-
Science in China Series C: Life Sciences
© 2009 SCIENCE IN CHINA PRESS
Springer
Citation: HU Y, CONG Y G, LI S, et al. Identification of in vivo
induced protein antigens of Salmonella enterica serovar Typhi
during human infection. Sci China SerC-Life Sci, 2009, 52(10):
942-948, doi: 10.1007/s11427-009-0127-z
www.scichina.com life.scichina.com
www.springer.com/scpwww.springerlink.com
Identification of in vivo induced protein antigens of Salmonella
enterica serovar Typhi during human infection
HU Yong1,2, CONG YanGuang1†, LI Shu1, RAO XianCai1, WANG Gang3
& HU FuQuan1† 1 Department of Microbiology, Third Military
Medical University, Chongqing 400038, China; 2 Department of
Biotechnology, Chongqing University of Technology, Chongqing
400050, China; 3 Department of Clinical Laboratory, The 3rd
Hospital of People’s Liberation Army, Baoji 721004, China
During infectious disease episodes, pathogens express distinct
subsets of virulence factors which allow them to adapt to different
environments. Hence, genes that are expressed or upregulated in
vivo are implicated in pathogenesis. We used in vivo induced
antigen technology (IVIAT) to identify antigens which are expressed
during infection with Salmonella enterica serovar Typhi. We
identified 7 in vivo induced (IVI) antigens, which included BcfD (a
fimbrial structural subunit), GrxC (a glutaredoxin 3), SapB (an
ABC-type transport system), T3663 (an ABC-type uncharacterized
transport system), T3816 (a putative rhodanese-related
sulfurtransferase), T1497 (a probable TonB-dependent receptor) and
T3689 (unknown function). Of the 7 identified antigens, 5 antigens
had no cross-immunoreactivity in adsorbed control sera from healthy
subjects. These 5 included BcfD, GrxC, SapB, T3663 and T3689.
Antigens identified in this study are potential targets for drug
and vaccine development and may be utilized as diagnostic
agents.
Salmonella enterica serovar Typhi, in vivo induced antigen
technology (IVIAT), virulence
Typhoid fever, a serious public health problem in de-veloping
countries[1], is a bacterial illness caused by Salmonella enterica
serovar Typhi. Typhoid symptoms are typically the sudden onset of
sustained fever, severe headache, loss of appetite, and either
constipation or mild diarrhea[2,3]. Better control of typhoid fever
is ur-gently needed because, as noted by Crump et al.[4], an
estimated 21 million cases of typhoid fever and 220000 annual
deaths occur worldwide. The incidence of dis-ease caused by
multidrug-resistant serovar Typhi organ-isms is increasing and this
has made treatment increas-ingly more difficult[2], increasing the
need for novel ap-proaches for the diagnosis, treatment and
prevention of typhoid fever to be developed.
However, because humans are the only known natural hosts for
serovar Typhi infection, pathogenicity studies of serovar Typhi are
difficult to perform. Relatively little is known about the specific
factors which may contrib-
ute to the ability of this organism to cause typhoid fever or
which facilitate its adaptation to human hosts[5,6]. Most research
on the pathogenesis of typhoid fever has been based on the
infection of mice with S. enterica se-rovar Typhimurium, which
causes a systemic infection that resembles typhoid fever in
humans[7]. However, there are many differences between these two
organisms; for example, serovar Typhimurium is a broad-host-range
pathogen and only causes gastroenteritis in humans[2]. Infection
with serovar Typhimurium induces apoptosis in mouse macrophages,
while infection with serovar Typhi causes less apoptosis in human
macrophages[8]. Consequently, there are limitations to the
application of results obtained with serovar Typhimurium to the un-
Received June 2, 2009; accepted July 21, 2009 doi:
10.1007/s11427-009-0127-z †Corresponding author (email:
[email protected]; [email protected]) Supported by the National
Natural Science Foundation of China (Grant No. 30500435)
Article
-
HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 |
no. 10 | 942-948 943
derstanding of human infection by serovar Typhi organ- isms. A
second method is to study pathogenesis using human and murine cell
lines, but these types of models are limited to single stages of
infection and are unable to mimic all of the complex and changing
environmental stimuli that occur at the sites of an infection in
the intact host.
