EFFECT OF TOBACCO EXTRACT IN INDUCING OXIDATIVE STRESS IN LUNG PATHOPHYSIOLOGY AN IN VITRO ANALYSIS A THESIS SUBMITTED BY SHEETHAL SIVARAMAN NAIR IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF PHILOSOPHY SREE CHITRA TIRUNAL INSTITUTE OF MEDICAL SCIENCE AND TECHNOLOGY TRIVANDRUM- 695 011
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
EFFECT OF TOBACCO EXTRACT IN INDUCING OXIDATIVE STRESS IN LUNG PATHOPHYSIOLOGY AN IN VITRO
ANALYSIS
A THESIS SUBMITTED
BY
SHEETHAL SIVARAMAN NAIR
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
MASTER OF PHILOSOPHY
SREE CHITRA TIRUNAL INSTITUTE OF MEDICAL SCIENCE AND TECHNOLOGY
TRIVANDRUM- 695 011
DECLARATION
I, Sheethal Sivaraman Nair, hereby declare that I personally carried out the
work depicted in the thesis entitled "Effect Of Tobacco Extract In Inducing
Oxidative Stress In Lung Pathophysiology An In Vitro Analysis" under
the direct supervision of Dr. A Maya Nandkumar, Scientist F & Head,
Division of Microbiology, Biomedical Technology Wing, Sree Chitra Tirunal
Institute for Medical Science and Technology, Trivandrum, Kerala, India.
External help sought are acknowledged.
~-7 Sheethal Sivaraman Nair
SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCE AND
TECHNOLOGY
THIRUVANANTHAPURAM- 695 011, INDIA
(An institute of National Importance under Govt. of India)
CERTIFICATE
This is to certify that the dissertation entitled "Effect of tobacco extract in
inducing oxidative stress in lung pathophysiology an in vitro analysis"
submitted by Sheethal Siva"""an Nair in partial fulfilment for the Degree of
Master of Philosophy in Biomedical Technology to be awarded by this
institute. The entire work was done by her under my supervision and guidance
at Division of Microbiology, Technology Wing, Sree Chitra Tirunallnstitute
for Medical Science and Technofogy (SCTIMST), Thiruvananthapuram
695012.
Place: Thiruvananthapuram
Date: ;_G ( '1 /eft d) 3 - Dr. A Maya Nandkumar
EFFECT OF TOBACCO EXTRACT IN INDUCING OXIDATIVE STRESS IN LUNG PATHOPHYSIOLOGY AN IN VITRO ANALYSIS
Submitted by
Sheethal Sivaraman Nair
For
Master of Philosophy
of
SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCE AND
TECHNOLOGY, TRIVANDRUM- 695 011
Evaluated and approved
By
Signature
1J-? II· M fJ Y/1 N rJ N.])/<. u M If)-/:(_
j~\si -F·
Name of Supervisor
~ Signature
u:-;.v.~·l~ ~~'i( --G ·
Examiner's name and Designation ·
EFFECT OF TOBACCO EXTRACT IN INDUCING OXIDATIVE STRESS IN LUNG PATHOPHYSIOLOGY AN IN VITRO ANALYSIS
Submitted by
Sheethal Sivaraman Nair
For
Master of Philosophy
of
SREE CHITRA TIRUNAL INSTITUTE FOR MEDICAL SCIENCE AND
TECHNOLOGY, TRIVANDRUM- 695 011
Evaluated and approved
Signature
~ II· fL1 AYA NANJ)/><.UM f)-1(
J c,WvJ.·si -F ·
Name of Supervisor
By
Signature
u:t.v.~·l~ ~~···-tr --~ .
Examiner's name and Designation
Acknowledgement
The presence of Almighty has made me strive towards success in my life. I am ever
grateful to HIM. I would like to thank an eminent group of people who have helped
me to bring this project to a successful completion.
I consider this as an opportunity to express my gratitude to all the dignitaries who
have been involved directly or indirectly with the successful completion of this
dissertation.
I would like to express my profound gratitude to my guide and mentor, Dr. A Maya
Nandkumar, Scientist F & Head, Division of Microbiology, BMT wing, Sree
Chitra Tirunal Institute of Medical Science and Technology, Poojappura,
Thiruvananthapuram for her valuable guidance, timely motivation, expert criticism
and insights which were instrumental in the successful completion of the project. Her
valuable inputs from tt1e initial to the final phase enabled me to develop an
understanding of the subject of the project work.
I am thankful to the Director, Registrar, Head, BMT wing and Deputy Registrar,
Sree Chitra Tirunal Institute of Medical Science and Technology, Poojappura,
Thiruvananthapuram for granting me permission to pursue this project and
providing all the facilities required for my work.
I wish to take this as an opportunity to thank Dr. Lissy. K. Krishnan (SIC,
Thrombosis Research Unit), Course coordinator, M.Phil Biomedical
Technology for coming up with such a wonderful course.
I am deeply indebted to the members of Division of Microbiology, Mr. Pradeepkumar
SS, Mr. Gireesh SP, Ms. Ashna U, Ms. Ancymol GR, Ms. Simina Jaseer and Ms.
Lekshmi for their helping hands without the help of whom I would not have
accomplished my project.
I acknowledge the financial support from DBT for carrying out my project work.
Finally, I wish to record my deep sense of gratitude and obligation to my parents as
well as my friends/classmates for their help, constant and affectionate
encouragement and blessings.
Sheethal Sivaraman Nair
GAPDH
HDAC
H0"-1
IKK
NO
List of Abbreviations
Acute respiratory distress syndrome
Bovine lipid extract surfactant
Clara cell secretory protein
Dichlorofluorescein
Deoxyribonucleicacid
Glyceraldehyde-3-phosphate dehydrogenase
Histone deacetylase
Heme Oxygenase-1
1-KB kinase
Nitric oxide
OS Oxidative stress
RNA Ribonucleic acid
SP-0 Surfactant protein - D
WHO World Health Organization
Table of Contents
Section No. Title/Subtitle Page No.
