Interleukin-8 production by THP-1 cells stimulated by Salmonella enterica serovar Typhimurium porins is mediated by AP-1, NF-κB and MAPK pathways

Cytokine 27 (2004) 15e24

www.elsevier.com/locate/jnlabr/ycyto

Interleukin-8 production by THP-1 cells stimulated bySalmonella enterica serovar Typhimurium porins is mediated

by AP-1, NF-kB and MAPK pathways

M. Vitielloa, M. D’Isantoa, M. Galdierob,), K. Raietaa,A. Tortoraa, P. Rotondoa, L. Pelusoa, M. Galdierob

aDipartimento di Patologia Generale, Facolta di Medicina e Chirurgia, Seconda Universita di Napoli, 80138 Naples, ItalybDipartimento di Medicina Sperimentale, Facolta di Medicina e Chirurgia, Seconda Universita degli Studi di Napoli,

Via De Crecchio 7, 80138 Naples, Italy

Received 11 October 2003; received in revised form 16 February 2004; accepted 16 March 2004

Abstract

Interleukin-8 (IL-8) is released in response to inflammatory stimuli, such as bacterial products. Either porins or

lipopolysaccharide (LPS) stimulated THP-1 cells to release IL-8 after 24 h. We have previously reported that stimulation ofmonocytic cells with Salmonella enterica serovar Typhimurium porins led to the activation of mitogen-activated protein kinasecascades and of protein tyrosine kinases (PTKs). In this report, we demonstrate, using two potent and selective inhibitors of MEKactivation by Raf-1 (PD-098059) and p38 (SB-203580), that both ERK1/2 and p38 pathways play a key role in the production of

IL-8 by porins and LPS. Porin-stimulated expression of activating protein 1 (AP-1) and correlated IL-8 release is also inhibited byPD-098059 or SB-203580 indicating that the Raf-1/MEK1-MEK2/MAPK cascade is required for their activation.

Also PTKs modulate the pathway that control IL-8 gene expression, in fact its expression is abolished by tyrphostin. By using

N-acetyl-leucinyl-leucinyl-norleucinal-H (ALLN) an inhibitor of nuclear factor-kappaB (NF-kB) activity, we also observed IL-8release modulation.

Our results elucidate some of the molecular mechanisms by which AP-1 and NF-kB regulate IL-8 release and open new strategies

for the design of specific molecules that will modulate IL-8 effects in various infectious diseases.� 2004 Elsevier Ltd. All rights reserved.

Keywords: IL-8 production; Porins; Signal transduction

1. Introduction

Interleukin-8 (IL-8) is the best characterized memberof the chemokine a-family. IL-8 is an inflammatorycytokine, produced by many cell types, which mainlyfunctions as a neutrophil chemo-attractant and activatingfactor [1], but also has potent chemotactic and stimula-tory effects on T cells, basophils, or eosinophils [2]. IL-8 isalso involved in other biological functions; it has beenreported to be a potent angiogenic factor, promotingvascularization of tumours and traumatized tissues [3].

) Corresponding author. Tel.: C39-0815667646; fax: C39-

0815667578.

E-mail address: [email protected] (M. Galdiero).

1043-4666/$ - see front matter � 2004 Elsevier Ltd. All rights reserved.

doi:10.1016/j.cyto.2004.03.010

IL-8 has been demonstrated to play a role in thepathogenesis of various diseases, including rheumatoidarthritis, psoriasis, asthma, pancreatitis, acute respira-tory distress syndrome, sepsis [4] and in hematopoiesis [5].

Outer membrane proteins (OMPs) have been shownto be important modulators of immune response toSalmonella infections [6e8]. Several works have dem-onstrated that porins induce many biological activitiesin the host cells. A well-documented effect of porins onimmunocompetent cells in vitro is the production ofcytokines by monocytes and lymphocytes [9e11]. Theseeffects have been reported with diverse porins isolatedfrom several bacteria [12,13] and with different cell types(e.g. peripheral blood mononuclear cells, macrophages,macrophagic cell lines).

16 M. Vitiello et al. / Cytokine 27 (2004) 15e24

In previous studies, we have reported that proteinphosphorylation is an early event in THP-1 activationby Salmonella enterica serovar Typhimurium, Pasteur-ella haemolytica and Haemophilus influenzae typeb porins [14]. Recently, we have demonstrated that theRaf-1/MEK1-MEK2/MAPK pathways are includedamong the proteins which are phosphorylated followingporin stimulations [15] and that S. enterica serovarTyphimurium porins were also able to stimulate proteinkinase A, protein kinase C and protein tyrosine kinases(PTKs) [16].

Furthermore, current results suggest that tyrosinephosphorylation constitutes a crucial event in the signal-ing pathways leading to IL-1a, tumor necrosis factor-aand IL-6 production by monocyte/macrophages stimu-lated with LPS, because inhibition of tyrosine kinasecorrelates with inhibition of LPS-induced macrophagesactivation and cytokine synthesis [17,18].

However, specific mechanisms by which porins mayinduce the production of proinflammatory and immu-nomodulatory cytokines have not been addressed exten-sively. The activation of transcription factors as nuclearfactor-kappaB (NF-kB) and activated protein 1 (AP-1)is an obliged step in intracellular signal pathway whichelicit changes in gene expression leading to cytokinesynthesis [19,20].

Porins were also able to activate NF-kB and AP-1[15]. AP-1 consists of various combinations of Fos andJun family members that dimerize via a leucin zipperdomain and bind to DNA via a specific target DNAsequence. The binding affinity is determined by thedifferent AP-1 dimer combinations and the context ofthe surrounding sequences. In addition, some Fos andJun proteins possess transcriptional activation domainswhich are regulated by phosphorylation. Finally thecomposition of AP-1 may change in the cells as a func-tion of time and stimulus [20].

NF-kB is present in the cytoplasm of resting cellsbound to its inhibitor, I-kBa. Subsequent to cellular acti-vation and through proteolytic degradation of I-kBa,NF-kB is released and translocated to the nucleus,where it transactivates several genes [19].