During disease progression, pathogens adapt to a se-ries of
environments, and survival in any one niche would likely need the
expression of a distinct subset of virulence factors. Hence, genes
that be expressed spe-cifically or upregulated in vivo may be
critical factors in the disease process[9]. If the proteins encoded
by these genes are antigenic, they would stimulate the body to
produce antibodies, so immunogenic techniques could be used to
identify these antigens[10]. In the present study, we utilized in
vivo induced antigen technology (IVIAT), an immunogenic technique,
to identify serovar Typhi antigens expressed during infection.
Doing so circum-vented the limitation of animal models such that
the identified antigens may prove to be significant in the
virulence of organism pathogen.
1 Materials and methods
1.1 Strains, plasmids and media
S. enterica serovar Typhi Ty2 strain was obtained from the
National Center for Medical Culture Collections (Beijing, China).
Escherichia coli DH5α and BL21 (DE3) were used as the host strains
for recombinant plasmids. All bacterial strains were grown in
Luria- Bertani (LB) medium. Kanamycin (Kan) was added at the
concentration of 50 μg/mL when required.
1.2 Patient and control sera
Convalescent-phase sera were collected from patients who were
culture-confirmed for serovar Typhi. Only the sera from patients on
days 22 to 40 post-illness were used in this study. Sera samples
from four healthy sub-jects were used as negative control. All sera
were sup-plied by the 3rd Hospital of People’s Liberation Army
(Baoji, China) and stored at −70℃ until usage. This study was
approved by the local ethical committees.
1.3 Adsorption of sera
For more effective screening in future studies, three sera with
high-level antibody titers were collected and used in the following
experiments. Equal volumes of the three
sera (300 μL/each) were pooled and adsorbed exten- sively with
in vitro-grown serovar Typhi Ty2 organisms and with the expression
host strain E. coli BL21(DE3) containing the native pET-30
expression plasmid. The pooled sera were serially adsorbed against
whole cells, cell extracts and denatured cell extracts immobilized
onto nitrocellulose membranes (Millipore), as previ- ously
described[11,12]. To check the efficacy of each ad- sorption step,
a 10 μL aliquot of the serum was removed after each adsorption and
an indirect enzyme linked immunosorbent assay (ELISA) was performed
as previ- ously described[11]. The resultant adsorbed serum sample
was found by ELISA to retain no discernible reactivity, utilizing
the Ty2 strain lysates and was aliquoted and stored at –70℃ for
further use.
1.4 Construction of a genomic expression library of serovar
Typhi Ty2
We used pET-30a/b/c expression vectors, which allowed
appropriate expression of the insert DNA in one of three open
reading frames (ORFs) under the transcriptional control of the T7
phage promoter. The vector DNA was digested with restriction enzyme
BamHI, gel purified with a gel extraction kit (Watson, Shanghai),
and treated with shrimp alkaline phosphatase. Genomic DNA of
serovar Typhi Ty2 was partially digested with Sau3AI and subjected
to electrophoresis. A DNA fragment of 0.5—1.5 kb was cut and
purified using the gel extraction kit. A rational ratio of vector
DNA and insert fragments was ligated and electroporated into
competent E. coli DH5α. Transformants were spread on LB plates
con-taining kanamycin. After overnight incubation at 37℃, all
colonies on the plates were collected and recombi-nant plasmid DNA
was recovered and electroporated into E. coli BL21 (DE3).
1.5 Screening of IVI antigens of serovar Typhi Ty2
To find the antigens that were expressed in vivo, an ali-quot of
the expression library, which was constructed as above in the
expression host BL21 (DE3), was diluted and spread on LB plates
containing kanamycin to pro-duce about 400 colonies per plate.