List of figures
--list of tables
Synopsis 1
CHAPTER 1: INTRODUCTION
1.1 Background 2
1.2 Review of Literature 3
1.2.1 Pulmonary system 4
1.2.2 Pulmonary alveoli 6
1.2.3 Alveolar cell types 7
1.2.4 Gap junction proteins 9
1.2.5 Oxidative stress 9
1.2.6 Free radicals and reactive oxygen species 11
1.2.7 Endogenous and exogenous sources of ROS 12
1.2.8 A549 as model system 12
---------- --~-~2.9 Expression of inflammatory genes 13
- -1 ~ Expression of pulmonary surfactant proteins 15 -'-•-'
1.3.1 COPD and emphysema 16
1.3 Hypodissertation 18
1.4 Research objectives 19
2 CHAPTER II: MATERIALS AND METHODS
~---·-·---~~----~------~·-
, r "
I 2.1 Materials 20
2.2 Maintenance of A549 cell line 20
2.3 Exposure of A549 cells to tobacco extract 21
2.4 Cell Proliferation assay using Trypan blue 21
exclusion method
2.5 Measurement of intracellular ROS and assay for 22
oxidative stress
2.6 Study of the effect of tobacco extract on inducing 22
oxidative stress by Real Time PCR
2.6.1 RNA extraction& Reverse transcription with real
time polymerase chain reaction 23
3 CHAPTER 3: RESULTS AND DISCUSSION
3.1 Morphological analysis of A549 27
3.2 Oxidative stress assay 28
3.3 Effect of tobacco extract on inducing expression of oxidative stress genes in alveolar epithelial cells 30
4 CHAPTER 4: SUMMARY AND CONCLUSION
Summary 33
Conclusion 33
REFERENCES 34
APPENDIX -1 39
APPENDIX-2 41
list of Figures
Fig No. Caption Page No.
1.1 Diagram showing the anatomy of pulmonary system
6 and a cross-section of alveoli
1.2 Schematic representation of pathogenesis of
17 emphysema
3.1 Phase contrast microscopy of A549 monolayer in
27 TCPS dishes
3.2 Fluorescent microscopy of stained with Hoechst
33342 for nuclear DNA 28
3.3 Concentration-response graph of percentage increase
of DCF fluorescence in A549 after exposure to H202 29
--Concentration-response graph of percentage increase
3.4 of DCF fluorescence in A549 after exposure to 29
tobacco extract
3.5 Relative gene expression ofH0-1 30
--~~ - --
3.6 Relative gene expression of IL-8
31
List of Tables
Table No. Caption Page No.
Constituents of reaction mixture for eDNA 2.1
Synthesis 24
2.2 PCR conditions for eDNA synthesis 24
2.3 PCR primer sequences 25
Constituents of reaction mixture for eDNA 2.4
amplification 25
2.5 PCR conditions for eDNA amplification 26
~ •
Synopsis
Tobacco smoking has been implicated as a source of OS in the pathogenesis of lung diseases.
Due to large surface area, lungs are highly vulnerable to external toxic substances making it a
major site of ROS production and resulting in alveolar epithelial injury. Tobacco smoke contains
oxidants which directly damages lungs resulting in diseases such as asthma and chronic
obstructive pulmonary disorder. Inflammatory mediators such as hemeoxygenase and
interleukins are recruited to the site of injury which in turn releases more cytotoxic mediators
ultimately leading to significant injury to the alveolar-capillary membrane and respiratory
failure. Oxidative modifications occur to various cellular components such as cell membrane,
cytosol, nuclear lipids and proteins which are potential targets of oxidants in acute lung
diseases. Significant oxidative stress response is observed in A549 human lung epithelial cells
making it a suitable candidate for toxicological analysis.
The present study aims at evaluating the role of tobacco extract as a candidate chemical
stimulant in inducing oxidative stress response in A549 lung epithelial cells at various pre
specified time points. Understanding gene expression changes as well as measurement of
intracellular ROS levels forms the analysis tools for this study.
The human lung epithelial cell line, A549 was exposed to tobacco extract at concentrations of
0.1 J..Lg/ml, 1 J..Lg/ml, 10 J..Lg/ml, 100 J..Lg/ml. The oxidative stress was measured using DCFDA
method at various time points such as 10 minutes, 30 minutes, 1 hour, 4 hours and 24 hours.
Total RNA isolation was also performed and complementary DNA was synthesized in order to
carry out qRT-PCR analysis of oxidative stress genes, H0-1 and IL-8 after 1 hour, 4 hour and 24
hours of A549 exposure to the specified concentrations of tobacco extract.
In conclusion, 100 J..Lg/ml tobacco extract was found to have a pronounced effect in cultured
A549 lung epithelial cells with a high oxidative stress in a concentration- and time-dependent
fashion. Significant alterations in the expression of oxidative stress genes were found at 100
J..Lg/ml concentration of tobacco extract.
1
Chapter I
Introduction
1.1 Background
Hundreds of millions of people worldwide suffer from preventable chronic respiratory
diseases. Lung diseases are the third most frequent cause of death in Europe and USA.
According to WHO statistics, nine million people die annually as a result of lung diseases.
Globalization in India has led to an emergence of occupational respiratory diseases. Latest
WHO statistics show that India has an estimated 15-20 million asthmatics. After cardio-
vascular diseases and cancers, chronic respiratory disease is the major cause for mortality in
both the sexes in India. Chronic obstructive pulmonary disease (COPD) is one such chronic
respiratory disease that is the main cause of chronic morbidity and mortality worldwide. It
is a major public health problem in subjects over 40 years of age and remains a challenge
for the future. According to recent WHO statistics, it is projected to rank seventh among the
deadliest diseases in 2030 and is termed as a 'worldwide burden of disease'. Due to
significant rise in morbidity and mortality from COPD, it will be the most dramatic in Asian
and African countries over next two decades primarily due to progressive increase in the
prevalence of smoking.
The lung is essentially a respiratory organ which is constructed to carry out the cardinal
function of exchange of gases between inhaled air and blood. It forms the primary line of
defense against any insult since there is a very thin barrier between the inspired air and
blood. It is continuously exposed to the environment leading to environmental injury
persists throughout an individual's lifetime. Oxidative stress is a deleterious process that is
widely known to lead to lung damage and consequently various disease states. The lung is
continually exposed to high levels of oxygen due to its large surface area and blood supply
making it a major site of ROS production. ROS has a dual role which may be both
deleterious and beneficial. ROS are products of normal cellular metabolism and under
physiological conditions, participate in maintenance of cellular 'redox' homeostasis.
Overproduction of ROS results in oxidative stress. Persistent inhalation of the invading
2
pathogens or toxic agents may result in overwhelming production of ROS. Oxidants initiate
a number of pathological processes including inflammation of the airways, which may
contribute to the pathogenesis and/or exacerbation of airway disease. During inflammation,
enhanced ROS production may induce recurring DNA damage, inhibition of apoptosis, and
activation of proto-oncogenes by initiating signal transduction pathways. Therefore, it is
conceivable that chronic inflammation-induced production of ROS in the lung may
predispose individuals to lung diseases.