To further understand the mechanism by which porinsinduce cytokine production, we have evaluated the con-tribution of PTKs, mitogen-activated protein kinase(MAPK) pathways and transcription factors AP-1 andNF-kB in the IL-8 production upon porin stimulationcompared to LPS by using selective inhibitors.

2. Results

2.1. Purity of porin preparation

The purity of the porin preparation from S. entericaserovar Typhimurium and the eventual contamination

by LPS have been amply addressed in previous works[7e10]. SDS-PAGE revealed the presence of two bandswith molecular weights of 34 and 36 kDa (Fig. 1A). Thepattern of LPS was revealed on SDS-PAGE stained withsilver nitrate (Fig. 1B).

2.2. Porins induce IL-8 secretion by THP-1 cells

S. enterica serovar Typhimurium porins have beendemonstrated to strongly stimulate the production ofproinflammatory cytokines by human monocytic cells[9,10]; however, their ability to induce IL-8 secretion bythese cells has not been previously addressed. Weinvestigated the expression of IL-8 mRNA in THP-1cells challenged with porins and LPS. S. enterica serovarTyphimurium porins and LPS induced the synthesis ofIL-8 mRNA 2 h after stimulation (data not shown), andthe mRNA level increased up to 8 h after stimulation(Fig. 2A). Quantitative analysis by Sigma-Gel demon-strated that at 10 h post-stimulation the IL-8 mRNA inporin-stimulated cells decreased to a basal level (datanot shown). Similar results were obtained when cellswere stimulated with LPS.

Fig. 1. Pattern of S. enterica serovar Typhimurium SH5014 porins and

LPS on SDS-PAGE. (A) Lane 1: molecular weight standards

(Amersham Pharmacia Biotech, Milan, Italy) (phosphorylase b,

94 kDa; albumin, 67 kDa; ovalbumin, 43 kDa; carbonic anhydrase,

30 kDa; trypsin inhibitor, 20.1 kDa; a-lactalbumin, 14.4 kDa); lane 2:

S. enterica serovar Typhimurium porins (10 mg). The gel was stained

with Coomassie blue. (B) Lane 1: S. typhimurium LPS standard

(SigmaeAldrich S.r.l., Italy), lane 2: S. enterica serovar Typhimurium

SH5014 LPS (10 mg). The gel was stained with silver nitrate.

17M. Vitiello et al. / Cytokine 27 (2004) 15e24

Moreover, as shown in Fig. 2B, porins (5 mg/ml for3!106 cells) induced the release of IL-8 by THP-1 cellsafter 24 h of stimulation. The level of IL-8 in THP-1cells stimulated with porins was comparable to thatinduced in response to LPS (1 mg/ml).

The effects shown by porins are not attributable tocontaminating traces of LPS. The concentration of usedporins contains a biologically insufficient percentage ofLPS (about 50 pg/mg of porins), which do not induceany cytokine release or mRNA expression (data notshown). Using porins plus polymyxin-B (PB), in aconcentration range that is non-toxic for monocytes, we

Fig. 2. IL-8 production by THP-1 cells stimulated with LPS and S.

enterica serovar Typhimurium porins. (A) mRNA expression in THP-1

cells 8 h after stimulation. THP-1 cells (1!106=ml), resuspended in

RPMI 1640, were not stimulated (control) or stimulated with LPS

(1 mg/ml) or porins (5 mg/ml) or porins plus polymyxin-B (PB)

(5 mgC 25 ng/ml) for indicated times and then subjected to RNA

extraction and RT-PCR amplification. Reaction products were run on

a 1.5% agarose gel in the presence of appropriate molecular mass

markers; b-actin was the positive transcription control. RT-PCR

quantitation of cytokine results was analysed by Sigma-Gel software.

(B) THP-1 cells (3!106=ml) were not stimulated (Control) or

stimulated with LPS (1 mg/ml) or porins (5 mg/ml) or porins plus PB

(5 mgC 25 ng/ml). The IL-8 level was measured by ELISA 24 h after

stimulation. Data presented are averages from three independent

experiments, and the error bars indicate the standard errors of the

means.

did not observe any inhibition of mRNA expression orcytokine release (Fig. 2A and B).

2.3. Involvement of PTK in IL-8 production by THP-1cells stimulated by porins

Tyrosine phosphoregulation is required for IL-8production by porin stimulation. Treatment of THP-1cells with porins or LPS results in the phosphorylationof tyrosine residues of a series of unidentified proteins[14]. THP-1 cells incubated with S. enterica serovarTyphimurium porins induced a rapid increase of PTKactivity measured as described in Section 4. PTKsactivity in cell lysates is shown in Fig. 3. The activationof PTKs in response to porins was evident as early as5 min after stimulation and began declining slowly atfirst, and afterward more rapidly within 30 min. Theeffect of tyrphostin, a specific PTK inhibitor, wasanalysed. THP-1 cells pre-treated for 1 h with tyrphostinat 20 mg/ml (a concentration that does not affect cellviability) and stimulated with porins (5 mg/ml) or LPS(1 mg/ml) caused a significant decrease in the PTKactivity compared with controls stimulated with porinsor LPS but not treated with tyrphostin (Fig. 3). Next, toevaluate the involvement of PTK in IL-8 production,cytokine release was measured by enzyme-linked im-munoadsorbent assay (ELISA) after porins (5 mg/ml) orLPS (1 mg/ml) stimulation of THP-1 cells pre-treatedwith tyrphostin. As reported in Fig. 4, tyrphostin almostcompletely inhibited IL-8 release in response to porinsor LPS compared with controls that received no treat-ment with tyrphostin prior to stimulation.

