role in the development of trap 100
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 5
5
cells in the nematophagous fungus Arthrobotrys oligospora (39). Approximately 32 101
peroxisomal proteins for biogenesis and maintenance have been identified in yeast 102
(44), and disrupting some of these genes in plant pathogenic fungi such as A. 103
alternata, C. lagenarium and M. oryzae leads to loss of fungal pathogenicity (2, 14, 104
15). 105
Previously, we constructed a T-DNA insertional library of C. minitans using the 106
wild type strain ZS-1 (22), and through a growth phenotype screening of this mutant 107
library, we uncovered a conidiation-deficient mutant ZS-1TN22803. The mutant 108
formed normal hyphae, but produced immature pycnidia without conidia, and showed 109
a phenotype similar to that of previously characterized conidiation-deficient mutants 110
ZS-1T2029 and ZS-1T21882 (10, 30), however, unlike those two mutants, the 111
ZS-1TN22803 mutant was unable to parasitize S. sclerotiorum. Furthermore, we 112
identified a peroxisome biogenesis factor 6 (PEX6) homolog of Saccharomyces 113
cerevisiae responsible for the phenotype of ZS-1TN22803. Although it is well known 114
that the PEX proteins are involved in fungal conidiation and pathogenicity on plant or 115
animal hosts, this is the first report on peroxisomal involvement in mycoparasitism. 116
Here we demonstrated the roles of PEX6 in conidiation by C. minitans and its 117
parasitism of S. sclerotiorum, and speculated on the possible underlying mechanisms. 118
119
Materials and methods 120
C. minitans strains and cultural condition. The C. minitans wild type strain 121
ZS-1 (CCAM 041057) was isolated from garden soil at Zhushan County, Hubei 122
Province, P R China, and the conidiation-deficient mutant ZS-1TN22803 was 123
obtained from screening a T-DNA insertional library (5, 22). Strain Ep-1PNA367 was 124
a virulent and virus-free strain of S. sclerotiorum, derived from hypovirulent strain 125
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 6
6
Ep-1PN by a single-ascospore isolation technique (45). The strains were cultured on 126
potato dextrose agar (PDA) and broth (PDB) at 20-22oC, and stored in PDA slants at 127
4oC for further use (5, 10). 128
Assay of growth rate, colony morphology, conidiation and parasitic ability. 129
To characterize biological properties of ZS-1TN22803, growth rate, conidial 130
production, colony morphology, and parasitic ability were examined. Hyphal 131
extension and conidial production were examined as described by Cheng et al. (5) and 132
Zeng et al. (48). Colony morphology was observed on PDA after incubation at 133
20-22oC for 15 days. 134
To assay parasitic ability, surface-sterilized sclerotia of strain Ep-1PNA367 were 135
incubated in a conidial suspension of all C. minitans strains (106 conidia/ml) for 30 136
min, and then transferred to sterilized moist sand in Petri dishes with half of the 137
sclerotia exposed on the surface of the sand for 30 days. The plates were sealed to 138
retain moisture. Rot index was used to assess the parasitic activity by C. minitans 139
according to Cheng et al. (5). To further check if sclerotia were parasitized by mutants, 140
all conidia-treated sclerotia were surface sterilized with sodium hypochlorite solution 141
to kill superficially growing C. minitans, washed three times with sterilized water, and 142
then the sclerotia were placed onto PDA amended with 50 μg/ml hygromycin and 143
incubated at 20oC for 7 d. If the sclerotia were successfully parasitized by mutants, the 144
mutants would grow out of the sclerotia and develop colonies on 145
hygromycin-amended PDA since the mutants were transformed with the 146
hygromycin-resistance gene (hph). 147
To examine if a mutant could parasitize the hyphae of S. sclerotiorum, a method 148
of dual culture on PDA following Qin et al. (23) was used with minor modifications. 149
An agar plug of mutant ZS-1TN22803 was placed at the center of a PDA plate and 150
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 7
7
incubated for 5 d, and then four mycelial discs of S. sclerotiorum were inoculated at 151
the same plate symmetrically, discs were about 3.0 cm distance from the agar plug of 152
ZS-1TN22803, and then the plates were incubated for further 20 d. Mycelial discs 153
were taken from the interaction zones between two colonies and transferred onto fresh 154
PDA for further incubation to check if S. sclerotiorum emerged. Experiments were 155
repeated three times with three replicates, and with the wild type strain ZS-1 as 156
control. 157
Observation of the pycnidial formation. To examine the pycnidial 158
development and fine surface structure of pycnidia of the mutants, scanning electron 159
microscopy (SEM, Model JSM-6390/LV, NTC, Japan) was used. The mutants were 160
cultured on cellophane membranes placed on PDA and incubated for 7 d at 20-22oC. 161
Then the mycelia with the cellophane base were cut into 5 mm × 10 mm pieces with a 162
scalpel. Samples were fixed with 1% OsO4 for 1 h, placed on the sample holder 163
directly, and sputter-coated with platinum (Model JFC-1600, NTC, Japan). Then the 164
samples were observed by SEM at an acceleration voltage of 10 kV, and 165
photographed with a digital camera (Canon Power Shot SX30 IS). The wild type 166
strain ZS-1 was used as control. 167
DNA extraction and Southern blot analysis. The genomic DNA of the wild 168
type strain ZS-1, ZS-1TN22803 and other derivative mutants was extracted according 169
to a standard procedure (34). To estimate the T-DNA insertion copy number in 170
ZS-1TN22803, Southern blot analysis was performed following the method described 171
by Gong et al. (10) with some modifications. Genomic DNA of ZS-1TN22803 or 172
ZS-1 was completely digested with SacI, which has only one recognition site on the 173
binary vector pTFCM used to construct the T-DNA insertional library. The nylon 174
membrane was probed with the hygromycin-resistance gene (hph) that was amplified 175
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 8
8