Various pathogens, drugs, chemicals and pollutants are the major cause of most of the
prevalent lung diseases. Lung epithelial cells form the first line of contact between the lung
and inspired air, which contain many pollutants and pathogens. An understanding of events
within the epithelial membrane or inside the epithelial cells will make it possible to
delineate the degenerative changes in case of an inflammatory injury. In this context, it
becomes essential to realize that in the in vivo situation a body mounts a immunologic
response which is well orchestrated by epithelial cells, alveolar macrophages and
leukocytes. In vivo scenario reveals that there is a close association between the various cell
types. The oxidants in cigarette smoke is known to possess cytotoxic effects on the
continuous epithelial surface area of all internal organs which is composed of several
phenotypically and functionally distinct types of epithelia separated by vast distances.
1.2 Review of literature
Any kind of injury to the tissue triggers inflammation, a complex pathophysiological process
attempting to attenuate injury thereby inducing body's reparative processes. However,
exaggerated inflammatory responses may exacerbate tissue damage and result in excessive
scarring compromising organ function. Injury to the lung epithelium can be caused by
bacterial or viral infections, inflammation, allergic reactions (asthma), exposure to
xenobiotics (e.g., cigarette smoke), physical trauma (mechanical ventilation), cancer or
pathology of unknown origin (idiopathic fibrosis) [Crosby and Waters, 2010]. Epithelial
changes are a major characteristic of airway remodeling in chronic inflammation and
epithelial cells have been shown to regulate the inflammatory changes in the lung [Rutgers
SR et a/, 2001]. Air pollution and tobacco smoke contain oxidants that when inhaled can
3
cause damage to the lungs and contribute to diseases such as asthma and chronic
obstructive pulmonary disease (COPD). Devastating impact of tobacco on human health is
well established. Emerging evidence suggests that cigarette smoking distorts lung immune
homeostasis, compromising respiratory host defense. Inhaled cigarette smoke induces
oxidative stress in the epithelium of airways. Oxidants in cigarette smoke may play a major
part in cigarette smoke induced lung injury and have been implicated in the pathogenesis of
emphysema [Heffner and Repine, 1989].
1.2.1 Pulmonary system
The pulmonary system which encompasses not only lungs but the conducting airways,
nasal cavity, pharynx, larynx, trachea, bronchi, bronchioles and alveoli is probably the most
complex system in the body. The human lungs are a pair of large, spongy organs optimized
for gas exchange between our blood and the air. The purpose of lungs is to provide vital
oxygen while removing carbon dioxide before it can reach hazardous levels. The chest
contains two lungs located in two cavities on either side of the heart. Though similar in
appearance, the two are not identical. Each lung is made up of sections known as lobes with
three lobes on the right and two on the left. The lobes are further divided into segments
and then into lobules that are hexagonal divisions of the lungs that are the smallest
subdivision visible to the naked eye. The connective tissue that divides lobules is often
blackened in smokers.
Each lobe is surrounded by a pleural cavity, which consists of two pleurae. The
parietal pleura lie against the rib cage, and the visceral pleura lies on the surface of the
lungs. In between the pleura is intra-pleural space fluid. The pleural cavity helps to lubricate
the lungs as well as provide the surface tension necessary to keep the lung surface in
contact with the rib cage.
In order to explain the anatomy of the lungs, it is necessary to discuss the passage of
air through the mouth to the alveoli. The trachea (windpipe) conducts inhaled air into the
lungs through its tubular branches, called bronchi. The bronchi then divide into smaller and
smaller branches (bronchioles) finally forming microscopic structures [Wienbergerl 1988].
4
The bronchioles eventually end in clusters of microscopic air sacs called alveoli.
Human lungs contain approximately 300 million alveoli, which gives the lungs a greater
internal than external surface area [Snell, 2007]. Alveoli are the basic anatomical units of
gas exchange in lungs. Carbon dioxide (a waste product of metabolism) rich blood is
pumped from the rest of the body into alveolar blood vessels via diffusion where it releases
its carbon dioxide and absorbs oxygen into the blood. Blood vessels from the pulmonary
arterial system accompany the bronchi and bronchioles. These blood vessels also branch
into smaller and smaller units ending with capillaries, which are in direct contact with each
alveolus. Gas exchange occurs through this alveolar-capillary membrane as oxygen moves
into and carbon dioxide moves out of the bloodstream. Although 300 million alveoli found
in the lungs are microscopic, they have a total surface area equivalent to the size of a tennis
court. Between the alveoli is a thin layer of cells called the interstitium, which contains
blood vessels and cells supporting the alveoli.
The other important functions of lungs include:
• Alter the pH of blood by facilitating alterations in the partial pressure of carbon dioxide
• Filter out small blood clots formed in veins
• Influence the concentration of some biologic substances and drugs used in medicine in
blood
• Convert angiotensin I to angiotensin II by the action of angiotensin-converting enzyme
• May serve as a layer of soft, shock-absorbent protection for the heart, which the lungs
flank and nearly enclose
• Immunoglobulin-A is secreted in the bronchial secretion and protects against respiratory
infections
• Maintain sterility by producing mucus containing antimicrobial compounds. Mucus
contains glycoproteins, e.g. mucins, lactoferrin [Travis et a/, 1999], lysozyme,
lactoperoxidase
• Ciliary escalator action is an important defense system against air-borne infection. The
dust particles and bacteria in the inhaled air are caught in the mucous layer present at the
5
mucosal surface of respiratory passages and are moved up towards pharynx by the
rhythmic upward beating action of the cilia [Rada B, Leto TL, 2008]
• Provide airflow for the creation of vocal sounds
• Thermoregulation
Fig 1.1 Diagram showing the anatomy of pulmonary system and a cross-section of alveoli
1.2.2 Pulmonary alveoli
Alveoli are anatomical structures in the form of a hollow cavity and are the main sites of gas
exchange. The walls of alveoli are coated with a thin film of water and this creates a major
problem. Water molecules including those on the alveolar walls are more attracted to each
other than to air and this attraction creates a force called surface tension. This surface
tension increases as the water molecules come close together, which is what happens when
we exhale and our alveoli become smaller. Potentially, surface tension could cause the
alveoli to collapse and in addition, would make it more difficult to re expand the alveoli
during the next cycle of inhalation. Our alveoli do not collapse and inhalation is relatively
easy because the lungs produce a substance called surfactant that reduces surface tension.
Alveoli also have fibroblast cells in close proximity that functions in epithelial cell regulation,
6
maintaining branching, morphogenesis and cytodifferentiation in lung [Adamson IV et a/,
1988]. Lung epithelium consists of both type I and type II cells. Type I cells provide a thin
membrane for the exchange of gases and type II cells are multifunctional and the functions
include surfactant secretion, immune response and act as progenitors for the development
of type I alveolar epithelial cells [Adamson and Young,1996].
1.2.3 Alveolar cell types
With an area of approximately 70-100 m2, the alveoli of the human lung serve as a selective
barrier between the organism and its environment. In the normal lung this barrier is formed
by a layer of alveolar epithelium, which is characterized by type I (AT I) and type II (AT II)
pneumocytes.