2.4. MAPK pathway activation is a key eventin IL-8 induction by porins

MAPKs are a group of serine/threonine proteinkinases which can be activated by various extracellularstimuli. MAPKs play a key role in the regulation of geneexpression and cytoplasmic activities. Well-character-ized MAPK pathways include in mammalian system fivedifferent MAPK modules identified so far; single MAPKmodule can signal independently of one another. Porinsare capable of activating ERK1/2, JNK and p38pathways in U937 cells, although with different intensity[15]. To determine the involvement of ERK1/2, JNKand p38 pathways in porin-induced IL-8 production, theeffects of specific inhibitors were examined (Fig. 4). Thepre-treatment of THP-1 cells with PD-098059, whichblocks the ERK-activating MEK1, strongly decreasedIL-8 release after LPS stimulations but was ineffectiveafter porin stimulations. As depicted in Fig. 4, the p38inhibitor SB-203580, a bicyclic imidazole compound,significantly reduced IL-8 release in response to porins.Furthermore, SB-203580 also inhibited partially IL-8production after LPS stimulation. In previous assays, we

18 M. Vitiello et al. / Cytokine 27 (2004) 15e24

demonstrated that the concentrations of inhibitors andporins or LPS used were not toxic for the cells; in fact,the treatment did not induce any significant release ofLDH in the cell supernatants (data not shown).

2.5. Involvement of NF-kB and AP-1 in IL-8production by porins

It is well documented that LPS induces NF-kB activ-ation in monocytes and regulates cytokine expression

0

50

100

150

200

250

300

0 5 10 20 30

PT

K activity (p

mo

l/m

in

/µg

p

ro

tein

)

Time (min)

Salmonella enterica serovar Typhimurium LPS(1µg/ml)Salmonella enterica serovarTyphimurium porins(5µg/ml)Salmonella enterica serovarTyphimurium LPS+ tyrphostinSalmonella enterica serovarTyphimurium porins+ tyrphostin

Fig. 3. PTKs activity in THP-1 cells in response to LPS and S. enterica

serovar Typhimurium porins. Cells (3!106=ml) were stimulated for

different time period with LPS (1 mg/ml) or porins (5 mg/ml); inhibition

of PTK in U937 (3!106=ml) was accomplished by pre-treatment with

tyrphostin (20 mg/ml) and followed by porin or LPS stimulation. PTK

activity was measured as described in Section 4. The results shown are

averages from three independent experiments, and the error bars

indicate the standard errors of the means.

[21]. It has been recently demonstrated that porinsinduce the activation of AP-1 and NF-kB in U937 cells[15]. These transcription factors are supposed to beinvolved in the expression of proinflammatory cytokinegenes.

We therefore assay the involvement of NF-kB andAP-1 in IL-8 production by porins in THP-1 cells. Toinvestigate the NF-kB activation in IL-8 productioninduced by porins, THP-1 were incubated with a specificNF-kB inhibitor, ALLN, that inhibits NF-kB activationby preventing I-kBa degradation, before being chal-lenged with either porins or LPS (Fig. 4). IL-8production was determined in cell supernatants after24 h of stimulation. As shown in Fig. 4, NF-kB inhibitorweakly inhibited the production of IL-8 in THP-1 cellschallenged with either porins or LPS.

Further experiments were performed to ascertainwhether MAPKs had a role in the binding of AP-1and NF-kB to DNA by porins. Specifically, we lookedat the effects of the PD-098059 and SB-203580 inhibitorson binding of AP-1 (c-Fos subunits) or p50 and p65NF-kB subunits to a consensus AP-1 or NF-kB bindingsequences.

The results obtained showed that increased specificbinding of active AP-1 (Fig. 5) or p50 and p65 NF-kBsubunits (Fig. 6) were detected in monocyte lysates 1 hafter stimulation with porins.

However, the pre-treatment with the p38 inhibitorSB-203580 significantly affected porin-stimulated c-Fossubunits or NF-kB binding to DNA, suggesting that thefunctionality of these proteins requires the activation ofp38 pathway. Pre-treatment with PD-098059 was lesseffective in activating c-Fos. These data demonstratedthe involvement of AP-1 and NF-kB in IL-8 productionby THP-1 cells in response to two different bacterial

Fig. 4. Effects of p38,MAPK cascade, PTK andNF-kB specific inhibitor on IL-8 release by THP-1 cells. Cells (3!106=ml) were pre-treated for 1 h with

the p38 inhibitor SB-203580 (10 mM), the ERK1/2 inhibitor PD-098059 (100 mM), the inhibitor of EGF receptor tyrosine kinase activity tyrphostin

(20 mg/ml) or the NF-kB inhibitor ALLN (100 mM). After stimulation with porins (5 mg/ml) or LPS (1 mg/ml), IL-8 production was measured after 24 h

by ELISA and expressed as percentage of production normalized to cells that received no treatment prior to stimulation. The results shown are averages

from three independent experiments, and the error bars indicate the standard errors of the means (P! 0:01; Student’s t-test).

19M. Vitiello et al. / Cytokine 27 (2004) 15e24

stimuli. The inhibitor concentration used as well as theduration of the treatment failed to induce any significantrelease of LDH from the cells (data not shown).

Moreover, a temporal relationship between the acti-vation of the analysed pathways is depicted in Fig. 7,showing how the various pathways are linked. THP-1cells pre-treated with tyrphostin and stimulated withporins (5 mg/ml) or LPS (1 mg/ml) do not release IL-8and do not activate MAPK, AP-1 and NF-kB. How-ever, THP-1 cells pre-treated with SB-203580 or PD-098059 and stimulated with porins (5 mg/ml) or LPS(1 mg/ml) release only small amounts of IL-8, althoughPTKs are activated. ALLN treated cells similarly releasesmall amounts of IL-8, and PTKs and MAPKs are alsoactivated.