with primer pair hph-L and hph-R (Table1) and labeled with [α-32P] dCTP. To estimate 176
the copy number of CmPEX6 in C. minitans, genomic DNA of ZS-1 was digested 177
completely with ApaI or BamHI separately, neither of which has recognition sites in 178
the DNA sequence of CmPEX6. The nylon membrane was hybridized with a 536 bp 179
DNA fragment of CmPEX6 amplified with primer pair 22803-L and 22803-R 180
(Table1). 181
For the analysis of CmPEX6 replacement and complemented mutants, genomic 182
DNA of ZS-1 or the mutants were digested with HindIII. The nylon membranes were 183
hybridized with probe P1 for CmPEX6 and P2 for hph. 184
Cloning and analysis of the gene disrupted by T-DNA insertion. 185
Amplification of the flanking DNA fragments of the T-DNA insertion site in 186
ZS-1TN22803 was performed using the inverse polymerase chain reaction (I-PCR) 187
technique. The genomic DNA of ZS-1TN22803 (500 ng-1 μg) was digested with 188
either ScaI or KpnI, precipitated with ethanol, and then re-suspended in 20 μl ddH2O, 189
and mixed with 20 U of T4 DNA ligase. The reaction was allowed to proceed at 16oC 190
for 10-16 h. After ethanol precipitation, the circularized DNA was re-suspended in 20 191
μl ddH2O and used as template for the nested PCR amplification with primer pair 192
Pttrp and LB-1 for the primary amplification. This PCR product was then used with 193
primer pair Pttrp and LB-3 for the secondary amplification. The primers were 194
designed based on the sequence of vector pTFCM (Table1). The PCR conditions used 195
were 32 cycles of 94oC for 30 s, 58oC for 30 s, and 72oC for 3 min, with a final 196
extension at 72oC for 5 min. The PCR product of primary amplification was diluted 197
20-fold with ddH2O, and 1μl of the diluted PCR product was used as template for the 198
secondary amplification. PCR reactions were carried out on a PTC-200 DNA Engine 199
Peltier Thermal cycler (BIO-RAD, USA). 200
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 9
9
RNA extraction and RT-PCR amplification. Total RNA of fungal strains was 201
isolated with TRIzol reagent (Invitrogen, USA) according to the manufacturer’s 202
protocols, and potential DNA contamination was removed by DNaseI treatment 203
(RNase Free) (TaKaRa, Dalian, China). First-strand cDNA was synthesized using the 204
RevertAidTM First Strand cDNA Synthesis Kit (MBI, Fermentas, USA) following 205
manufacturer’s instructions. The total RNA of mycelia at 48 h, 72 h, 84 h and 96 h 206
post incubation on PDA was used to assess the expression pattern of CmPEX6 by 207
RT-PCR, and samples at 96 h were detected to determine the gene expression in all 208
mutants. A 536 bp fragment of CmPEX6 was amplified by RT-PCR with 209
gene-specific primer pair 22803-L and 22803-R (Table 1). PCR conditions used were 210
28 cycles of 94oC for 30 s, 57oC for 30 s, and 72oC for 3 min, with a final extension at 211
72oC for 5 min. 212
Vector construction and Agrobacterium-mediated transformation. To assess 213
the function of CmPEX6, a CmPEX6 replacement vector pCMPEX-3300 and a 214
complementary vector pCPPE were constructed. The replacement vector was 215
constructed using the homologous recombination strategy. A 5’ fragment of 1.4 kb 216
was amplified with primer pair CmPEX6 HindIII and CmPEX6 SalI (Table 1) and 217
cloned into the same sites on pMD18-hph, resulting in the construct pMD2-hph. 218
Subsequently, a 0.95-kb 3’ fragment was amplified with primer pair CmPEX6 XbaI 219
and CmPEX6 KpnI (Table 1) and cloned between the same sites on pMD2-hph, 220
resulting in the construct pNeoP3300III. After that, the neomycin-resistance gene 221
cassette (neo) was ligated into XbaI recognition site of pNeoP330III as the second 222
negative selectable marker, resulting in the gene replacement vector pCMPEX-3300, 223
which makes sure the replacement transformants would be hygromycin-resistant and 224
neomycin-sensitive. To construct the complementary vector, CmPEX6 cDNA was 225
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 10
10
amplified by RT-PCR with primer pair com-HindIII and com-PstI (Table1) and 226
cloned into the same sites of pCIT vector, which contained the constitutive PtrpC 227
promoter and terminator. Finally, the cDNA of CmPEX6 was digested with XhoI and 228
cloned into pNeoP3300 vector, resulting in the CmPEX6 complementary vector 229
pCPPE. 230
The transformation of C. minitans was performed with strain EHA105 of 231
Agrobacterium tumefaciens as described by Li et al. (22) and Qin et al. (30) with 232
minor modifications. To complement the mutation of the CmPEX6 in ZS-1TN22803, 233
ZS-1TN22803 was transformed with vector pCPPE. Complemented transformants, 234
namely CmPEX6-com, were rescued on PDA containing 80 μg/ml of G418. To obtain 235
the CmPEX6 replacement transformants, candidate transformants DCmPEX6 were 236
uncovered on PDA supplemented with 50 μg/ml hygromycin B, and then subcultured 237
on PDA with 80 μg/ml of G418. All CmPEX6-com and DCmPEX6 transformants 238
were primarily confirmed by RT-PCR with primer pair (22803-L and 22803-R) 239
(Table1) and further by Southern blot analysis. 240
Assay on carbon utilization. To assay the effect of oleic acid as carbon source 241
on the growth of the mutants, strains ZS-1, ZS-1TN22803, CmPEX6-com and 242 DCmPEX6-98 were investigated for growth both on modified Czapek-Dox (MCD) 243
medium containing oleic acid (Sigma-Aldrich, USA) as the sole carbon source, and 244
on PDA containing 1% oleic acid and 0.5% Tween 80 at 20-22oC for 10 days, with 245
MCD and PDA media as controls according to Qin et al. (30). Mycelial growth rate 246
and conidial production were measured. Each experiment was repeated 3 times. 247
To test if acetyl-CoA and glyoxylic acid could restore conidiation of the mutants, 248
ZS-1 and DCmPEX6-98 were cultured on PDA amended with different concentrations 249
(0.25 mM-0.1 M) of acetyl-CoA (Sigma-Aldrich, USA) and glyoxylic acid 250
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 11
11
(Sinopharm Chemical Reagent Co., Ltd), respectively. PDA was used as control. The 251
colony morphology, growth rate and conidial production by each treatment were 252