The other major types of cells present in the lungs are:
• Fibroblasts
• Clara cells
• Endothelial cells
• Interstitial cells
• Alveolar macrophages
Type 1 pneumocytes responsible for gas exchange and type II pneumocytes which
secrete surfactants responsible for reducing the surface tension of alveoli of lungs. Type I cells
have a unique pattern of gene expression and have all the pumps and ion channels for trans
cellular sodium transport. The type II pneumocytes cover about 5% of alveolar surface area and
is important in maintaining normal lung function. It also acts as a progenitor of alveolar type I
cells that are damage during lung injury.
Type I cells are large, squamous in morphology with minimal cytoplasm and no lamellar
bodies. Type II cells are cuboidal in shape and located at the corners of alveoli. They possess
lamellar bodies, mitochondria, Golgi apparatus and rough endoplasmic reticulum [Ballard,
' 1986]. The heterocellular population is interconnected by tight junctions. Type I cells cover
more than 95% of alveolar surface whereas Type II cells cover less than 15% of the alveolar
surface. The primary function of type II cell is synthesis and secretion of pulmonary surfactant.
Surfactant is stored in bell shaped lamellar bodies until it is secreted by exocytosis [Bangham
7
and Horne, 1964]. They also have additional metabolic and immunological functions. Also type
II cells serve as progenitors for Type I cells. during normal lung development and during repair of
lung epithelium subsequent to injury.
Fibroblasts are the other major groups which are involved in overall maintenance of
pneumocytes through intercellular signaling. It is necessary to understand the modulation of
surfactant gene expression for the effective treatment of respiratory infections.
The induction of surfactant system is regulated by the interaction between two cell types
within the lungs: epithelial (type II pneumocytes) and mesenchymal cells (fibroblast) [Smith and
Fletcher, 1979]. The differentiation of type II cells is a key step in lung maturation and
surfactant production. Differentiation of type II pneumocytes is triggered by the adjacent
fibroblast.
Clara cells are a group of cells, sometimes called "non-ciliated bronchiolar secretory cells",
found in the bronchiolar epithelium of mammals and in the upper airways of some species such
as mice. Their secretory function is assumed from their ultrastructural appearance that usually
includes copious smooth endoplasmic reticulum, many apical mitochondria and scanty
secretory-like dense vesicles near the luminal membrane. An apical Cap of the cell usually
bulges into the airway lumen, and secretion may be by shedding this cap, or by diffusion
secretion or by merocrine secretion in individual granules. They do this by secreting a small
variety of products, including Clara cell secretory protein (CCSP).The chemical nature of the
secretion probably includes protein, glycoprotein and lipids. The secretion may contain
enzymes. Its function is presumably to determine the chemical and physical properties of the
lining of small airways, and it could behave as a kind of bronchiolar surfactant, limiting lung
collapse. They are also responsible for detoxifying harmful substances inhaled into the lungs.
Clara cells accomplish this with cytochrome P450 enzymes found in their smooth endoplasmic
reticulum. Clara cells also act as a stem cell and multiply and differentiate into ciliated cells to
regenerate the bronchiolar epithelium. Clara cells may be important in human disease, both by
giving rise to tumours and by taking part in metaplastic changes in bronchiolar disease
[Widdicombe JG, Pack RJ, 1982].
8
1.2.4 Gap junction proteins
Alveolar epithelial cells also express gap junction proteins (connexins) and establish
functional gap junction intercellular communication (GJIC) linking the cytoplasmic
compartments of adjacent cells. Connexins constitute a family of closely related integral
membrane proteins that assemble to form hexameric transmembrane hemichannels
(connexins). Connexins in adjacent cells interact in the intercellular compartment to form
conductive channels that allow regulated passage of electrical current, solutes, and small
molecules through axial transmembrane pores that mediate coordination of cellular activity [D.
Eugene Rannels, 2001]. Some of the major gap junction proteins are connexin 32, connexin 43
and connexin 46. Out of these connexin 43 is expressed ubiquitously and is normally seen in the
gap junctions between ATI and ATII cells. Connexin 32 is mainly expressed by ATII cells and
connexin 46 is expressed occasionally by the alveolar epithelial cells. With continuous sub
culturing connexin 32 expressions reduce, whereas connexin 43 and connexin 46 expression
increase [Abraham V eta/, 2001].These expressions show variations during an injury. Changes
in connexin expression in alveolar epithelial cells have been associated with developing or post
injury airways [Isakson BEet a/, 2003].
1.2.5 Oxidative stress
Oxidative stress is defined as the steady state level of oxidative damage in a particular cell,
tissue or organ. The net effect is an imbalance between the level of oxidant production and
antioxidant defenses disturbing normal homeostasis. This stress is characterized by the
overproduction of a large variety of free oxygen radicals which are collectively known as
reactive oxygen species (ROS). ROS represents a class of molecules that are derived from the
metabolism of oxygen and exist inherently in all aerobic organisms and are termed oxidants
[Bartosz G, 2009]. Living systems are constantly exposed to oxidants which are either generated
endogenously or from exogenous sources. ROS arise from endogenous sources as by-products
of normal and cellular metabolic reactions such as energy generation from mitochondria or
9
detoxification reactions involving cytochrome P-450 enzyme system. Formation of ROS takes
place continuously in every cell during normal metabolic processes.
In lungs, the possible cellular sources of ROS include neutrophils, eosinophils, alveolar
macrophages, type II pneumocytes, endothelial cells, smooth muscle cells and lung fibroblasts
[Piotrowski WJ eta/, 2000]. Neutrophils represent the minor cellular type known to produce
ROS under physiologic conditions after stimulation during inflammation in lung infections. Type
II pneumocytes which produces pulmonary surfactant are known to possess enzymatic
properties for the production of ROS molecules [Van Klaveren RJ eta/, 1997]. Endothelial cells
contribute to a substantial source of ROS generation due to rich lung vascularization and thus
participate in oxidative stress and lung injury under pathological conditions [Kelley EE et a/,
2006]. Lung fibroblasts are also known to produce ROS on stimulation by inflammatory
cytokines. There is evidence for the presence of two different membrane bound enzymes in
lung fibroblasts. One enzyme is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase
with a phagocytic ability that generates 0 2- intracellularly and the other enzyme is NADH
oxidase, which produces H20 2 and releases it directly into the extracellular space [Thannickal VJ
et a/, 1995]. All these cells are stimulated when they encounter inhaled particles such as
cigarette smoke or other mediators of inflammation that lead to the activation of the
membrane bound NADPH oxidase complex and the generation of the superoxide anion (02-)
[Nagata M, 2005]. The exogenous sources of ROS include exposure to cigarette smoke,
environmental pollutants such as emission from automobiles and industries, excessive alcohol
consumption, exposure to ionizing radiation and bacterial, viral or fungal infections. Inhalation
of volatile substances in cigarette smoke as well as airborne pollutants which may be either
oxidant gases such as ozone and sulphur dioxide or fine particulate matter results in either
direct lung damage or activation of inflammatory responses in the lungs due to production of
either short-lived or long-lived radicals [Liu PL eta/, 2005].