These plates were incubated at 37℃ until the clones became pinpoint
sized. A sterile nitrocellulose membrane was then placed onto each
plate for 10 min to produce a replica, which was then placed onto
an LB plate containing kanamycin and isopropyl-β-D-thiogalactoside
(IPTG, 1 mmol/L), and incubated for 5 h at 37℃ to induce expression
of
-
944 HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52
| no. 10 | 942-948
genes in cloned inserts. The primary plates were also incubated
for 5 h at 37℃ and stored at 4℃ as the mas-ter plates. Each
membrane was removed and partially lysed by exposing them to
chloroform vapor for 15 min, followed by blocking with 10% nonfat
skim milk over-night at 4℃. After washing with PBS-T, each membrane
was reacted with adsorbed convalescent sera (1︰200 dilution) for 1
h at room temperature with mild agitation, then washed 3 times with
PBS-T. Clones reacting with antibody in adsorbed sera were detected
by using per- oxidase-conjugated goat anti-human Ig (Southern-
biotech) at a 1︰20000 dilution, and developed by using an ECL
chemiluminescence kit (Pierce). Reactive clones were then
identified by their positions on the master plate, and each
positive clone was purified and stored at −70℃ as a glycerol
stock.
To eliminate false positive clones in the primary screen, a
secondary screening was done by comparing them directly to the
reactivity of a control strain, E. coli BL21(DE3) containing the
pET-30 vector without an insert, in a whole-colony immunoblot
assay. Plasmids from persistent reactive clones were then purified
and the serovar Typhi DNA inserted into the vector was se- quenced.
A tertiary screening was carried out by cloning each of the entire
predicted ORFs that were generated by PCR amplification into 5′ Nde
I or Nco I (if the gene had Nde I sites) and 3′ Not I restriction
enzyme sites in the pET-30a vector, and then screened by the same
method as the secondary screening. The PCR primer sequences of the
predicted ORFs are shown in Table 1.
1.6 Screening antigens identified by IVIAT against sera from
subjects
To assess the degree of cross-immunoreactivity of anti- gens
identified by IVIAT, we screened reactive clones
Table 1 Oligonucleotide primers used for polymerase chain
reaction (PCR) amplification of the fifteen genes a)
Gene Primer sequence
Pf1: 5′ cgcgCATATGaaaatacctcttttatttgctc 3′ bcfD
Pr1: 5′ cggcGCGGCCGCttagtcaaagtccactcgc 3′
Pf2: 5′ cgcgCATATGcaagaaattatgcaatttgttg 3′ t3816
Pr2: 5′ cggcGCGGCCGCtcacttaccgcgcacca 3′
Pf3: 5′ cgcgCATATGgccaatattgaaatctacacca 3′ grxC
Pr3: 5′ cggcGCGGCCGCttaacgcaacagcggatcc 3′
Pf4: 5′ cgcgCATATGaaaattatttccgttagacagc 3′ t1497
Pr4: 5′ cggcGCGGCCGCttattcaaattgccatgccag 3′
Pf5: 5′ cgcgCCATGGccatgattatcttcaccctg 3′ sapB
Pr5: 5′ cggcGCGGCCGCttatcgtaaggcataccatt 3′
Pf6: 5′ cgcgCCATGG ttatggcaacccggcaca 3′ t3663
Pr6: 5′ cggcGCGGCCGC ctacggccctggctcaa 3′
Pf7: 5′ cgcgCATATGaaaaaacgctcccttttgct 3′ t3689
Pr7: 5′ cggcGCGGCCGCtcaaaagcgatactcacc 3′
Pf8: 5′ cgcgCATATGacccttcaacatacccgac 3′ t0309
Pr8: 5′ cggcGCGGCCGC ctatttagcggatagcgc 3′
Pf9: 5′ cgcgCATATG gtttcatcatccacaaccgt 3′ cysZ
Pr9: 5′ cggcGCGGCCGC ttatttccataacgcgtgttt 3′
Pf10: 5′ cgcgCATATG atgcaggatttgcgtctgat 3′ t0429
Pr10: 5′ cggcGCGGCCGCtcaggcgttagcgtccat 3′
Pf11: 5′ cgcgCCATGGacaaagcgcattaataaagaca 3′ t3664
Pr11: 5′ cggcGCGGCCGCttacagacgtgaccaggc 3′
Pf12: 5′ cgcgCCATGGctatgtctacaacaacgttaa 3′ t3467
Pr12: 5′cggcGCGGCCGCtcaggcttcctcccgttt 3′
Pf13: 5′ cgcgCATATGatgacaaatctaaaaaagcgcgaa3′ t0769
Pr13: 5′ cgcgGCGGCCGCttaatacgccgctttattaacaaac 3′
Pf14: 5′ cgcgCATATGatggcggttgaagttaaatacgta3′ t0995
Pr14: 5′ cgcgGCGGCCGCtcaggcggcttgctttttcgtt 3′
Pf15: 5′ cgcgCATATGatgagtttacgacaaaaaacgatc 3′ t0770
Pr15: 5′ cgcgGCGGCCGCtcatccgacacgtaataacttttt 3′
a) Restriction sites in each primer are underlined.