3. Discussion

Monocytes/macrophages play a major role in thepathogenesis of inflammatory diseases being an essentialtarget for gram-negative and gram-positive bacteria.LPS is largely known to induce different cell types tosecrete large amounts of IL-8 [2]. The present studydemonstrated that also porins from S. enterica serovarTyphimurium induce IL-8 expression and release byTHP-1 cells, an event that appears to be dependent onearly activation of AP-1 and NF-kB. Stimulation ofIL-8 gene expression occurred in a time-dependent

Fig. 5. Effect of MAPK inhibitors on binding of c-Fos AP-1 subunit to

an AP-1-binding consensus sequence. THP-1 cells were stimulated with

S. enterica serovar Typhimurium porins (5 mg/ml) or LPS (1 mg/ml) in

the absence or presence of an ERK 1/2 inhibitor (PD-098059, 100 mM),

or a p38 inhibitor (SB-203580, 10 mM). Cell lysates (10 mg/ml) were

tested for binding of the activated c-Fos AP-1 subunit to an AP-1

consensus sequence using the Trans-Am AP-1 ELISA kit. The

experiment was performed in the presence of soluble wild-type or

mutated consensus oligonucleotides. The results are expressed as

specific binding (absorbance measured in the presence of the mutated

oligonucleotide minus that measured in the presence of the wild-type

oligonucleotide). The results are shown as means G standard errors of

triplicate determinations (P! 0:01; Student’s t-test).

fashion, with increased levels observed as early 2 hpost-treatment. Porins stimulated the translocation ofNF-kB and AP-1 at 60 min of incubation, as determinedby ELISA. In the present study, we investigated theinvolvement of PTK and MAPK pathways in IL-8regulation in THP-1 cells stimulated with either porinsor LPS (as positive control), by using specific inhibitorsas tyrphostin, PD-098059 and SB-203580, that selec-tively inhibit PTKs, ERK1/2 and p38 pathways. Theresults showed that the pathways assayed were involvedin IL-8 regulation via activation of a number of specifictranscription factors including AP-1 and NF-kB. Theeffect of PTK blockade on IL-8 production afterpre-treatment with tyrphostin, clearly showed the in-volvement of PTK in the signaling pathways leading toIL-8 production by THP-1 in response to both LPS and

0

0,2

0,4

0,6

0,8

1

1,2

1,4

1,6

1,8

w/o inhibitors with PD with SB with ALLN

0

0,2

0,4

0,6

0,8

1

1,2

1,4

1,6

1,8

w/o inhibitors with PD with SB with ALLN

Sp

ecific N

F-κB

b

in

din

g

(O

D 450 n

m)

Control

Salmonella entericaserovar TyphimuriumLPS (1µg/ml)

Salmonella entericaserovar Typhimuriumporins (5µg/ml)

p50 subunit

NF-kB activation

*

**

*

**

* *

p65 subunit

**

* *

Sp

ecific N

F-κB

b

in

din

g

(O

D 450 n

m)

Fig. 6. Effect of MAPK inhibitors on binding of NF-kB subunits to an

NF-kB-binding consensus sequence. THP-1 cells were stimulated with

S. enterica serovar Typhimurium porins (5 mg/ml) or LPS (1 mg/ml) in

the absence or presence of an ERK 1/2 inhibitor (PD-098059, 100 mM),

or a p38 inhibitor (SB-203580, 10 mM), or the NF-kB inhibitor ALLN

(100 mM). Cell lysates (10 mg/ml) were tested for binding of the

activated p50 and p65 NF-kB subunits to an NF-kB consensus

sequence using the Trans-Am NF-kB ELISA kit. The experiment was

performed in the presence of soluble wild-type or mutated consensus

oligonucleotides. The results are expressed as specific binding

(absorbance measured in the presence of the mutated oligonucleotide

minus that measured in the presence of the wild-type oligonucleotide).

The results are shown as means G standard errors of triplicate

determinations (P! 0:01; Student’s t-test).

20 M. Vitiello et al. / Cytokine 27 (2004) 15e24

porins of S. enterica serovar Typhimurium. The p38inhibitor, SB-203580, efficiently blocked IL-8 produc-tion in THP-1 cells in response to porins whereas theERK1/2 pathway inhibitor, PD-098059, resulted lessefficient. Several studies suggest that IL-8 regulationvaries from one cell type to another and/or dependentson the stimulating agent [22,23]. Recently, it has beendemonstrated that combined stimulation of THP-1 cellswith LPS and interferon-gamma up-regulate mCD14,Toll-like receptor 4, MD-2 and MyD88 expression bythese cells, which might be involved markedly inincreased IL-8 production by cells [24]. However, inour study, a functional role for NF-kB in induction ofIL-8 gene expression by S. enterica serovar Typhimu-rium porins was demonstrated by experiments usingALLN, a proteasome inhibitor, that has been shown todetermine specific inhibition of NF-kB activation andTNF production in a murine macrophage cell line, in theplasma of septic mice and in THP-1 monocytic cells [25].The most prominent NF-kB dimer consists of thesubunits p50 and p65 and is present in the cytosol inan inactive state bound to inhibiting proteins collectivelytermed I-kB. Activation of NF-kB involving phosphor-ylation and removal of I-kB followed by nucleartranslocation of the heterodimer is induced by a varietyof agents including proinflammatory and immunomod-ulatory cytokines [19]. In our assays, porins activatedthe nuclear translocation of the heterodimer; this

Porins or LPS

PTK TYRPHOSTIN

P38 ERK1/2SB203580 PD-098059

AP-1 NF-kB ALLN

IL-8

Fig. 7. Porin-mediated activation of IL-8 production via PTK and

MAPK pathways.

translocation is inhibited by ALLN, indicating thatporin-induced proteolysis of I-kB was inhibited byprotease inhibitors. This could suggest the participationof I-kB in phosphorylation-dependent pathway forNF-kB activation by S. enterica serovar Typhimuriumporins. Brasier et al. [26] recently demonstrated by usingan agent that blocks both I-kB proteolysis and NF-kBtranslocation that NF-kB play an important role ininduction of IL-8 by TNF-a in A549 alveolar cells.