Pulmonary epithelium is the barrier between inhaled air & underlying tissue. It is vital to
maintain this barrier via continuous cell replacement and repair of epithelium. The activation of
apoptotic pathways eliminate damaged cells resulting in inflammation & tissue remodeling. A
10
disturbance of this physiological process results in necrosis or excessive apoptosis thereby
disrupting the barrier function of epithelium leading to lung injury and development of
emphysema. Oxidant production within lungs may lead to acute lung injury and occasionally
progressive lung injury resulting in fibrotic outcomes [Kinnula VL eta/, 2005]. Oxidative injury to
the lung is a major feature of acute lung injury (All) and its most severe form, acute respiratory
distress syndrome (ARDS) [Rocksen D eta/, 2003]. This is mediated by reactive oxygen species
(ROS), partly reduced derivatives of molecular oxygen and reactive nitrogen species (RNS)
which perpetuates a vicious cycle by recruiting further inflammatory cells that in turn releases
more cytotoxic mediators ultimately leading to significant injury to the alveolar-capillary
membrane and respiratory failure [Rahman I & W MacNee,1998 ].Cigarette smoke extract is
known to have oxidative stress induced cell injury mediated through connexin channels [
Ramachandran Setal, 2007].
1.2.6 Free radicals and reactive oxygen species
Free radicals are atoms or molecules possessing unpaired electrons in their outer orbital
resulting in instability and high reactivity. Nevertheless, it is not an appropriate term to describe
reactive oxygen species since a few among them do not have unpaired electrons in their outer
orbital, although they participate in redox reactions. Thus, the term reactive oxygen species
(ROS) and reactive nitrogen species (RNS) are considered to be more suitable because they
better depict these chemical agents. ROS are found in all biological systems and is formed from
the metabolism of molecular oxygen (02). Under physiological conditions, 0 2 undergoes
reduction by accepting four electrons resulting in the formation of water. It is during this
. process that reactive intermediates such as superoxide (02-), hydrogen peroxide (H20 2) and
hydroxyl (OH-) radicals are formed. Most of the RNS are formed from the synthesis of nitric
oxide (NO) through the conversion of L-arginine into L-citrulline by nitric oxide synthases [Mak
JC, 2008].
The production of reactive species is an essential part of normal metabolism present under
normal conditions notably in physiological processes involved in the production of energy,
11
regulation of cell growth, phagocytosis, intracellular signaling and synthesis of important
substances such as hormones and enzymes. In order to counteract the negative effects of these
radicals, the human body is endowed with an antioxidant system. Whenever there is an
imbalance between the pro-oxidant system and the antioxidant system, oxidative stress occurs
[Rajendrasozhan Set a/, 2008].
1.2. 7 Endogenous and exogenous sources of reactive oxygen species
The respiratory tract is in direct contact with the external environment and exposed to high
concentrations of oxygen making it a major target of injury caused by oxidants of endogenous
or exogenous origin [Park HS eta/, 2009].
The reactive species of endogenous origin are usually produced through enzymatic and non
enzymatic reactions of electron transfer. The principal cellular sites and processes that generate
oxidants are the microsomes, the mitochondria, the xanthine/xanthine oxidase system and
NADPH oxidase [Finkel T & Holbrook NJ, 2000]. The chief endogenous sources of oxidants are
alveolar macrophages, epithelial cells; endothelial cells and recruited inflammatory cells such as
neutrophils, eosinophils, monocytes and lymphocytes [Rajendrasozhan S et a/, 2008]. The
activation of these cells results in the formation of 0{ that is rapidly converted into H20 2 by the
enzyme superoxide dismutase (SOD). H20 2 is also formed through a non-enzymatic secondary
reaction in the presence of iron, OH- (Fenton reaction) [Park HS et a/, 2009]. The reactive
species produced by phagocytes are the main cause of the tissue injury associated with chronic
inflammatory lung diseases [Rajendrasozhan S eta/, 2008]. The exogenous oxidants originate
from air pollutants such as ozone, nitric dioxide, sulfur dioxide and cigarette smoke. Cigarette
smoke is known to contain approximately five thousand toxic compounds, including potent
oxidants (roughly 1014 free radicals per inhalation) such as acrolein, H20 2, OH- and organic free
radicals [Rajendrasozhan Set a/, 2008].
1.2.8 A549 as model system
A549 possess morphology and functions of type II pneumocytes. A549 human lung epithelial
cells were nominated as suitable candidates for toxicological analyses of oxidative stress and
12
inflammatory parameters in lung diseases [Muller L et a/, 2010]. Chlorinated aromatic
substances were found to be predominantly involved in oxidative stress response with
significant alterations at a proteome level as well as the activation of apoptotic cascades [Morbt
N et a/, 2011]. The primary site of injury in cigarette smoking is the alveolar epithelial cells
contributing to the pathogenesis of chronic lung diseases. A study by Hoshino Y et a/ showed
that exposure of A549 to the cigarette smoke extract (CSE) resulted in cytotoxic effects
[Hoshi no Yet a/, 2001].
1.2.9 Expression of inflammatory genes
Oxidative stress is the result of numerous biochemical pathways in which the endogenous anti
oxidant defenses give rise to oxidants such as ROS resulting in characteristic inflammatory
changes. An imbalance in the oxidant-antioxidant system is recognized as one of the first events
that ultimately leads to inflammatory reactions in the lung. Oxidative stress is initiated by the
productg of activated lung macrophages and infiltrated neutrophils propagating to lung
epithelial and endothelial cells leading to tissue damage. The sources of inflammation are
extensive and include microbial and viral infections, exposure to allergens, radiation, and toxic
chemicals, autoimmune and chronic diseases, obesity, consumption of alcohol, tobacco use and
a high-calorie diet [Aggarwal BB eta/, 2009]. Oxidative stress also turns on the redox-sensitive
transcription factors such as nuclear factor-KB [NF-KB] and activating protein-1 [AP-1] resulting
in the production of pro-inflammatory cytokines and chemokines which further aggravates
inflammation and oxidative stress. High levels of cytokines and chemokines such as tumor
necrosis factor- a (TNF-a), interleukins (IL) such as IL - 1~, IL-2, IL-6 and IL-8 is a common
feature of several lung diseases. Cytokine expression is mainly regulated at a transcriptional
level by NF-KB which is a DNA-binding factor that stimulates transcription of many different
cytokines involved in acute inflammation and is activated in AU. The expression of NF-KB is
modulated via activation of 1-KB kinase (IKK) pathway under hypoxic conditions, which is in turn
dependent on the level of oxidants [Rahman I eta/, 2000]. Since NF-KB is the final common step
of transcriptional regulation of inflammatory cytokine expression, modulation of its activity has
been the target of a number of anti-inflammatory drugs such as glucocorticoids. These agents
13
inhibit NF-KB and also impair binding of another transcription regulatory factor, activator
protein-1 to DNA and thus prevent cytokine-induced transcription of pro-inflammatory genes
[Schwartz MD eta/]. Hypoxia-inducible factor (HIF)-1 is another transcription factor modulated
by ROS under hypoxic conditions and is known to activate hypoxia-responsive genes such as
VEGF which is one of the major determinants of asthma ROS such as H202 and TNF-a, have
been shown to increase histone acetylation in alveolar epithelial cells [Barnes PJ, 2009].