examined using the method described above. Three replicates were conducted for 253
each treatment and each experiment was repeated twice. 254
H2O2 and NO generation in mycelia. To examine if there was any change for 255
generating hydrogen peroxide (H2O2) and nitric oxide (NO) in mutants during growth 256
on PDA, CmPEX6 mutants and ZS-1 were grown on PDA for 3-4 days. Mycelia (0.05 257
g) were scraped off, ground in liquid nitrogen, and soaked in 500 μl of lysis buffer 258
supplied by hydrogen peroxide assay kit or by nitrate/nitrite colorimetric assay kit 259
(Beyotime Institute of Biotechnology, China). Fifty microliters of the supernatant, 260
gathered by centrifuging at 12,000×g for 5 min, was used to determine the amount of 261
H2O2 and NO. The measurements were carried out following the kit protocols. There 262
were three replicates in each treatment, and the experiment was repeated three times. 263
Data analyses. SAS version 8.1 (SAS Institute, Inc., Cary, NC, USA) was used 264
to analyze the variation between treatments for each experiment using ANOVA. The 265
data of conidial production were log transformed prior to analysis. When a significant 266
treatment effect was found (P = 0.05), the mean values (whether numerical or log 267
transforms) for different treatments in the experiments were compared with the Least 268
Significant Difference Test. 269
270
RESULTS 271
Characterization of conidiation-deficient mutant ZS-1TN22803 in C. 272
minitans. The T-DNA insertion mutant ZS-1TN22803 grew well on PDA plates, and 273
its hyphal growth rate was not significantly different from that of the wild type strain 274
ZS-1 (Fig. 1A and 1B). ZS-1TN22803 formed a light color colony with the mycelial 275
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 12
12
strands that developed into pycnidial primordia. However, only a few immature 276
pycnidia from mycelial strands were produced, most pycnidia showed a light color 277
without melanization, and no conidia were produced within the immature pycnidia as 278
revealed under light microscopy. At 7 days post incubation, very few immature 279
pycnidia turned dark, and some conidia were produced. The wild type strain ZS-1 280
formed deep color colonies with production of mature pycnidia and conidiation, 281
beginning at 3 days post inoculation on PDA plates, and numerous mature dark 282
pycnidia produced at 7 days post incubation. In comparison to the wild type strain, 283
conidiation of ZS-1TN22803 on PDA plates was significantly delayed. Furthermore, 284
conidial production by ZS-1TN22803 (3.3×104 conidia/plate) was considerably less 285
than that by ZS-1 (2.6×107 conidia/plate) by about 1000 fold at 15 days post 286
incubation (Fig. 1C and Fig. 2). 287
ZS-1TN22803 unable to parasitize S. sclerotiorum. When 106 conidia/ml of 288
ZS-1TN22803 was inoculated on sclerotia and incubated at 20oC for 30 days, neither 289
pycnidia nor conidia of C. minitans were formed on the surface or the inner part of the 290
sclerotia (Fig. 3A and 3C), suggesting that ZS-1TN22803 could not parasitize 291
sclerotia of S. sclerotiorum. To further investigate whether the mutant could parasitize 292
the inner part of sclerotia, sclerotia were surface-sterilized and then seeded on PDA 293
amended with 50 μg/ml hygromycin for additional incubation. No colonies of 294
ZS-1TN22803 were formed around sclerotia (Fig. 3B). 295
We established a dual culture system to further investigate the interaction 296
between the mutant ZS-1TN22803 and S. sclerotiorum. When ZS-1TN22803 was 297
dual cultured with S. sclerotiorum for 20 days, the two colonies intermingled without 298
a significant inhibition zone. Mycelial discs excised from the region between S. 299
sclerotiorum and ZS-1TN22803 were placed on fresh PDA plates, and formed new 300
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 13
13
colonies always resembling S. sclerotiorum. Furthermore, the sclerotia formed around 301
the colony border of S. sclerotiorum were not parasitized by the mutant and no 302
pycnidia of C. minitans were observed. In contrast, when the wild type strain ZS-1 303
was dual cultured with S. sclerotiorum, ZS-1 continued to grow and spread over the 304
colony of S. sclerotiorum, and mycelia discs excised from the interaction zone 305
constantly formed colonies of C. minitans, but not S. sclerotiorum. Furthermore, 306
many mature dark pycnidia were produced on the surface of deteriorated sclerotia of S. 307
sclerotiorum (Fig. 4). These results demonstrate that the mutant ZS-1TN22803 lost 308
ability to parasitize hyphae or sclerotia of S. sclerotiorum, furthermore conidiation by 309
ZS-1TN22803 was not restored in dual cultures with its natural living host, S. 310
sclerotiorum. 311
Cloning and analysis of CmPEX6 in mutant ZS-1TN22803. Inverse PCR 312
was used to amplify the T-DNA flanking genomic DNA sequence in ZS-1TN22803, 313
and an 850 bp DNA fragment was obtained. The incomplete ORF was predicted to 314
encode a partial peptide of a peroxisomal biogenesis factor 6, a homolog to the PEX6 315
of Saccharomyces cerevisiae. Thus, we named it CmPEX6. As shown in the Southern 316
blot analysis, only one copy of T-DNA was inserted into the genome of mutant 317
ZS-1TN22803, and CmPEX6 was likely a single copy gene in C. minitans (Fig. S1A 318
and S1B). 319
The coding region of CmPEX6 was obtained by amplifying C. minitans genomic 320
DNA with specific primers. It was predicted that CmPEX6 in ZS-1 consisted of three 321
exons and two introns (60 bp and 69 bp, respectively) and encoded a polypeptide with 322
1399 amino acids (desposited in GenBank as accession JN391412). The gene 323
CmPEX6 in ZS-1TN22803 mutant was disrupted by T-DNA insertion at position 324
1582 nt after the translational start code (ATG) (Fig. S1C). The amino acid sequence 325
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 14
14
showed high homology to S. cerevisiae PEX6 (53% identity) and to genes in 326
filamentous fungi, including A. nidulans (92% identity) and C. lagenarium (93% 327
identity), with the conserved motifs AAA-protein family signature at the C-terminal 328