Table 2 S.enterica serovar Typhi strain Ty2 antigens identified
by IVIAT
Gene designation in S. enterica serovar Typhi strain Ty2 genome
sequence Name of encoded protein product Function
t0025 BcfD fimbrial structural subunit
t3816 rhodanese-related sulfurtransferase
t3817 GrxC glutaredoxin and related proteins
t1497 outer membrane receptor proteins, mostly Fe transport
t1598 SapB ABC-type transport systems, permease components
t3663 ABC-type uncharacterized transport system
t3689 hypothetical protein
-
HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 |
no. 10 | 942-948 945
for immunoreactivity against pooled sera from four healthy
subjects. Prior to screening, the pooled control sera were also
adsorbed with in vitro-grown E. coli BL21(DE3) containing the
pET-30a vector without an insert to reduce background reactivity
against the host bacteria used in the whole-colony immunoblot
assay.
2 Results
2.1 Construction and analysis of the expression li-brary
A serovar Typhi Ty2 DNA fragment at a length of 0.5—1.5 kb was
obtained by partially digesting Ty2 ge- nomic DNA with Sau3AI
(Figure 1). It was recovered and ligated with prepaired vector
pET-30 a/b/c and elec- troporated into host stains, thereby
obtaining a genomic expression library. To check for the presence
of inserts, the plasmid DNA from 10 randomly selected clones of the
library was purified and digested with Kpn I and Hind III and then
subjected to electrophoresis. The re-sults showed all these
randomly selected clones con-tained DNA inserts (Figure 2).
2.2 Screening of the expression library for positive clones
The adsorbed convalescent sera were used to screen the
Figure 1 Partially digested Ty2 genomic DNA with Sau 3AI. M: DNA
marker.
Figure 2 Restriction enzyme analysis of expression library with
Kpn I and Hind . Ⅲ Lane 1: Negative controle plasmid; Lanes 2-11:
ten ran-domly selected recombinant plasmids; M: DNA marker.
expression libraries for positive clones. Approximately 30000
clones of the serovar Typhi Ty2 expression li- brary were screened
in the first screen, and 23 immuno- reactive clones were identified
(one positive clone is shown in Figure 3A as an example). In
secondary screening, eight clones out of the 23 immunoreactive
clones were found to be persistently reactive with ad- sorbed sera
compared to the negative control, E. coli BL21 (DE3) containing the
native pET-30 vector with- out an insert.
Figure 3 Screening positive clones. A, One of the reactive
clones (indi-cated by the black arrow) identified in the first
screen; B, seven reactive clones identified in the tertiary screen.
Negative control: E. coli BL21 (DE3) containing the pET-30a without
an insert.
2.3 Identification of IVI antigens
Insert Ty2 DNA sequences in the 8 persistently reactive clones
were sequenced (TaKaRa), and 15 ORFs were revealed in the 8 clones
by BLAST (http://www.ncbi. nlm.nih.gov/BLAST/). To confirm which
ORF encoded the IVI antigen, all 15 ORFs full length sequences were
respectively cloned into pET-30a vector and screened with adsorbed
convalescent sera in a wholecolony immunoblot assay. Seven ORFs
were confirmed to have positive immunoreactivity against the sera
(Figure 3B). The proteins encoded by the seven indentified ORFs are
shown in Table 2. These proteins included BcfD (a fim-brial
structural subunit), GrxC (a glutare-doxin 3), SapB (an ABC-type
transport systems), T3663 (an ABC-type uncharacterized transport
system), T3816 (a putative rhodanese-related sulfurtransferase),
T1497 (a probable TonB-dependent receptor, mostly involved in Fe
trans-port) and T3689 (unknown function).