Oxidants may also play a significant role in the modulation of HDAC activity [Bridges JP et a/,
2000].The action of corticosteroids is mediated via HDAC2 to switch off the activated
inflammatory genes but the reduction in HDAC2 appears to be secondary to the increased
oxidative and nitrative stress in COPD of lungs. This leads to tyrosine nitration, phosphorylation,
and ubiquitination of HDAC2, resulting in loss of its activity and its degradation which may be
restored by antioxidants, peroxynitrite scavengers, theophylline and curcumin inhibitors
[Barnes PJ, 2009]. Heme oxygenase 1 (H0-1) is one of the various molecules emerging as a
central player in diseases of the lung and intensive care unit. Although the main function of this
enzyme .. is to dispose of heme, its activity results in cytoprotection against oxidative injury and
cellular stresses. As the lung interfaces directly with an oxidizing environment, it is expected
that heme oxygenase-! would be involved in many aspects of lung health and disease [Morse D
and Choi AM, 2005]. The key inflammatory mediators in diseased conditions also increase H0-1
expression and HO activity in vitro providing an antioxidant mechanism in airway diseases
[Donnelly LE and Barnes PJ, 2001]. JL-8 is a prototypic human chemokine having varying
expression levels. In healthy cells, it is barely detectable, while it is rapidly induced in response
to pro-inflammatory stimuli and bacteria and viral products and during oxidative stress in the
alveolar epithelium [Standiford TJ eta/, 1990]. Airway epithelial cells secrete IL-8 in response to
several stimuli, including TNF-a, JL-1~, bacterial products, lipopolysaccharides (LPS), certain
viruses, oxidative stress and cigarette smoke extract [Repine JE et al, 1997]. Cultured airway
epithelial cells and alveolar macrophages from COPD patients produce more IL-8 than cells from
normal smokers, indicating an amplified response [Marwick JA et al, 2004]. The release of JL-8
from alveolar airspace epithelial cells is associated with particulate matter in the environment
14
mediated by oxidative stress [Gilmour PS et al, 2002].1L-8 protein and mRNA are increased in
bronchiolar epithelial cells of patients with COPD [Drost EM et al, 2005].
1.3 Expression of pulmonary surfactant proteins
Oxidative stress has a predominant role in surfactant - associated protein expression. It is
found that the hydrophilic surfactant proteins A (SP-A) and D (SP-D) directly protect surfactant
phospholipids and macrophages from oxidative damage. Both proteins block the accumulation
of thiobarbituric acid-reactive substances and conjugated dienes during copper-induced
oxidation of surfactant lipids or low density lipoprotein particles by a mechanism that does not
involve metal chelation or oxidative modification of the proteins. Oxidation of bovine lipid
extract surfactant (BLES) by ROS either from the hypochlorous acid or Fenton reaction resulted
in significant alterations in the levels of surfactant proteins, SP-B and SP-C. The study
demonstrated that oxidation of either SP-B or SP-C can hamper surfactant function whereas
non-oxidized SP-B can improve samples containing oxidized SP-C [Rodriguez-Capote et a/]. A
study suggested that the SP-D is an important regulatory molecule for protection against
hyperoxic lung injury through modulation of proinflammatory cytokines and antioxidant
enzymatic scavenger systems [Jain D eta!, 2008]. Another study revealed that SP-A exhibited a
specific protective effect against lipid peroxidation stimulated by linoleic acid hydroperoxide
(LHP) of rat lung mitochondria and microsomes in comparison to equal amounts of albumin
which exerted nil effect and was unable to inhibit lipid peroxidation [Terrasa AM eta/]. Another
study suggest that altered surfactant function which is associated with LPS-related All is
partially related to changes in the expression of SP-B due to a marked rise in inflammatory
cytokines and parallel decrease specifically in SP-B protein and mRNA levels and that the
treatment strategies directed at increasing SP-B expression may have a role in the future
therapy of acute respiratory distress syndrome (ADRS) [Ingenito EP eta/].
1.3.1 COPD and Emphysema
COPD is a complex disorder in which the final disease state is the interplay of multiple genetic
and environmental factors. It is a leading cause of morbidity and mortality worldwide. The
global burden of disease is projected to increase, making COPD the fourth leading cause of
15
death by 2030 [Wan ES and Silverman EK, 2009]. It is a heterogeneous group of diseases with
various clinical manifestations and includes disparate and overlapping disease processes such
as chronic bronchitis, emphysema, asthma, bronchiectasis and bronchiolitis. Cigarette smoking
is the major environmental risk factor for the development of COPD. The other important
factors include occupational and environmental exposures, genetic factors and increased
airway responsiveness [Mannino DM eta/, 2006]. It is reported that COPD is the most frequent
concomitant reason for prevalence of lung cancers worldwide and is present in about one half
of the population [L6pez-Encuentra A, 2002]. Emphysema is a major component of COPD and
could be expected to affect a significant percentage of patients with lung cancer. It is associated
with a chronic inflammation of the airways and lung parenchyma, characterized by increased
numbers of neutrophils, activated macrophages and activated T-lymphocytes [Barnes PJ, 2008].
The mechanisms involved in the development of the disease are influx of inflammatory cells
into the lung (leading to chronic inflammation of the airways), imbalance between proteolytic
and anti-proteolytic activity (resulting in the destruction of healthy lung tissue) and oxidative
stress [Barnes PJ eta/, 2003]. Macrophages are markedly increased in this condition and these
cells play a key role in recruiting other inflammatory cells (such as neutrophils) and releasing
mediators and proteases [Tetley TD, 2002]. The inflammatory changes in COPD are due to the
release of multiple inflammatory mediators, including lipid mediators, cytokines, and
chemokines. Activated macrophages and neutrophils release elastolytic enzymes, particularly
neutrophil elastase and matrix metalloproteinase-9 (MMP-9), that result in emphysema and
enhanced inflammatory cell recruitment into the lungs. Small airway narrowing as a result of
inflammation and fibrosis appears to be a major mechanism contributing to progressive airflow
limitation and air trapping, but the mechanisms of fibrosis in COPD are not yet well understood.