(Fig. S2A). Phylogenetic analysis revealed that this gene is clustered with other 329
identified fungal PEX6 (Fig. S2B). 330
RT-PCR analysis showed that CmPEX6 was expressed at a high level over the 331
time course of C. minitans growth from 48 h to 96 h growing on PDA plates (Fig. 332
S1D). 333
Replacement of CmPEX6 and complementation of ZS-1TN22803 mutant. 334
To test whether the disruption of CmPEX6 by T-DNA insertion is responsible for the 335
phenotypic changes in mutant ZS-1TN22803, a replacement vector pCMPEX-3300 336
was transformed into ZS-1. A total of 158 transformants without resistance to G418 337
among 400 hygromycin-resistant transformants were obtained, and two transformants, 338 DCmPEX6-39 and DCmPEX6-98, were selected for further analysis. 339
For complementation of the ZS-1TN22803 mutant, CmPEX6 with a PtrpC 340
promoter was integrated into ZS-1TN22803 (Fig. S3A). A total of 120 putative 341
complemented transformants were obtained and one transformant, CmPEX6-com, 342
was chosen for further characterization. RT-PCR analysis showed an expected 536 bp 343
fragment of CmPEX6 in ZS-1 and CmPEX6-com, but not in ZS-1TN22803, 344 DCmPEX6-39 or DCmPEX6-98 (Fig. S1D and Fig. S3B) when fungal RNA was 345
extracted from mycelia grown on PDA plates at 96 h post incubation. The integration 346
event of the CmPEX6 in the complemented transformant CmPEX6-com was further 347
confirmed by Southern blot analysis in which two hybridization bands appeared when 348
probed by the CmPEX6 fragment: one band represented the native CmPEX6 349
integrated with T-DNA insertion and the other was the newly inserted CmPEX6 with 350
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 15
15
a PtrpC promoter from the complementation vector (Fig. S3C and S3D). Furthermore, 351
Southern blot analysis demonstrated a targeted replacement of the CmPEX6 in 352
transformants DCmPEX6-39 and DCmPEX6-98 since there was one hybridization 353
band when hph was used as a probe, and no band when probed with a CmPEX6 354
fragment. These results confirm successful creations of both the replacement and the 355
complemented mutants for CmPEX6 in C. minitans. 356
Involvement of CmPEX6 in conidiation and parasitism by C. minitans. To 357
decipher the roles of CmPEX6 in conidiation and parasitism to S. sclerotiorum, the 358
phenotypic characteristics of the C. minitans strains were studied. There was no 359
significant difference in colony morphology (Fig. 1A), mycelial growth rate (Fig. 1B), 360
conidiation (Fig. 1C), or the ability to parasitize the sclerotia of S. sclerotiorum 361
among the three CmPEX6-deficient mutants, DCmPEX6-39, DCmPEX6-98, and 362
ZS-1TN22803 (Fig. 3). The conidial production of all three mutants was less than the 363
wild type strain ZS-1 by 1000 fold (Fig. 1C and Fig. 2), and none of the mutants could 364
parasitize the sclerotia of S. sclerotiorum (Fig. 3). Notably, the complemented mutant 365
CmPEX6-com recovered all the defective characteristics of the mutant ZS-1TN22803 366
to the similar extent of the wild type ZS-1 (Fig. 1, Fig. 2 and Fig. 3). Taken together, 367
these results demonstrated that CmPEX6 plays important roles in conidiation and 368
parasitism by C. minitans. 369
Growth deficiency of CmPEX6 mutants on media amended with oleic acid. 370
Peroxisomes are the site where lipids are broken down through fatty acid β-oxidation, 371
disruption of CmPEX6 is likely to cause dysfunction for fatty acid β-oxidation. To 372
determine if CmPEX6 disruption mutants could use oleic acid, mutants were 373
inoculated on MCD and PDA media amended with oleic acid, respectively. Results 374
showed that both ZS-1TN22803 and CmPEX6 replacement mutants could grow 375
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 16
16
neither on MCD medium in which oleic acid was used as the sole carbon source, nor 376
on oleic acid amended PDA in which glucose was also available as carbon source. In 377
contrast, the wild type ZS-1 and the complemented mutants grew well on the same 378
media (Fig. 5). 379
Conidiation of the CmPEX6 mutants partially restored by acetyl-CoA and 380
glyoxylic acid. It is well known that the β-oxidation of fatty acids producing 381
acetyl-CoA is one of the main metabolic pathways in peroxisomes, and the 382
acetyl-CoA fueled-glyoxylate pathway is a central component of peroxisomal 383
function in plants and fungi (49). To confirm this pathway is involved in conidiation 384
by C. minitans, mutant DCmPEX6-98 was transferred onto PDA amended with 385
acetyl-CoA or glyoxylic acid. At 15 days post incubation, conidiation by mutant 386
DCmPEX6-98 was partially restored when the exogenous acetyl-CoA or glyoxylic 387
acid was added into PDA medium at a final concentration of 50 mM (Fig. 6A). The 388
conidial production by DCmPEX6-98 was increased from 1.7×104 conidia cm-2 on 389
PDA to 4.6×105 or 5.3×105 conidia cm-2 on PDA amended with acetyl-CoA or 390
glyoxylic acid, respectively (Fig. 6B). These results suggest that the CmPEX6 mutants 391
are defective in utilization of fatty acids because of impaired β-oxidation. 392
Decreased production of H2O2 and NO in CmPEX6 mutants. Peroxisomes are 393
also the site for generating H2O2 and NO. To determine if the generation of H2O2 and 394
NO was influenced by the disruption of the CmPEX6, the amount of H2O2 and NO in 395
3-d and 4-d mycelia of mutants were monitored. Compared to ZS-1, the amount of 396
H2O2 and NO in CmPEX6-defective mutants ZS-1TN22803, DCmPEX6-39, and 397 DCmPEX6-98 at the two time points during incubation on PDA plates were 398
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 17
17
significantly decreased. The production of H2O2 and NO in the mycelia of 399
CmPEX6-com (3.2 uM and 22.7 uM) was slightly higher than that produced by ZS-1 400
(2.9 uM and 18.7 uM) (Fig. 7A and 7B), which correlates with possibly enhanced 401
expression of the CmPEX6 in this complemented mutant since expression of the 402
CmPEX6 was driven by a TrpC promoter. The results indicated that altered activities 403