It has been suggested that pathogenic bacteria induceNF-kB activation followed by the up-regulation ofproinflammatory mediators such as IL-8, in a variety ofcultured epithelial cells [27,28]. Savkovic et al. [29]observed that infection of intestinal epithelial cells byenteropathogenic E. coli, but non-pathogenic, inducesnuclear translocation of NF-kB, resulting in the gen-eration of IL-8.

The present study demonstrated that also AP-1activation generated upon porin stimulation was re-quired for IL-8 production. The role of AP-1 in THP-1cells stimulated with porins required functional expres-sion of MEK1/ERK molecules and p38 molecules,furthermore cells pre-treated with PD-098059 or SB-20350 showed a reduction or a total inhibition of IL-8production.

Several evidences in the literature indicate thatproteins of MEK and ERK families are involved inAP-1eDNA binding protein activation induced bya variety of stimuli. The expression of several cytokinesproduced by cells as Th1 and Th2 is regulated, at least inpart, by AP-1. Various Fos and Jun proteins interactwith the promoters of these genes, either as independentAP-1 dimer or in cooperation with other transcriptionfactors [30].

Although the receptor family that leads to AP-1 andNF-kB activation following porins stimulation of THP-1 cells is still unknown, it is well established thattranscription factor activation resulting from engage-ment of several surface receptors with their extracellularligands, usually involves the Ras, Raf, MEK and ERKintermediates. Accordingly, in our experiments, thesepathways act as cellular intermediates in linking porinstimulation to AP-1 and NF-kB activation.

Collectively, our results indicate that the IL-8 re-sponse observed with S. enterica serovar Typhimuriumporin requires the independent activation of severalpathways, including PTK, MEK/ERK and p38. It isimportant to understand the mechanism of how theproduction of IL-8 is regulated by the simultaneousactivation of multiple pathways. Complete inhibition ofIL-8 release appears to require blockade of more thanone intracellular mediator. Therefore, eventual thera-peutic strategies aimed at preventing IL-8 increasedproduction could perhaps exploit the simultaneousblockade of multiple signaling events using combinedtreatments.

21M. Vitiello et al. / Cytokine 27 (2004) 15e24

4. Materials and methods

4.1. THP-1 cell line

The human promyelomonocytic cell line THP-1(ATCC TIB-202) [31] was cultured at 37 (C in a moistatmosphere of 5% CO2 in complete medium consistingof RPMI 1640 supplemented with 10% heat-inactivatedfetal calf serum (FCS), 2 mM L-glutamine, penicillin(100 U/ml), and streptomycin (100 U/ml) (Labtek,Eurobio) in 150-cm2 tissue culture flasks (Corning,New York, NY).

4.2. Bacterial strain

The bacterial strain used was: Salmonella entericaserovar Typhimurium strain SH5014 grown in nutrientbroth (Difco, Detroit, MI) for 18e24 h at 37 (C underagitation. The cells were harvested at the end of theexponential growth phase, and outer membranes wereprepared from cell envelopes following protocols de-scribed by Nurminen et al. [32].

4.3. Porin preparation

S. enterica serovar Typhimurium was used to extractand purify porins. Porins were isolated from thelysozymeeEDTA envelopes as described by Nurminenet al. [33]. Briefly, 1 g of envelopes was suspended in 2%Triton X-100 in 0.01 M TriseHCl (pH 7.5, containing10 mM EDTA); after the addition of trypsin (10 mg/g ofenvelopes), the pellet was dissolved in sodium dodecylsulfate buffer (SDS buffer, 4% [wt/vol] in 0.1 M sodiumphosphate [pH 7.2]), and applied to an Ultragel ACA 34column equilibrated with 0.25% SDS buffer. The frac-tion containing proteins, identified by absorption at280 nm (A280), was extensively dialysed and checked bySDS-polyacrylamide gel electrophoresis (SDS-PAGE)according to Laemmli [34]. The purity of the porinpreparation was checked by SDS-PAGE, and revealedtwo bands with molecular weights of 34 and 36 kDa.The protein content of the porin preparation wasdetermined by the method of Lowry et al. [35]. LPScontamination, revealed on SDS-PAGE gels stainedwith silver nitrate as described by Tsai and Frasch [36],was determined by the Limulus amoebocyte lysate assay(Limulus test) [37]. The Limulus test showed the presenceof LPS at 50 pg/mg of porins. The LPS concentration inthe porin preparation was estimated to be !0.005%(wt/wt) compared with a standard S. enterica serovarTyphimurium LPS solution. In addition, PB (SigmaeAldrich S.r.l., Milan, Italy) was incubated with porins toneutralize the biological activity of possible traces ofLPS. The porins were incubated with PB at roomtemperature for 1 h in a ratio of 1:100 [38]. LPS, porins

and PB mixture were used in pyrogen-free phosphate-buffered saline (PBS).

4.4. LPS preparation

LPS-R was isolated from S. enterica serovar Typhi-murium with phenol/chloroform/ether as described byGalanos et al. [39]. Briefly, liquid phenol (90 g of dryphenol plus 11 ml of waterechloroformepetroleumether in a volume ratio of 2:5:8) was added to 1 g ofdried bacteria. After 2 min homogenisation, bacteriawere centrifuged and extracted twice. The supernatantswere filtered through filter paper and treated as de-scribed by Galanos et al. [39].

4.5. THP-1 stimulation and cytokine release

THP-1 cells were cultured in serum-free medium, for24 h at 37 (C before experimentation to prevent anyinterference with serum factors on nuclear activation.The day after, cells (3! 106 cells/ml) were washed,resuspended in complete medium and then stimulatedwith porins (5 mg/ml) or LPS (1 mg/ml) and incubatedfor 24 h at 37 (C in an atmosphere of 5% CO2. Afterincubation the samples were centrifuged at 1800 rpm at4 (C for 10 min and the supernatants were collected andstored at �70 (C. All samples were assayed for thepresence of IL-8 by ELISA, according to the manufac-turer’s instructions (Roche Diagnostics GmbH, RocheMolecular Biochemicals).