There is growing evidence that COPD may represent accelerated ageing of the lung in response
to chronic oxidative stress [Ito K and Barnes PJ, 2009]. Oxidative stress is the third mechanism
involved in the pathogenesis of COPD which occurs when reactive oxygen species are produced
in excess of the antioxidant defence mechanisms [Barnes PJ, 2003]. Oxidants are generated in
the airways by cigarette smoking or are released from inflammatory leukocytes and epithelial
cells. Oxidative stress can lead to cell dysfunction or cell death and can induce damage to the
16
lung extracellular matrix. Moreover, oxidative stress influences the proteinase-antiproteinase
imbalance by activating proteases and inactivating antiproteinases. Additionally, oxidants
contribute to the inflammatory reaction by activating the transcription factor NF-KB and thus
inducing the transcription of pro-inflammatory genes. In a rat model of emphysema induced by
VEGFR blockade, Tuder et al demonstrated that apoptosis predominated in the lung in areas of
oxidative stress and that experimental blockade of apoptosis markedly reduced the expression
of markers of oxidative stress [Tuder RM et al, 2003]. Certain other groups have shown that
mice with impaired expression of antioxidant genes have increased numbers of apoptotic
alveolar septal cells (predominantly endothelial and type II epithelial cells) and develop early
and extensive emphysema in response to cigarette smoke [Rangasamy T et al, 2004].
Fig 1.2 Schematic representation of pathogenesis of emphysema (Adapted from Kahn MA and Solomon
LW, 2007)
17
Hypodissertation
Lung as an organ is anatomically unique as this is the only site in the body which takes in large
volumes of air during a respiratory cycle and has efficient air blood diffusion. This anatomical
peculiarity makes the lung a target for oxidative injury. Understanding the molecular
mechanisms of this oxidative stress and its effect on lung functions is important in
understanding molecular pathogenesis of chronic lung diseases.
Alveolar epithelium is primary target of injury by exogenous sources of free radicals. A549 are
nominated as suitable candidates as they represent the type II pneumocytes of the lung and are
easily prone to oxidative stress reactions on exposure to exogenous oxidants. It is widely known
that smoking related lung diseases are on the rise and thus tobacco extract is chosen as a
potential chemical stimulant.
The objective of this work is to study oxidative responses in the lung at the molecular level
using A549 as model of alveolar epithelium and Tobacco extract as a mediator of chronic lung
injury as seen in a smoker's lung. The present study hypothesizes that tobacco extract would
induce oxidative stress in A549 cells which would modulate mRNA expression genes leading to
alveolar epithelial injury.
18
Research Objectives
The objectives of the current study include:
~ To understand the effect of tobacco extract in inducing oxidative stress in alveolar cell
monoculture system.
~ To characterize the effect of tobacco extract on the expression of key genes involved in
oxidative stress and inflammatory response in A549 lung epithelial cells.
19
Chapter II
Materials and Methods
All biochemicals were of analytical grade and were obtained from commercial suppliers such as
Sigma Chemical Co. (St. Louis, MO), HiMedia Labs (Mumbai, India), Corning (Tewksbury, MA),
Genei (Bangalore, lndiaL Eurogentec (San Diego, CA), Bio-Rad (Munchen, Germany).
2. Materials
Ham's F-12K complete media and 10% Fetal bovine serum (FBS) were purchased from Sigma
Aldrich. Gentamicin sulfate (SO IJ.g/ml), amphotericin B solution (250 IJ,g/ml), 0.25% Trypsin
EDTA and DMSO were obtained from HiMedia Labs. Multiwell cell culture plates available in 6-,
24- and 96 well formats were purchased from Corning. Tobacco extract was procured from
Sigma Aldrich. SYBR Green I and eDNA synthesis kit were purchased from Eurogentec. PCR
plastic consumables were obtained from Bio-Rad.
Methods
2.1 Maintenance of A549 cell line
A549 is a cell line established from lung adenocarcinoma of a Caucasian male in 1972. It is a
type II alveolar epithelial cell line. It was obtained from ATCC [American Type Cell Collection]
and were maintained in Ham's F-12K complete medium in standard tissue culture flasks of
25cm! size supplemented with 10% FBS, 11J,I/ml gentamycin and 101J.I/ml amphotericin at 3rC
in a humidified atmosphere containing 5% C02• The media was replenished every two days.
Once the cells attained 90% confluency on observation under an inverted phase contrast
microscope, the cells were detached from the flask using 0.25% trypsin-EDTA mix for the
passage of cells to a new tissue culture flask (appendix 1).
20
2.2 Exposure of A549 cells to tobacco extract
Monolayers of A549 cells grown to approximately 80-90% confluency in 6 well plates
containing 10% FBS were washed with sterile PBS and treated with tobacco extract prepared in
various concentrations such as 0.1~J.g/ml, 1~J.g/ml, 10 ~J.g/ml and 100 ~J.g/ml at pre-specified time
points -1hour, 4 hour and 24 hours. Experiments were done in triplicates.
2.3 Cell Proliferation assay using Trypan blue exclusion method
For the proliferation study, exponentially growing cells were harvested with trypsin- EDTA.
10111 of the cell suspension was mixed with 10111 of 0.1% trypan blue solution in Ca2+/Mg2+ free
phosphate buffered saline (PBS) and incubated for 3 min at room temperature. The suspension
was then loaded onto haemocytometer and counted under light microscope {Leica
Microsystems, EL 6000). The cells stained blue were considered nonviable cells, whereas the
cells that excluded the dye were considered viable. The total number of viable cells and dead
cells per ml of aliquot was counted and percentage viability was calculated according to the
formula.
Number of viable cells/ml = n*10,000*2
4
Percentage viability = (Number of viable cells/Number of viable cells + Number of dead
cells)*100
Experiments were done in triplicates. Control and drug treated cells were counted from day1 to
day4 and graphs were plotted. Varying concentrations of tobacco extract were tried in order to
find the optimum concentration that shows a maximum inhibitory effect on cell proliferation.