of CmPEX6 in C. minitans mutants affected the generation of H2O2 and NO during the 404
fungal growth. 405
406
Discussion 407
In this research, we cloned CmPEX6 encoding a peroxisomal biogenesis factor 6 408
from C. minitans, and demonstrated its essential role in conidiation and parasitism by 409
C. minitans. Both T-DNA insertion disruption and targeted replacement mutants of 410
CmPEX6 were defective in conidiation and lost ability to parasitize S. sclerotiorum. 411
The CmPEX6 null mutants could produce pycnidial primordia on PDA plates, but 412
most pycnidia were immature and defective in conidiation. Furthermore, the CmPEX6 413
disrupted mutants could not grow on media amended with oleic acid. The conidiation 414
by the CmPEX6 disrupted mutants could be partially restored by adding acetyl-CoA 415
or glyoxylic acid into the media, suggesting that β-oxidation of fatty acids in the 416
mutants was impaired, and that this function plays a crucial role in conidiation and 417
parasitism. 418
Loss of pathogenicity caused by disruption of the PEX6 in plant pathogenic fungi 419
was reported in C. lagenarium, M. oryzae, and A. alternata (2, 14, 31). In C. 420
lagenarium, clapex6 mutants produced small appressoria with severely reduced 421
melanization that failed to form infectious hyphae. In M. oryzae, the Mgpex6-deletion 422
mutant lacked appressorial melanin and was defective in host penetration and 423
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 18
18
therefore completely non-pathogenic. In A. alternata, the ΔAaPEX6 strains 424
completely lost host-selective AK-toxin production and pathogenicity on susceptible 425
Japanese pear leaves. Although the CmPEX6 disrupted mutants of C. minitans 426
showed phenotypes associated with the impairment of melanization, the loss of 427
parasitism by the CmPEX6 disrupted mutants ZS-1TN22803 and DCmPEX6 may not 428
be due to the lack of melanization in the mutants since other mutants with disruption 429
of melanin-biosynthesis-associated polyketide synthase gene in C. minitans still 430
maintain their pathogenicity to parasitize sclerotia of S. sclerotiorum (data not shown). 431
In addition, we observed that the CmPEX6 disrupted mutants can live well on dead 432
sclerotia and produce abundant conidia there (data not shown), suggesting that the 433
CmPEX6 mutants are able to produce parasitism-associated fCWDEs that degrade 434
sclerotia tissues for nutrient supply. Loss of pathogenicity for the CmPEX6 disrupted 435
mutants on the host S. sclerotiorum suggests that the mutants are not able to overcome 436
live host defenses during parasitism. Alternatively, C. minitans may require other 437
virulence/pathogenicity factors to parasitize S. sclerotiorum. Notably, the generation 438
of H2O2 and NO was significantly reduced in the CmPEX6 mutants. It is possible that 439
these two reactive agents may serve as virulence factors for C. minitans to parasitize 440
its host. Further work is necessary to test this hypothesis. 441
Mutations in PEX genes can result in the absence of peroxisomes, abnormal 442
peroxisomal structures, mistargeting of matrix proteins, and/or inability to respond to 443
stimuli that cause increased numbers of peroxisomes (13). Peroxisomes are associated 444
with β-oxidation of fatty acids (37, 38). It was believed that the disruption of PEX6 in 445
C. lagenarium destroyed β-oxidation pathway of fatty acids so that Δpex6 mutants 446
could not utilize oleic acid as the sole carbon source (15). In this study, we showed 447
that CmPEX6 disrupted mutants ZS-1TN22803, DCmPEX6-39, and DCmPEX6-98 448
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 19
19
could not grow on media amended with oleic acid whether or not the oleic acid was 449
used as the sole carbon source, and the conidiation-deficiency of the CmPEX6 450
disrupted mutants was partially restored by adding acetyl-CoA or glyoxylic acid into 451
culture media. The results suggest that the β-oxidation of fatty acids associated with 452
peroxisomes, along with possible other factors, plays an important role in conidiation. 453
However, when growing on dead sclerotia or on carrot juice agar medium, the 454
CmPEX6 disrupted mutants could produce much more conidia than on PDA amended 455
with acetyl-CoA or glyoxylic acid (data not shown), suggesting the dysfunction of 456
peroxisomes in the CmPEX6 disrupted mutants can be compensated by some 457
unknown factors. 458
The NADPH oxidase-dependent superoxide generation by plants in response to 459
microbial pathogen colonization is a well known defense mechanism in plants (16). 460
NADPH oxidases also play essential roles in development of filamentous fungi (12, 461
17, 25). In N. crassa, ROS generated at the beginning of each morphogenetic step that 462
occurs during asexual development (12). NoxA-generated ROS played an essential 463
role in A. nidulans sexual differentiation, but had no effect on asexual hyphal growth 464
(17). Nox1 is required for sexual development, whereas Nox2 is involved in 465
ascospore germination in P. anserina (25). Recently, several reports demonstrated 466
essential roles of NO in conidiation of fungal species including Blastocladiella 467
emersonii (40), N. crassa (6) and C. minitans (10, 20). It is likely that NO signaling 468
mediates fungal conidiation via a cGMP-dependent pathway and another 469
yet-unknown pathway (10, 20). Our results showed correlations between reduced 470
generation of NO and H2O2 and conidiation deficiency in the CmPEX6 disrupted 471
mutants, suggesting that cellular homeostasis of ROS and NO regulates conidiation in 472
C. minitans. 473
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 20
20
PEX6 is essential for β-oxidation of fatty acids in fungi. As expected, the 474
CmPEX6 disrupted mutants DCmPEX6 were unable to grow in MCD medium 475
amended with oleic acid as sole carbon source. However, we also found that the 476
CmPEX6 mutants could not grow in oleic acid amended PDA medium in which 477
glucose is already available. Similarly, growth deficiency of yeast ΔPex6 mutants was 478
observed in media amended with oleic acid media containing other available carbon 479
