RPF-II (2012-2013) PROFORMA FOR SUBMISSION OF ANNUAL PROGRESS REPORT OF RESEARCH PROJECTS PART -I : GENERAL INFORMATION 600 Project Code C17.11 6001 Institute Project Code No. : CI 7.11 6002 ICAR Project Code No. 601 Name of Institute and Division: 6011 Name & Address of Institute : INDIAN GRASSLAND & FODDER RESEARCH INSTITUTE, JHANSI- 284003 6012 Name of Division ISection Crop Improvement Division 6013 Location of Project IGFRI, Jhansi 602 Project Title : " Biochemical and Molecular Approach for Characterization of Drought Tolerant Forage Sorghum" 603 Priority Area : Research and Development 6031 Research Approach: Applied Res. Basic Res. Process/ or Technology Transfer of >l 02 Development 03 Technology 04 604 Specific Area : Plant Biochemistry & Plant Molecular Biology 605 Duration of project : 5 years 6051 Date of start of project : July 2010 6052Likely date of completion of project: 2015 6053 Period for which report submitted : 2012 - 2013 606 Total cost of the project : 6061 Expenditure to date 607 Summary Achievements: Sorghum (Sorghum bicolor L.) is an important crop in many parts of the world. It is utilized as food, fodder and several industrial purposes. In general, sorghum is known 2
12
Embed
RPF-II (2012-2013) PROFORMA FOR SUBMISSION OF ANNUAL … · 2014. 1. 3. · RPF-II (2012-2013) PROFORMA FOR SUBMISSION OF ANNUAL PROGRESS REPORT OF RESEARCH PROJECTS PART -I :GENERAL
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
RPF-II (2012-2013)
PROFORMA FOR SUBMISSION OF ANNUALPROGRESS REPORT OF RESEARCH PROJECTS
PART -I : GENERAL INFORMATION
600 Project Code C17.11
6001 Institute Project Code No. : CI 7.11
6002 ICAR Project Code No.
601 Name of Institute and Division:
6011 Name & Address of Institute : INDIAN GRASSLAND & FODDERRESEARCH INSTITUTE, JHANSI- 284003
6012 Name of Division ISection Crop Improvement Division
6013 Location of Project IGFRI, Jhansi
602 Project Title : " Biochemical and Molecular Approach forCharacterization of Drought Tolerant ForageSorghum"
603 Priority Area : Research and Development6031 Research Approach: Applied Res. Basic Res. Process/ or TechnologyTransfer of
>l 02Development
03Technology
04
604 Specific Area : Plant Biochemistry & Plant Molecular Biology605 Duration of project : 5 years
6051 Date of start of project : July 2010
6052Likely date of completion of project: 2015
6053 Period for which report submitted : 2012 - 2013
606 Total cost of the project :
6061 Expenditure to date607 Summary Achievements:Sorghum (Sorghum bicolor L.) is an important crop in many parts of the world. It isutilized as food, fodder and several industrial purposes. In general, sorghum is known
2
to be ore tolerant to any stresses including heat, drought, salinity and flooding (Ejetaand Knoll, 2007). Drought, one of the most severe stresses, results in a considerableloss of crop productivity. Development and selection of drought tolerant foragesorghum is very much required to ensure the fodder availability in drought prone areasof country. The forage sorghum germ plasm at IGFRI comprising of stay green, highsugar content and low HCN will be screened at physiological and biochemical level fortheir tolerance to drought. Selected sorghum lines will be characterized at molecularlevel. The selected lines will be introduced into drought prone area for forageproduction in the extreme environmental conditions.
Key Words Drought, forage sorghum, antioxidant enzymes, chlorophyll
PART -II : INVESTIGATOR PROFILE610 Principal Investigators:
6101 Name:
6102 Designation:
6103 Division! Section:
6104 Location:
6105 Institute Address:
611 Co- Investigators
Dr. Manoj Kumar Srivastava
Senior Scientist
Crop Improvement Division
Crop Improvement Division
IGFRI, Jhansi-284 003
611 Co- Investigators
6111 Name6112 Designation:6113 Division !Section:6114 Location :6115 Institute Address:
PART -III: TECHNICAL DETAILS620 Introduction and objectives;6201 Immediate objectives:
• Screening and selection of drought tolerant lines of forage sorghum
• Biochemical and Molecular characterization of drought tolerance in fodder
sorghum
6202 Long term objectives:• Introduction of promising drought tolerant lines of forage sorghum.
6203 Specific objectives for the year as detailed in RPF-11. Enzymatic profile of antioxidant enzymes viz. Catalase, Peroxidase, SOD,
Polyphenol oxidase, esterase and glucosidases (validation).2. Isozyme analysis of above enzymes during drought stress (validation).3. Isolation of genomic DNA and development of molecular marker associated
with drought.621 Project Technical Profile:
6211 Technical Programme:Please see Annexure I
6212 Man months involvement of component project workers for the specified year: --
622 Progress of work6221 Achievements in terms of targets fixed for each Activity:
Please see Annexure II
6222Questions-Answered -Biochemical characterization of drought tolerant forage sorghum lines hasbeen done at morphological level.
Flower initiation and day to flower was measured in field grown lines.Six SGS and two non- SGS lines were selected for molecular analysis.
6223 Process/Product/Technology/developed during the Year.
6224 Utility of results obtained so far.The morphological and biochemical data will be used for selection of droughtresistant forage sorghum lines.
623 Publications and Material Development:(one copy each to be supplied with this proforma)
4
6231 Research Papers
6232 Popular articles : No6233 Reports
6234 Seminars and workshops (relevant to the project) in which the Scientists haveparticipated.
ANNEXURE-IC17.11" Biochemical and Molecular Approach for Characterization of DroughtTolerant Forage Sorghum"
Date of starts: July 2010Date of completion: June 2015
Technical Program:
1. Enzymatic profile of antioxidant enzymes viz. Catalase, Peroxidase; SOD, Polyphenoloxidase, esterase and glucosidases (validation).
2. Isozyme analysis of above enzymes during drought stress (validation).3. Isolation of genomic DNA and development of molecular marker associated with
drought.
Activity of catalase
Catalase activity was assayed by measuring the loss of H202 concentration by the
enzyme extract by measuring the absorbance at 240 nm.
Activity of peroxidase
Peroxidase activity was measured by method of Chance and Machly (1955) using
guaiacol as substrate.
Guaiacol + H202 ~ Oxidized guaiacol + H20
The resulting oxidized guaiacol was measured at 470 nm.
Activity of Superoxide dismutase
SOD activity was measured by measuring the ability of enzyme extract to inhibit
photochemical reduction of nitroblue tetrazolium (NBT) according to method of
9ginnnopolitis and Reis (1977) with slight modifications.
PCR analysis
The PCR conditions were setup using 50 ng of genomic DNA and all other
components in a PCR tube (200 1J1). the annealing temperature was 58°C and the
total reaction volume was 25 IJI. The PCR product was run in 1.4% agarose gel at
120 volts for 2 hours in TBE buffer.
6
7
ANNEXURE - II
C17.11
" Biochemical and Molecular Approach for Characterization of Drought
Tolerant Forage Sorghum"
Date of starts: July 2010
Date of completion: June 2015
Achievements:
Morphological and Biochemical characterization of sorghum germ plasm:
28 selected lines were sown in glass house and filed for the evaluation of drought
tolerance at morphological and biochemical levels. Germination percentage was
recorded and growth of seedlings was observed. When flowering time was
measured, it was found that flowering was delayed in all stay green lines. Leaf
morphology at 15 day stage was measured. The data is shown in Fig. 1
CGAGGAGGTCGAGTAGAACG6 Hypothetical protein GCGGACTTAGTTGGACCTGA (GT)lO
TTCACAGCATAAAGCGCAAC
11
M 12 34 56 7 8 9 10111213141516171819202122232425
Primer 1
---
Primer 2
Primer 3
Primer 4
Primer 5
Primer 6
Fig. 6: Diversity in banding pattern with 6 SSR primer set used for 25 genotypes of sorghum.
12
\ "
The SSR analysis showed that all these primer amplified the bands of expected size.
However there was polymorphism between the germplasms. The actual difference in these
bands would be resolved by getting sequence of these band and comparing them.
Based on this year's morphological, biochemical and molecular data and data of Jprevious years, six SGS lines (SGS-33, SGS-45, SGS-89, SGS-118, SGS-154 and SGS- )
168) and two non-SGS lines (IG-03-285 and EC 507882) were selected for further