2.4 Immunoreactivities of antigens identified by IVIAT to sera
from volunteers
The degree of the seven antigens identified by IVIAT against
adsorbed sera from volunteers was shown in a whole-colony
immunoblot assay in Figure 4. Five (BcfD, GrxC, Sap, T3689, T3663)
had no detectable degree of
-
946 HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52
| no. 10 | 942-948
Figure 4 Immunoreactivities of antigens identified by IVIAT
against sera from volunteers in a whole-colony immunoblot assay.
1a: T3816; 3c: T1497; 1b: GrxC; 2a: BcfD; 2c: T3689; 3a: SapB; 3b:
T3663; 1c and 2b: plasmids pET-30a.
immunoreactivity with adsorbed volunteers sera. This result
suggests that these five antigens have no cross- immunoreactivity
to sera from healthy individuals.
3 Discussion
Microbial pathogenicity is defined as the ability of the
pathogen to enter into, propagate in, and persist at sites in the
host that are inaccessible to commensal species[13]. Many virulence
determinants that contribute to this ability share a unique
phenotype in that they are induced within the host[14,15]. These
IVI genes were shown to be poorly expressed in laboratory media but
exhibited relatively elevated levels of expression in host tissues
or in cultured cells[13]. It is not anticipated that all IVI genes
will have essential roles in virulence. However, their in vivo
induction suggests that they contribute to growth in restricted
host tissues and thus enhance pathogenicity.
Several in vivo technologies have been developed in recent years
to identify IVI genes, including in vivo ex- pression technology
(IVET)[14,16], signature-tagged mutagenesis (STM)[17] and
differential fluorescence in- duction (DFI)[18]. All of these
technologies have certain limitations. Their common drawback is
that they depend on the use of animal models of infection. Animal
models are not available for many pathogens and even in a case
where an animal model is available, it might not closely
approximate the conditions in humans[10]. The key ad- vantage of
IVIAT is its independence of animal models, which makes IVIAT the
optimal method for study of S. erterica serovar Typhi, as humans
are its only host[3]. Furthermore, the virulence factors which are
identified by other technologies that utilize animal or cell
culture models must be validated in the context of the actual
human infection process. The pooled serum from con- valescent
phase patients allows a direct identification of antigens produced
in the patients during different stages of infection[19].
Although Harris et al.[20] identified 35 immunogenic bacterial
antigens by using IVIAT in S. enterica serovar Typhi CT18, we
identified seven new antigens which were dissimilar from those
previously identified. Of the 7 antigens, five had no
cross-immunoreactivity against adsorbed control sera. These five
were encoded by genes grxC, bcfD, sapB, t3663 and t3689.
The identified gene grxC encodes glutaredoxin 3, which is a
constituent of an important redox system, the
glutathione/glutaredoxin system[21]. Several studies have indicated
that production of oxidative and nitrosative substances by
phagocytes is a main effector in the innate defense against
infection of murine primary macrophages
and macrophage-like cells in culture, as well as in living mice,
by S. enterica serovar Typhimurium[22,23]. The re- dox-shuffling
pathways that operate in salmonellae may provide protection against
oxidative stress[23]. Consider- ing the important role of
glutathione/glutare- doxin sys- tem in the in vivo survival of
serovar Typhi, the induced expression of grxC is not
unexpected.
The gene t0025 encodes a subunit of fimbriae BcfD. Fimbriae and
other surface molecules mediate adherence
via specific receptors on host cell surfaces. Adhesion to host
cells and mucosal surfaces is often considered to be
an essential step during the course of infection, as it al- lows
bacteria to initiate colonization[3]. The gene bcfD belongs to a
fimbrae operon Bcf, which consists of bcf ABCDEFG[24]. This operon
exists in all Salmonella se- rovars. Huang et al.[25] found that
bcfA of S. enterica serovar Typhimurium, which encodes subunits of
fim- briae, is involved in bacterial adhesion and colonization
during infection in pigs. Humphries et al.[26] found that injection
of static LB broth cultures of S. enterica se- rovar Typhimurium
into bovine ligated ileal loops re- sulted in the expression of
BcfA. Our data are consistent with the results of these studies, as
both bcfA and bcfD genes are in the same operon, the expression of
bcfA and bcfD could be coincident.