4.6. Inhibitors of signal transduction by porins or LPS

In some experiments, before stimulation, THP-1 cells(3! 106 cells/ml) were pre-treated with different inhib-itors: 2#-amino-3#-methoxyflavone (PD-098059) (NewEngland Biolabs, Inc.) (100 mM for 1 h), a highlyselective inhibitor of MEK1 activator and MAP kinasecascade [40]; 4-(4-fluorophenyl)-5-(4-pyridyl)1H-imida-zole (SB-203580) (Calbiochem-Novabiochem GmbH,Schwalbach, Germany) (10 mM for 1 h), a specificinhibitor of the p38 pathway [41]; 3,4-dihydroxybenzy-lidene-malononitrile (tyrphostin 23) (Calbiochem-Novabiochem GmbH, Schwalbach, Germany) (20 mg/ml for 1 h), an inhibitor of epidermal growth factor(EGF) receptor tyrosine kinase activity [42]; N-acetyl-leucinyl-leucinyl-norleucinal-H (ALLN) (Sigma Chem-ical Company, St. Louis, MO) (100 mM for 1 h), aproteasome inhibitor that inhibits NF-kB activation bypreventing I-kBa degradation [43].

4.7. RNA extraction, reverse transcription and PCR

All assays were carried out using 1! 106 THP-1cells/ml cultured in RPMI 1640 without FCS for 24 h at37 (C. Porins (5 mg/ml) or LPS (1 mg/ml) were added to

22 M. Vitiello et al. / Cytokine 27 (2004) 15e24

suspensions of THP-1 cells, resuspended in completemedium, for 2, 4 and 8 h.

After incubation times, the cells were collected,washed and total RNA was extracted by High PureRNA Isolation kit (Roche Diagnostics GmbH, RocheMolecular Biochemicals). Two micrograms of RNA wasconverted into cDNA in a 20 ml reaction mixturecontaining 1! reaction buffer (M-MuLV RT buffer5!, Roche Diagnostics GmbH, Roche MolecularBiochemicals), 20 U RNasi inhibitor (Roche Diagnos-tic GmbH, Roche Molecular Biochemicals), 10 UM-MuLV Reverse Transcription (Roche DiagnosticGmbH, Roche Molecular Biochemicals), 1 mM dNTPnucleotide mix (Roche Diagnostic GmbH, Roche Mole-cular Biochemicals) and 0.125 mg random hexamers(Roche Diagnostic GmbH, Roche Molecular Biochem-icals). This mixture was incubated in a PerkineElmer thermal cycler for 10 min at 25 (C, 60 minat 37 (C, 5 min at 99 (C and 5 min at 4 (C. Humancytokine primer pair sequences were designed onthe basis of published gene sequences as reported inTable 1.

Ten microliters of cDNA was amplified in thepresence of 400 mM dNTP PCR nucleotide mix (RocheDiagnostic GmbH, Roche Molecular Biochemicals),0.5 U Taq DNA polymerase (Roche Diagnostic GmbH,Roche Molecular Biochemicals), 1! PCR reactionbuffer (PCR-Reaction buffer 10!, Roche DiagnosticGmbH, Roche Molecular Biochemicals), 20 mM 5#and 3# (each) cytokine primers (Roche DiagnosticGmbH, Roche Molecular Biochemicals) (Table 1) ina final volume of 50 ml. The PCR was performed ina PerkineElmer thermal cycler for 1 cycle at 96 (C for1 min, 30 cycles each of 1 min of denaturation at 96 (C,1 min of annealing at 58 (C and 1 min of extensionat 72 (C.

The reaction product was visualized by electro-phoresis using 25 ml of the reaction mixture at 100 Vin a 1.5% agarose gel containing ethidium bromide(1 mg/ml). The gels were then examined on a UV lightbox and photographed. BglI- and HinfI-digestedpBR328 DNA (Roche Diagnostic GmbH, RocheMolecular Biochemicals) (1 mg) was run in parallel asa molecular size marker ( providing bands at 2.176,1.766, 1.230, 1.033, 653, 517, 453, 394, 298, 234, 220and 154 bp).

Table 1

Primer sequences used for PCR-assisted mRNA amplification

Target

primer

Oligonucleotide sequence

IL-8 5#CCGGAAGGAACCATCTCACT3#5#ACTTCTCCACAACCCTCTGC3#

b-Actin 5#TGACGGGGTCACCCACACTGTGCCCATCTA3#5#CTAGAAGCATTGCGGTGGACGATGGAG3#

4.8. PTK activity

Analysis of PTK activity was performed with a non-radioactive tyrosine kinase assay kit (Oncogene ResearchProducts, MA) and was expressed as picomoles ofphosphopeptide per minute per microgram of protein.

4.9. AP-1 and NF-kB activation analysis

To detect and quantify AP-1 and NF-kB activation inTHP-1 cells, we used ELISA-based Trans-Am transcrip-tion factor kits (Active Motif, Carlsbad USA) thatexploited a patented technology to attach an oligonucle-otide containing a TPA-responsive element (TRE)(5#-TGAGTCA-3#) or an NF-kB binding consensussequence (5#-GGGACTTTCC-3#) to a 96-well plate ac-cording to the transcription factors analysed [44,45]. Theactive forms of c-Fos or NF-kB p50 and p65 subunits inwhole-cell extracts can be detected using Abs specific forepitopes that are accessible only when the nuclear factorsare activated and bound to their target DNA.

Preparation of cell extract was done according to themanufacturer’s instructions. The specificity of the assayswas checked by measuring the ability of soluble wild-type or mutated AP-1 or NF-kB oligonucleotides to in-hibit binding. In preliminary assays, the Trans-Am kitsshowed a good correlation with an EMSA in detectingthe DNA binding capacity of AP-1 and NF-kB.

The optimal time of stimulation (1 h) and amount ofporins (5 mg/ml) or LPS (1 mg/ml) used in the NF-kBand AP-1 ELISA were determined in preliminaryexperiments.