sources (24). The growth deficiency of both CmPEX6 mutants and yeast ΔPex6 480
mutants in the presence of oleic acid could not be attributed to the shortage of carbon 481
sources in the media, but likely due to the possible production of some inhibitory 482
metabolites during β-oxidation of oleic acid, or the direct cellular damage triggered by 483
oleic acid metabolism in the CmPEX6 disrupted mutants. 484
Many studies have recently shown that NO is a widespread signaling molecule 485
involved in regulation of many important physiological processes in fungi as well as 486
in animals and plants (9). However, little is known about the origin of NO production 487
at the cellular and subcellular levels in fungi (36). In plants, peroxisomes are 488
organelles contributing to generation of superoxide (O2•-) and nitric oxide radicals (7, 489
8). In this study, we found that the disruption of a peroxisomal CmPEX6 in C. 490
minitans resulted in a significant decrease of NO generation in the CmPEX6 disrupted 491
mutants, and complementation of the CmPEX6 mutation could completely restore the 492
NO generation of. Our results established a potential involvement of peroxisomes in 493
generation of NO in filamentous fungi. 494
In summary, we have identified a PEX6 homolog from C. minitans, and have 495
found that the CmPEX6 possesses critical functions in conidiation and parasitism by C. 496
minitans. Our data suggest that the metabolism via β-oxidation of fatty acids and the 497
production of NO and H2O2 may be involved in fungal conidiation and parasitism. 498
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 21
21
Acknowledgements 499
The research was financially supported by the National Natural Science 500
Foundation of China (grant 309718833), the Special Fund for Agro-scientific 501
Research in the Public Interest (grant 201103016) and the earmarked fund for China 502
Agriculture Research System (nycytx-00514). We thank the anonymous reviewers for 503
their constructive and helpful comments. We are grateful to Prof. Tom Hsiang, School 504
of Environmental Sciences, University of Guelph, and Prof. Yangdou Wei, College of 505
Art & Science, University of Saskatchewan, for editorial advice. 506
507
References 508
1. Adams TH, Wieser JK, Yu JH. 1998. Asexual sporulation in Aspergillus nidulans. 509
Microbiol. Mol. Biol. Rev. 62:35-54. 510
2. Asakura M, Okuno T, Takano Y. 2006. Multiple contributions of peroxisomal 511
metabolic function to fungal pathogenicity in Colletotrichum lagenarium. Appl. 512
Environ. Microb. 72: 6345-6354. 513
3. Bennett AJ, Leifer C, Whipps JM. 2006. Survival of Coniothyrium minitans 514
associated with sclerotia of Sclerotinia sclerotiorum in soil. Soil Biology and 515
Biochemistry 38(1):164-172. 516
4. Boland GJ, Hall R. 1994. Index of plant hosts of Sclerotinia sclerotiorum. Can J. 517
Plant Pathol. 16:93-108. 518
5. Cheng JS, Jiang DH, Fu YP, Li GQ, Whipps JM. 2003. Production, survival and 519
efficacy of Coniothyrium minitans conidia produced in shaken liquid culture. 520
FEMS Microbiol. Lett. 227:127-131. 521
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 22
22
6. Cano-Domínguez N, Álvarez-Delfín K, Hansberg W, Aguirre J. 2008. NADPH 522
oxidases NOX-1 and NOX-2 require the regulatory subunit NOR-1 to control 523
cell differentiation and growth in Neurospora crassa. Eukaryotic Cell 524
7:1352-1361. 525
7. Corpas FJ, Barroso JB, Carreras A, Quiros M, Leon AM, Romero-Puertas 526
MC, Esteban FJ, Valderrama R, Palma JM, Sandalio LM, Gomez M, del 527
Rio LA. 2004. Cellular and subcellular localization of endogenous nitric oxide in 528
young and senescent pea plants. Plant Physiol. 136:2722-2733. 529
8. Corpas FJ, Barroso JB, del Río LA. 2001. Peroxisomes as a source of reactive 530
oxygen species and nitric oxide signal molecules in plant cells. TRENDS in Plant 531
Science 1:145-150. 532
9. Durner J, Andrew JG, Jonathan SS, Glazebrook J. 1999. Ancient origins of 533
nitric oxide signaling in biological systems. Proc. Natl. Acad. Sci. U. S. A. 534
96:14206-14207. 535
10. Gong XY, Fu YP, Jiang DH, Li GQ, Yi XH, Peng YL. 2007. L-arginine is 536
essential for conidiation in the filamentous fungus Coniothyrium minitans. 537
Fungal Genet. Biol. 44:1368-1379. 538
11. Han YC, Li GQ, Yang L, Jiang DH. 2011. Molecular cloning, characterization 539
and expression analysis of a pacC homolog in the mycoparasite Conithyrium 540
minitans. World J. Microb. Biot. 27:381-391. 541
12. Hansberg W, de Groot H, Sies H. 1993. Reactive oxygen species associated 542
with cell differentiation in Neurospora crassa. Free Radic Biol. Med. 14: 543
287-293. 544
13. Hynes MJ, Murray SL, Khew GS, Davis MA. 2008. Genetic analysis of the role 545
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 23
23
of peroxisomes in the utilization of acetate and fatty acids in Aspergillus 546
nidulans. Genetics 178: 1355-1369. 547
14. Imazaki A, Tanaka A, Harimoto Y, Yamamoto M, Akimitsu K, Park P, 548
Tsuge T. 2010. Contribution of peroxisomes to secondary metabolism and 549
pathogenicity in the fungal plant pathogen Alternaria alternata. Eukaryotic Cell 550
9: 682-694. 551
15. Kimura A, Takano Y, Furusawa I, Okuno T. 2001. Peroxisomal metabolic 552
function is required for appressorium-mediated plant infection by Colletotrichum 553
lagenarium. Plant Cell 13:1945-1957. 554
16. Lamb C, Dixon RA. 1997. The oxidative burst in plant disease resistance. Annual 555
Review of Plant Physiology and Plant Molecular Biology 48: 251-275. 556
17. Lara-Ortı´z T, Riveros-Rosas H, Aguirre J. 2003. Reactive oxygen species 557
generated by microbial NADPH oxidase NoxA regulate sexual development in 558
Aspergillus nidulans. Mol. Microbiol. 50: 1241-1255. 559
18. Lazarow PB, Fujiki Y. 1985. Biogenesis of peroxisomes. Annu. Rev. Cell Biol. 560
1:489-530. 561
19. Lengeler KB, Davidson RC, D’souza C, Ashima T, Shen WC, Wang P, Pan X, 562
Waugh M, Heitman J. 2000. Signal transduction cascades regulating fungal 563
development and virulence. Microbiology and Molecular Biology Reviews 564
64:746-785. 565
20. Li B, Fu YP, Jiang DH, Xie JT, Cheng JS, Li GQ, Hamid MI, Yi XH. 2010. 566