Both sapB and t3663 encode ABC-transporters. ABC- transporters
in bacteria are usually involved in control- ling influx and efflux
of small molecules through meta- bolic pathways in response to
environmental changes[27].
-
HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52 |
no. 10 | 942-948 947
Multidrug resistance[28,29] and pathogenicity[30] may also be
attributed to ABC-transporters. It is widely accepted that
over-expression of ABC-type multidrug transporters efficiently
evades the pressure of drugs and enhances the invasive ability of
pathogens[28,29,31].
IVIAT was demonstrated to be an effective method for screening
in vivo induced antigens during infection with pathogens which have
no animal model for study-
ing. Because IVI antigens are expressed in response to specific
cues during infection and might help pathogens adapt to or counter
hostile in vivo environments, those the antigens identified in this
study are potential targets for drug and vaccine development. Also,
those antigens which had no immunoreactivity against adsorbed
control sera from healthy subjects may be utilized as diagnostic
agents of typhoid fever.
1 Kumar S, Balakrishna K, Singh G P, et al. Rapid detection of
Sal-
monella typhi in foods by combination of immunomagnetic
separa-
tion and polymerase chain reaction. World J Micro, 2005, 21:
625—
628
2 Boyle E C, Bishop J L, Grassl G A, et al. Salmonella: from
patho-
genesis to therapeutics. J Bacteriol, 2007, 189: 1489—1495
3 House D, Bishop A, Parry C, et al. Typhoid fever: pathogenesis
and
disease. Curr Opin Infect Dis, 2001, 14: 573—578
4 Crump J A, Luby S P, Mintz E D. The global burden of typhoid
fever.
Bull WHO, 2004, 82: 346—353
5 Faucher S P, Curtiss R, Daigle F. Selective capture of
Salmonella
enterica serovar typhi genes expressed in macrophages that are
absent
from the Salmonella enterica serovar Typhimurium genome.
Infect
Immun, 2005, 73: 5217—5221
6 Chanana V, Majumdar S, Ray P, et al. Coordinated expression
and
immunogenicity of an outer membrane protein from Salmonella
en-
terica serovar Typhi under iron limitation, oxidative stress and
an-
aerobic conditions. J Biomed Sci, 2006, 13: 303—312
7 Chander H, Majumdar S, Sapru S, et al. Reactivity of typhoid
patients
sera with stress induced 55 kDa phenotype in Salmonella
enterica
serovar Typhi. Mol Bioch, 2004, 267: 75—82
8 Schwan W R, Huang X Z, Hu L, et al. Differential bacterial
survival,
replication, and apoptosis-inducing ability of Salmonella
Serovars
within human and murine macrophages. Infect Immun, 2000, 68:
1005—1013
9 Rediers H, Rainey P B, Vanderleyden J, et al. Unraveling the
secret
lives of bacteria: use of in vivo expression technology and
differential
fluorescence induction promoter traps as tools for exploring
niche-specific gene expression. Microbiol Mol Biol Rev, 2005,
69:
217—261
10 Handfield M, Brady L J, Progulske-Fox A. IVIAT: a novel
method to
identify microbial genes expressed specifically during human
infec-
tions. Trends Microbiol, 2000, 8: 336—339
11 Hang L, John M, Asaduzzaman M. et al. Use of in vivo-induced
an-
tigen technology (IVIAT) to identify genes uniquely expressed
during
human infection with Vibrio cholerae. Proc Natl Acad Sci USA,
2003,
100: 8508—8513
12 Rollins S M, Peppercorn A, Hang L, et al. In vivo induced
antigen
technology (IVIAT). Cell Microbiol, 2005, 7: 1—9
13 Heithoff D M, Conner C P, Hanna P C, et al. Bacterial
infection as
assessed by in vivo gene expression. Proc Natl Acad Sci USA,
1997,
94: 934—939
14 Mahan M J, Slauch J M, Mekalanos J J. Selection of bacterial
viru-
lence genes that are specifically induced in host tissues.