4.10. Lactate dehydrogenase (LDH) assay

LDH assay was carried out according to manufac-turer’s instructions by using a cytotoxicity detectionkit (Roche Diagnostic GmbH, Roche Molecular Bio-chemicals). LDH is a stable cytoplasmic enzyme presentin all cells and is rapidly released into cell culture super-natant when the plasma membrane is damaged. LDHactivity was determined by a coupled enzymatic reactionwhereby the tetrazolium salt (INT) was reduced toformazan. An increase in the number of dead or damagedcells resulted in an increase in LDH activity in the culturesupernatant. The amount of LDH shows that treated anduntreated cells are healthy.

4.11. Reproducibility

Cytokine levels were expressed as mean values Gstandard errors of three independent observations;differences were considered significant at values ofP! 0:01 (Student’s t-test).

23M. Vitiello et al. / Cytokine 27 (2004) 15e24

The results obtained were confirmed by using Sigma-Gel software and shown below are averages of thevalues from three different experiments.

References

[1] Oppenheim JJ, Zachariae CO, Mukaida N, Matsushima K.

Properties of the novel proinflammatory supergene ‘‘intercrine’’

cytokine family. Annu Rev Immunol 1991;9:617e48.

[2] Baggiolini M, Dewald B, Moser B. Interleukin-8 and related

chemotactic cytokinesdCXC and CC chemokines. Adv Immunol

1994;55:97e179.[3] Koch AE, Polverini PJ, Kunkel SL, Harlow LA, DiPietro LA,

Elner VM, et al. Interleukin-8 as a macrophage-derived mediator

of angiogenesis. Science 1992;258:1798e801.

[4] Strieter RM, Koch AE, Antony VB, Fick Jr RB, Standiford TJ,

Kunkel SL. The immunopathology of chemotactic cytokines: the

role of interleukin-8 and monocyte chemoattractant protein-1. J

Lab Clin Med 1994;123:183e97.

[5] Cacalano G, Lee J, Kikly K, Ryan AM, Pitts-Meek S, Hultgren B,

et al. Neutrophil and B cell expansion in mice that lack the murine

IL-8 receptor homolog. Science 1994;265:682e4.

[6] Galdiero F, Tufano MA, Sommese L, Folgore A, Tedesco F.

Activation of the complement system by porins extracted from

Salmonella typhimurium. Infect Immun 1984;46:559e63.

[7] Galdiero F, Tufano MA, Galdiero M, Masiello S, Di Rosa M.

Inflammatory effects of Salmonella typhimurium porins. Infect

Immun 1990;58:3183e8.

[8] Gupta S, Kumar D, Vohra H, Gaunuly NK. Involvement of

signal transduction pathways in Salmonella typhimurium porin

activated gut macrophages. Mol Cell Biochem 1999;194:235e43.

[9] Galdiero F, Cipollaro de l’Ero G, Benedetto N, Galdiero M,

Tufano MA. Release of cytokines by Salmonella typhimurium

porins. Infect Immun 1993;61:155e61.[10] Galdiero M, Cipollaro de l’Ero G, Donnarumma G, Marcatili A,

Galdiero F. Interleukin-1 and interleukin-6 gene expression in

human monocytes stimulated with Salmonella typhimurium

porins. Immunology 1995;86:612e9.[11] Henderson B, Poole S, Wilson M. Bacterial modulins. Novel class

of virulence factors which cause host tissue pathology by inducing

cytokine synthesis. Microbiol Rev 1996;60:316e41.[12] Galdiero M, D’Amico M, Gorga F, Di Filippo C, D’Isanto M,

Vitiello M, et al. Haemophilus influenzae porin contributes to

signaling of the inflammatory cascade in rat brain. Infect Immun

2001;69:221e7.[13] Iovane G, Pagnini P, Galdiero M, Cipollaro de l’Ero G, Vitiello

M, D’Isanto M, et al. Role of Pasteurella multocida porin on

cytokine expression and release by murine splenocytes. Vet

Immunol Immunopathol 1998;66:391e404.[14] Galdiero M, Vitiello M, D’Isanto M, Peluso L, Galdiero M.

Induction of tyrosine phosphorylated proteins in THP-1 cells by

Salmonella typhimurium, Pasteurella haemolytica and Haemophi-

lus influenzae porins. FEMS Immunol Med Microbiol 2001;1330:

1e10.

[15] Galdiero M, Vitiello M, Sanzari E, D’Isanto M, Tortora A,

Longanella A, et al. Porins from Salmonella enterica serovar

typhimurium activate transcription factors AP-1 and NF-kB

through the Raf1/MEK1-MEK2/MAPK cascade. Infect Immun

2002;70:558e68.

[16] Galdiero M, D’Isanto M, Vitiello M, Finamore E, Peluso L,

Galdiero M. Monocytic activation of protein tyrosine kinase,

protein kinase A and protein kinase C induced by porins isolated

from Salmonella enterica serovar Typhimurium. J Infect 2003;46:

111e9.

[17] Beaty CD, Franklin TL, Uehara Y, Wilson CB. Lipopolysacchar-

ide-induced cytokine production in human monocytes: role of

tyrosine phosphorylation in transmembrane signal transduction.

Eur J Immunol 1994;24:1278e84.

[18] Weinstein SL, Sanghera JS, Lemke K, DeFranco AL, Pelech SL.

Bacterial lipopolysaccharide induces tyrosine phosphorylation

and activation of mitogen-activated protein kinases in macro-

phages. J Biol Chem 1992;267:14955e62.[19] Caamano J, Hunter CA. NF-kB family of transcription factors:

central regulators of innate and adaptive immune functions. Clin

Microbiol Rev 2002;15:419e29.

[20] Karin M, Liu ZG, Zandi E. AP-1 function and regulation. Curr

Opin Cell Biol 1997;9:240e6.