Cyclic GMP as a second messenger in the nitric oxide-mediated conidiation of 567
the mycoparasite Coniothyrium minitans. Appl. Environ. Microb. 76:2830-2836. 568
21. Li GQ, Huang HC, Miao HJ, Erickson RS, Jiang DH, Xiao YN. 2006. 569
Biological control of Sclerotinia diseases of rapeseed by aerial applications of 570
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 24
24
the mycoparasite Coniothyrium minitans. Can. J. Plant Pathol. 114:345-355. 571
22. Li M, Gong XY, Zheng J, Jiang DH, Fu YP, Hou MS. 2005. Transformation of 572
Coniothyrium minitans, a parasite of Sclerotinia sclerotiorum, with 573
Agrobacterium tumefaciens. FEMS Microbiol. Lett. 243:323-329. 574
23. Lin Y, Sun L, Nguyen LV, Rachubinski RA, Goodman HM. 1999. The Pex16p 575
homolog SSE1 and storage organelle formation in Arabidopsis seeds. Science 576
284:328-330. 577
24. Lockshon D, Surface LF, Kerr EO, Kaeberlein M, Kennedy BK. 2007. The 578
sensitivity of yeast mutants to oleic acid implicates the peroxisome and other 579
processes in membrane function. Genetics 175:77-91. 580
25. Malagnac F, Lalucque H, Lepe` re G, Silar P. 2004. Two NADPH oxidase 581
isoforms are required for sexual reproduction and ascospore germination in the 582
filamentous fungus Podospora anserina. Fungal Genet. Biol. 41:982-997. 583
26. Muller WH, van der Krift TP, Krouwer AJ, Wosten HA, van der Voort LH, 584
Smaal EB, Verkleij AJ. 1991. Localization of the pathway of the penicillin 585
biosynthesis in Penicillium chrysogenum. EMBO J. 10:489-495. 586
27. Muthumeenakshi S, Sreenivasaprasad S, Rogers CW, Challen MP, Whipps 587
JM. 2007. Analysis of cDNA transcripts from Coniothyrium minitans reveals a 588
diverse array of genes involved in key processes during sclerotial 589
mycoparasitism. Fungal Genet. Biol. 44:1262-1284. 590
28. Peraza-Reyes L, Zickler D, Berteaux-Lecellier V. 2008. The peroxisome 591
RING-Finger complex is required for meiocyte formation in the fungus 592
Podospora anserine. Traffic 9:1998-2009. 593
29. Petriv OI, Tang L, Titorenko VI, Rachubinski RA. 2004. A new definition for 594
the consensus sequence of the peroxisome targeting signal type 2. J. Mol. Biol. 595
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 25
25
341:119-134. 596
30. Qin L, Gong XY, Xie JT, Jiang DH, Cheng JS, Li GQ, Huang JB, Fu YP. 597
2011. Phosphoribosylamidotransferase, the first enzyme for purine de novo 598
synthesis, is required for conidiation in the sclerotial mycoparasite Coniothyrium 599
minitans. Fungal Genet. Biol. 48:956-965. 600
31. Ramos-Pamplona M, Naqvi NI. 2006. Host invasion during rice-blast disease 601
requires carnitine-dependent transport of peroxisomal acetyl-CoA. Mol 602
Microbiol 61:61-75. 603
32. Ren L, Li GQ, Han YC, Jiang DH, Huang HC. 2007. Degradation of oxalic 604
acid by Coniothyrium minitans and its effects on production and activity of 605
β-1,3-glucanase of this mycoparasite. Biological Control 43:1-11. 606
33. Rogers CW, Challen MP, Muthumeenakshi S, Sreenivasaprasad S, Whipps 607
JM. 2008. Disruption of the Coniothyrium minitans PIF1 DNA helicase gene 608
impairs growth and capacity for sclerotial mycoparasitism. Microbiology-SGM 609
154:1628-1636. 610
34. Sambrook J, Russell DW. 2001. Molecular Cloning: A Laboratory Manual. Cold 611
Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 612
35. Smith SN, Prince M, Whipps JM. 2008. Characterization of Sclerotinia and 613
mycoparasites Coniothyrium minitans interaction by microscale co-culture. 614
Letters in Applied Microbiology 47: 128-133. 615
36. Song NK, Jeong CS, Choi HS. 2000. Identification of nitric oxide synthase in 616
Flammulina velutipes. Mycologia 92:1027-1032. 617
37. Titorenko VI, Rachubinski RA. 2001. The life cycle of the peroxisome. Nat. 618
Rev. Mol. Cell Biol. 2:357-368. 619
38. van den Bosch H, Schutgens RBH, Wanders RJA, Tager JM. 1992. 620
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 26
26
Biochemistry of peroxisomes. Annu. Rev. Biochem. 61:157-197. 621
39. Veenhuis M, Nordbring-Hertz B, Harde W. 1984. Occurrence, characterization 622
and development of two different types of microbodies in the nematophagous 623
fungus Arthrobotrys oligospora. FEMS Microbiol. Lett. 24:31-38. 624
40. Vieira AL, Linares E, Augusto O, Gomes SL. 2009. Evidence of a Ca 2 625
+-.NO-cGMP signaling pathway controlling zoospore biogenesis in the aquatic 626
fungus Blastocladiella emersonii. Fungal Genet. Biol. 46: 575-584. 627
41. Wang ZY, Soanes DM, Kershaw MJ, Talbot NJ. 2007. Functional analysis of 628
lipid metabolism in Magnaporthe grisea reveals a requirement for peroxisomal 629
fatty acid β-oxidation during appressorium-mediated plant infection. Mol. 630
Plant-Microbe Interact. 20:475-491. 631
42. Wang JY, Wu XY, Zhang Z, Du XF, Chai RY, Liu XH, Mao XQ, Qiu HP, 632
Wang YL, Lin FC, Sun GC. 2008. Fluorescent co-localization of PTS1 and 633
PTS2 and its application in analysis of the gene function and the peroxisomal 634
dynamic in Magnaporthe oryzae. J. Zhejiang Univ. Sci. B 9(10):802-810. 635
43. Whipps JM, Gerlagh M. 1992. Biology of Coniothyrium minitans and its 636
potential for use in disease biocontrol. Mycological Research 96:897-907. 637
44. Wolf J, Schliebs W, Erdmann R. 2010. Peroxisomes as dynamic organelles: 638
peroxisomal matrix protein import. FEBS J. 277:3268-3278. 639
45 Xie J, Wei DM, Jiang DH, Fu YP, Li GQ, Ghabrial SA, Peng YL. 2006. 640
Characterization of debilitation-associated mycovirus infecting the 641
plant-pathogenic fungus Sclerotinia sclerotiorum. J. Gen. Virol. 87:241-249. 642
46. Yang L, Li GQ, Long YQ, Hong GP, Jiang DH, Huang HC. 2010. Effects of 643
soil temperature and moisture on survival of Coniothyrium minitans conidia in 644
central China. Biological Control 55:27-33. 645
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 27
27
47. Yang R, Han YC, Li GQ, Jiang DH, Huang HC. 2008. Effects of ambient pH 646
and nutritional factors on antifungal activity of the mycoparasite Coniothyrium 647
minitans. Biological Control 44:116-127. 648
48. Zeng FY, Gong XY, Hamid MI, Fu YP, Xie JT, Cheng JS, Li GQ, Jiang DH. 649