Science, 1993,
259: 686—688
15 Mahan M J, Tobias J W, Slauch J M, et al. Antibiotic-based
selection
for bacterial genes that are specifically induced during
infection of a
host. Proc Natl Acad Sci USA, 1995, 92: 669—673
16 Angelichio M J, Camilli A. In vivo expression technology.
Infect
Immun, 2002, 70: 6518—6523
17 Hensel M, Shea J E, Gleeson C, et al. Simultaneous
identification of
bacterial virulence genes by negative selection. Science, 1995,
269:
400—403
18 Valdivia R H, Falkow S. Fluorescence-based isolation of
bacterial
genes expressed within host cells. Science, 1997, 277:
2007—2011
19 Kim Y R, Lee S E, Kim C M, et al. Characterization and
pathogenic
significance of Vibrio vulnificus antigens preferentially
expressed in
septicemic patients. Infect Immun, 2003, 71: 5461—5471
20 Harris J B, Baresch-Bernal A, Rollins S M, et al.
Identification of in
vivo-induced bacterial protein antigens during human infection
with
Salmonella enterica Serovar Typhi. Infect Immun, 2006, 74:
5161—
5168
21 Aslund F, Beckwith J. The thioredoxin superfamily:
redundancy,
specificity, and gray-area genomics. J Bacteriol, 1999, 181:
1375—
1379
22 Bjur E, Eriksson Y S, Aslund F, et al. Thioredoxin 1 promotes
intra-
cellular replication and virulence of Salmonella enterica
Serovar
Typhimurium. Infect Immun, 2006, 74: 5140—5151
23 Shiloh M U, Nathan C F. Reactive nitrogen intermediates and
the
pathogenesis of Salmonella and mycobacteria. Curr Opin
Microbiol,
2000, 3: 35—42
24 Townsend S M, Kramer N E, Edwards R, et al. Salmonella
enterica
Serovar Typhi possesses a unique repertoire of fimbrial gene
se-
quences. Infect Immun, 2001, 69: 2894—2901
25 Huang Y, Leming C L, Suyemoto M, et al. Genome-wide screen
of
Salmonella genes expressed during infection in pigs, using in
vivo
-
948 HU Y, et al. Sci China Ser C-Life Sci | Oct. 2009 | vol. 52
| no. 10 | 942-948
expression technology. Appl Environ Microbiol, 2007, 73:
7522—
7530
26 Humphries A D, Raffatellu M, Winter S, et al. The use of flow
cy-
tometry to detect expression of subunits encoded by 11
Salmonella
enterica serotype Typhimurium fimbrial operons. Mol
Microbiol,
2003, 48: 1357—1376
27 Yazaki K. ABC transporters involved in the transport of plant
sec-
ondary metabolites. FEBS Lett, 2006, 580: 1183—1191
28 Jones P M, George A M. Multidrug resistance in parasites:
ABC
transporters, P-glycoproteins and molecular modelling. Int J
Parasitol,
2005, 35: 555—566
29 Sipos G, Kuchler K. Fungal ATP-binding cassette (ABC)
transporters
in drug resistance & detoxification. Curr Drug Targets,
2006, 7:
471—481
30 Brown J S, Gilliland S M, Holden D W. A Streptococcus
pneumoniae
pathogenicity island encoding an ABC transporter involved in
iron
uptake and virulence. Mol Microbiol, 2001, 40: 572—585
31 Wolfger H, Mamnun Y M, Kuchler K. Fungal ABC proteins:
Plei-
otropic drug resistance, stress response and cellular
detoxification.
Res Microbiol, 2001, 152: 375—389
1 Materials and methods1.1 Strains, plasmids and media1.2
Patient and control sera1.3 Adsorption of sera1.4 Construction of a
genomic expression library of serovar Typhi Ty21.5 Screening of IVI
antigens of serovar Typhi Ty21.6 Screening antigens identified by
IVIAT against sera from subjects
2 Results2.1 Construction and analysis of the expression
library2.2 Screening of the expression library for positive
clones2.3 Identification of IVI antigens2.4 Immunoreactivities of
antigens identified by IVIAT to sera from volunteers
3 Discussion