[21] Yao J, Mackman N, Edgington TS, Fan ST. Lipopolysaccharide

induction of the tumor necrosis factor-alpha promoter in human

monocytic cells. Regulation by Egr-1, c-Jun, and NF-kappaB

transcription factors. J Biol Chem 1997;272:17795e801.

[22] Alcorn MJ, Booth JL, Coggeshall KM, Metcalf JP. Adenovirus

type 7 induces interleukin-8 production via activation of

extracellular regulated kinase 1/2. J Virol 2001;75:6450e9.

[23] Marie C, Roman-Roman S, Rawadi G. Involvement of mitoge-

n-activated protein kinase pathways in interleukin-8 production

by human monocytes and polymorphonuclear cells stimulated

with lipopolysaccharide or Mycoplasma fermentans membrane

lipoproteins. Infect Immun 1999;67:688e93.

[24] Tamai R, Sugawara S, Takeuchi O, Akira S, Takada H.

Synergistic effects of lipopolysaccharide and interferon-gamma

in inducing interleukin-8 production in human monocytic THP-1

cells is accompanied by up-regulation of CD14, Toll-like recep-

tor 4, MD-2 and MyD88 expression. J Endotoxin Res 2003;9:

145e53.

[25] Haas M, Page S, Page M, Neumann FJ, Marx N, Adam M, et al.

Effect of proteasome inhibitors on monocytic IkappaB-alpha

and -beta depletion, NF-kappaB activation, and cytokine produc-

tion. J Leukoc Biol 1998;63:395e404.

[26] Brasier AR, Jamaluddin M, Casola A, Duan W, Shen O,

Garofalo RP. A promoter recruitment mechanism for tumor

necrosis factor-alpha-induced interleukin-8 transcription in type

II pulmonary epithelial cells. Dependence on nuclear abundance

of Rel A, NF-kappaB1, and c-Rel transcription factors. J Biol

Chem 1998;273:3551e61.

[27] Dyer RB, Collaco CR, Niesel DW, Herzog NK. Shigella flexneri

invasion of HeLa cells induces NF-kappa B DNA-binding

activity. Infect Immun 1993;61:4427e33.

[28] Eckmann L, Kagnoff MF, Fierer J. Epithelial cells secrete the

chemokine interleukin-8 in response to bacterial entry. Infect

Immun 1993;61:4569e74.

[29] Savkovic SD, Koutsouris A, Hecht G. Attachment of a non-

invasive enteric pathogen, enteropathogenic Escherichia coli, to

cultured human intestinal epithelial monolayers induces trans-

migration of neutrophils. Infect Immun 1996;64:4480e7.

[30] Rincon M, Derijard B, Chow CW, Davis RJ, Flavell RA.

Reprogramming the signalling requirement for AP-1 (activator

protein-1) activation during differentiation of precursor CD4C

T-cells into effector Th1 and Th2 cells. Genes Funct 1997;1:

51e68.[31] Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T,

Tada K. Establishment and characterization of a human acute

monocytic leukaemia cell line (THP-1). Int J Cancer 1980;26:

171e5.[32] Nurminen M, Lounatmaa K, Sarvas M, Makela PH, Nakae T.

Bacteriophage-resistant mutants of Salmonella typhimurium de-

ficient in two major outer membrane proteins. J Bacteriol 1976;

127:941e55.

[33] Nurminen M. Isolation of porin trimers. Enterobacterial surface

antigens: methods for molecular characterization. FEMS Symp

1985;25:294e9.

24 M. Vitiello et al. / Cytokine 27 (2004) 15e24

[34] Laemmli UK. Cleavage of structural proteins during the assembly

of the head of the bacteriofage T4. Nature 1970;277:680e5.

[35] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein

measurement with the Folin phenol reagent. J Biol Chem 1951;

193:265e75.

[36] Tsai CM, Frasch CE. A sensitive silver-stain for detecting

lipopolysaccharides in polyacrylamide gels. Anal Biochem 1982;

119:115e9.[37] Yin ET, Galanos C, Kinsky S, Bradshaw RA, Wessler S, Luderity

O, et al. Picogram sensitive assay for endotoxin: gelation of

Limulus polyphemus blood cell lysate induced by purified

lipopolysaccharide and lipid A from Gram negative bacteria.

Biochim Biophys Acta 1972;261:284e9.

[38] Morrison DC, Jacobs DM. Binding of polymyxin B to the lipid A

portion of bacterial lipopolysaccharides. Immunochemistry 1976;

13:813e8.

[39] Galanos C, Luderitz O, Westphal O. A new method for the

extraction of R lipopolysaccharides. Eur J Biochem 1969;9:245e9.

[40] Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR.

PD-098059 is a specific inhibitor of the activation of mitogen-

activated protein kinase kinase in vitro and in vivo. J Biol Chem

1995;270:27489e94.

[41] Cuenda A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF,

et al. SB203580 is a specific inhibitor of a MAP kinase homologue

which is stimulated by cellular stress and interleukin-1. FEBS Lett

1995;364:229e33.

[42] Gazit A, Yaish P, Gilon C, Levitzki A. Tyrphostin I: synthesis

and biological activity of protein tyrosine kinase inhibitors. J Med

Chem 1989;32:2344e52.

[43] Zen K, Karsan A, Eunson T, Yee E, Harlan JM. Lipopolysac-

charide-induced NF-kB activation in human endothelial cells

involves degradation of IkBa but not IkBb. Exp Cell Res 1998;

243:425e33.

[44] Basbous J, Arpin C, Gaudray G, Piechaczyk Devaux C, Mesnard

JM. The HBZ factor of human T-cell leukaemia virus type I

dimerizes with transcription factors JunB and c-Jun and modu-

lates their transcriptional activity. J Biol Chem 2003;278:43620e7.

[45] Renard P, Ernest I, Houbion A, Art M, Le Calvez H, Raes M,

et al. Development of a sensitive multi-well colorimetric assay for

active NFkB. Nucleic Acids Res 2001;29(4):E21.