2012. A fungal cell wall integrity-associated MAP kinase cascade in 650
Coniothyrium minitans is required for conidiation and mycoparasitism. Fungal 651
Genet. Biol. 49:347-357. 652
49. Zimmerman R, Neupert W. 1980. Biogenesis of glyoxysomes. Synthesis and 653
intracellular transfer of isocitrate lyase. Eur. J. Biochem. 112:225-233. 654
655
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 28
28
Figure legends and Tables 656
Figure 1. Comparison of colony morphology and conidiation by C. minitans among 657
isolates ZS-1, ZS-1TN22803, DCmPEX6-39, DCmPEX6-98, and CmPEX6-com on 658
PDA at 20oC for 15 days. (A) Colony morphology of C. minitans grown on PDA at 659
20oC for 15 days. (B) Mycelial growth rate based on colony diameter of cultures 660
incubated at 20oC for 7 days. (C) Conidial production on PDA at 20oC for 15 days 661
counted with a haematocytometer. The vertical bars represent standard errors based 662
on five replicates. Within columns, means followed by the same lowercase letter 663
within each chart are not significantly different (P > 0.05) according to the Least 664
Significant Difference Test. 665
666
Figure 2. Microscopic observation of colony morphology and pycnidia formed by 667
nonmutants first and then mutants ZS-1TN22803, DCmPEX6-39, DCmPEX6-98, 668
CmPEX6-com and ZS-1 with SEM. All strains were cultured at 20oC on PDA for 7 669
days. Column I shows the colony morphology. Column II shows pycnidia near the 670
margin of colony. Column III shows the conidia formed in the pynidia. There were no 671
pynidia and conidia formed in colonies of ZS-1TN22803, DCmPEX6-39 or 672
DCmPEX6-98. 673
674
Figure 3. Parasitic ability by C. minitans mutants to sclerotia of S. sclerotiorum. (A) 675
Sclerotia were parasitized by ZS-1 or CmPEX6-com, dark pycnidia were observed on 676
the surface of sclerotia, and the inner parts of sclerotia were soft/rotted; sclerotia were 677
not parasitized by mutants ZS-1TN22803 and DCmPEX6-98, no pycnidia were 678
observed on the surface of the sclerotia, just like the uninoculated sclerotia (CK). (B) 679
Inoculated sclerotia were grown on PDA amended with hygromycin (50 μg/ml) for 7 680
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 29
29
days after surface-sterilization. New colonies of C. minitans were observed only from 681
sclerotia treated with CmPEX6-com, and mycelia of S. sclerotiorum could be 682
observed from sclerotia treated with ZS-1TN22803 or DCmPEX6-98. (C) The 683
sclerotial rot index induced by C. minitans mutants. Sclerotia with a similar size were 684
surface-sterilized and inoculated with the conidia of ZS-1TN22803, DcmPEX6-98, 685
CmPEX6-com or ZS-1, respectively, and incubated in wet sand at 20oC for 30 days. 686
687
Figure 4. Dual cultures of ZS-1TN22803 or ZS-1 of C. minitans with host S. 688
sclerotiorum Ep-1PNA367. The mycelial disc of mutant ZS-1TN22803 or ZS-1 was 689
placed at the center of a PDA plate, grown for 5 d, and then four mycelial discs of S. 690
sclerotiorum were placed on the same plate equally spaced at ~3.0 cm from the center, 691
and then the plates were incubated at 20oC for a further 20 d. ZS-1TN22803 did not 692
produce dark pycnidia in the colony of S. sclerotiorum, nor parasitize the sclerotia 693
(the white fuzzy material) at the interface of the two colonies. 694
695
Figure 5. CmPEX6 mutants of C. minitans could not grow on media amended with 696
oleic acid. ZS-1, ZS-1TN22803, DCmPEX6-98 or CmPEX6-com was placed on 697
MCD and PDA media amended with 1% oleic acid at 20oC for 10 days. MCD 698
medium was amended with oleic acid instead of dextrose as the sole carbon source, 699
while PDA medium was amended with oleic acid. 700
701
Figure 6. Partial restoration of conidiation by acetyl-CoA and glyoxylic acid. (A) 702
Colony morphologies of ZS-1 and DCmPEX6-98 grown on PDA with or without 703
exogenous 0.05 M acetyl-CoA or 0.05 M glyoxylic acid at 20oC for 15 days. (B) 704
Conidial production of DCmPEX6-98 was restored partially. The vertical bars 705
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 30
30
represent the standard errors based on five replicates. Columns noted by the same 706
lowercase letter within each chart are not significantly different (P>0.05) according to 707
the Least Significant Difference test. 708
709
Figure 7. Generation of H2O2 (A) and NO (B) in mycelia of CmPEX6 mutants. 710
ZS-1TN22803, DCmPEX6-98, CmPEX6-com or ZS-1 was incubated on PDA at 711
20oC for 3 days. Hydrogen peroxide assay kit and Nitrate/nitrite colorimetric assay kit 712
(Beyotime, China) were used to measure the amount of H2O2 and NO per gram fresh 713
mycelia following the kit protocol, respectively. The vertical bars represent the 714
standard errors based on five replicates. Columns noted by the same lowercase letter 715
within each chart are not significantly different (P>0.05) according to the Least 716
Significant Difference test. 717
Table 1. Primers used for vector construction and PCR 718
Primers of CmPEX6 used for RT-PCR
22803-L: 5’CAAAGCAGTCGCCTGGTTC 3’
22803-R: 5’ ATTTGGCACCGCAGGTAAGC 3’
Primers used for I-PCR
Pttrp: 5’ATGTCCTCGTTCCTGTCTGCTAATA 3’
LB-1: 5’ AGGGTTCCTATAGGGTTTCGCTCATG 3’
LB-3: 5’ GAATTAATTCGGCGTTAATTCAGT 3’
Primers used for CmPEX6 replacement vector
CmPEX6 HindIII : 5’CGAAGCTTAGAACACCCCGTGGACCATCCTG 3’
CmPEX6 SalI: 5’CGGTCGACAGATGGAGGCGAGGAGAAGC3’
CmPEX6 XbaI: 5’GCTCTAGATATCCGCGGTTTGTTCACACACG3’
CmPEX6 KpnI: 5’GGGGTACCCGAACGAGTATGTGAAATAGAGG3’
Primers used for CmPEX6 complementation vector
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 31
31
719
com-HindIII : 5’GCAAGCTTATGGAAGTGCAGAACGGCACT3’
com-PstI : 5’ CTGCAGTCAAGAGTACAGCTCCTCGTCCC3’
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 32
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 33
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 34
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 35
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 36
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 37
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Page 38
on April 7, 2018 by guest
http://aem.asm
.org/D
ownloaded from