21
f'" I
' 2.4 Measurement of intracellular ROS and assay for oxidative stress
The DCF-DA, 5-(and- 6)-carboxy-2'J'-dichlorodihydrofluorescein diacetate method was used to
detect the intracellular ROS levels. The A549 cells were trypsinized, counted by trypan blue dye
exclusion method and seeded onto a 96 well plate at a density of 1 x104 cells/well. On
formation of a monolayer after 24 hours, the cells were washed twice with F-12K with
antibiotics containing incomplete media. 201J.M of DCFH-DA was added to the wells and
incubated at 37°C in dark for 1 hour. The cells were then washed with F-12K complete media
thrice. The cells were treated with various concentrations (0.11J.g/ml, 11J.g/ml, 10 IJ.g/ml and 100
IJ.g/ml) of tobacco extract as well as the positive control, H20 2• The cells were incubated at 37°C,
5% C02• Fluorescence was then determined at 485 nm excitation and 520 nm emission '
wavelengths using a microplate reader at the pre-specified exposure time points. The
percentage increase in fluorescence per well was calculated by the formula below [(Ftx-Ft0/
Fto)*100], .where Ftx = fluorescence at a particular time point and Fto =fluorescence at time 0
min. Experiments were done in triplicates. A control graph for the positive control, H20 2 and. a
graph for the tobacco extract of varying concentrations were plotted separately.
2.5 Study of the modulation of mRNA of antioxidant and inflammatory genes by tobacco
extract by Real Time PCR
qRT-PCR was done in order to determine the transcriptional induction of antioxidant genes
such as heme oxygenase 1 (H0-1) and inflammatory gene, IL-8. Total RNA was extracted from
cells by single-step method using Trizol® reagent (Sigma-Aldrich) at pre-specified time points-
1hour, 4 hour and 24 hours after the addition of 0.11J.g/ml, 1 IJ.g/ml, 10 IJ.g/ml and 100 IJ.g/ml
concentrations of tobacco extract. The precipitated RNA was resuspended in sterile RNase-free
water and quantified by absorbance at 260 nm with Nanovue spectrophotometer (GE
Healthcare, Amersham, Piscataway Township, NJ). One microgram of RNA was reverse
transcribed to eDNA using Eurogentec RT-PCR kit and random primers. Five microliters of the
resulting eDNA was amplified by qRT-PCR.
22
2.5.1 RNA extraction
Total RNA was extracted from the cells using the TRizol® Reagent [Invitrogen]. Protocol of the
kit was followed strictly. In briet cells were collected from the dish using TRizol reagent and
kept on ice. For every 1ml of TRizol, 200ul of chloroform was added and vortexed vigorously by
hand for 15 seconds. It was then incubated at room temperature for 5 -10 minutes followed by
centrifugation for 15 minutes at 12,000 g at 4°C. Three layers were formed - Upper aqueous
phase [colourless], interphase and lower phase [pink]. The upper aqueous phase was
transferred into a fresh eppendorf tube and an equal volume of isopropanol was added. It was
then incubated at room temperature for 5 -10 minutes and centrifuged at 12,000 g for 10
minutes at 4°C. The RNA precipitate forms a gel-like precipitate on the side and the bottom of
the tube. The pellet was then washed with 1ml of 75% ethanol by centrifuging it at 7,500 g for 5
minutes at 4°C. The pellet was then briefly air dried for around 3 minutes, resuspended in 10-
15ul of sterile, RNase free water and stored at -80°C. RNA was quantified using Nanovue plus
spectrophotometer (GE Healthcare, Amersham).
2.5.2 Real-time quantitative polymerase chain reaction (qRT-PCR)
Real time qPCR was done using SYBR Green chemistry and Eurogentec two-step kit. Kit
comprised of a Reverse transcription core kit and a MESA GREEN qPCR mastermix plus for SYBR
assay-dTTP. The protocol mentioned in the kit was followed. In brief, 11-lg of RNA was reverse
transcribed to eDNA using Eurogentec RT-PCR kit using random primers. To amplify eDNA by
qRT-PCR. 5!-ll of the resulting eDNA were added to a mixture of 20!-ll of SYBR green universal
PCR Master Mix and assays were performed using Chromo4™ real-time PCR system. Standard
graphs were generated for each gene to quantify the copies of eDNA in each sample.
The primer pairs used are tabulated (table 3). GAPDH was used as the house-keeping gene.
Final Quantitation was done using the comparative CT method and reported as n-fold
difference relative to a calibrator eDNA. The housekeeping gene was used to normalize the CT
values of the target genes (f~CT). The amount of target molecules relative to the calibrator was
23
calculated by 2-Mcr. Therefore, all gene transcriptions were expressed as an n-fold difference
relative to the calibrator. AlOJ..ll reaction was made. Constituents of the reaction mixture are
listed in table 1.
lOX reaction buffer lui
2.5mM dNTP 2ul
25mM MgCb 2ul
Random nanomer O.Sul
Euro script RT 0.25ul
RNase inhibitor 0.20ul
mRNA extract 1-2ug/ul concentration
Nuclease free water To make up the total volume to lOul
Table 2.1 Constituents of reaction mixture for eDNA synthesis
eDNA amplification was done using Chromo4™ system and the conditions of the experimental
setup are listed in Table 2.
25°C 10 min.
48°C 30min.
gsoc Smin.
Table 2.2 PCR conditions for eDNA synthesis
24
f
I
l!ll of the resulting eDNA was amplified by qRT-PCR. Specific primers were used, optimized to
amplify fragments from the various genes of interest, as listed in Table 3. A 25jll reaction was
set up. The constituents of reaction mixture and the PCR conditions are given in Table 4 and 5
respectively and assays were performed using Chromo4 TM real-time PCR system.
Genes Primer sequences Annealing
Temperature
GAPDH FP: 5' ATICCATGGCACCGTCAAGGCT 3'
RP: 5' TCAGGTCCACCACTGACACGT 3' 58°C
Heme oxygenase-1 (H0-1) FP: 5' CAGCATGCCCCAGGATITG 3'
RP: 5'AGCTGGATGTIGAGCAGGA 3' 59°C
lnterleukin-8 (IL-8) FP: 5' GCTTICTGATGGAAGAGAGC 3'
159"C J L_ __ ~ ______________ _L ______________________________ _L __________ __
RP: 5' GGCACAGTGGAACAAGGACT 3'
Table 2.3 Primer sequences of oxidative stress genes and housekeeping gene
2X reaction buffer with SYBR 12.Sul
Green
Forward primer [lOO!lM] 0.025ul
--Reverse primer [100jlM) 0.025ul
Nuclease free water 11.45ul
Template lui
Table 2.4 Constituents of reaction mixture for eDNA amplification
25
95°C lOmin.
95°C 15 sec.
53oC 20 sec.
72°C 40 sec.
Plate read
Go to step two for 39 more times
Melting curve analysis
1rc 5 min.
woe Forever
End
Table 2.5 PCR conditions for eDNA amplification
26
' I Chapter IU
Results & Discussion
lung diseases are the third most frequent cause of death in Europe and USA. According to WHO
statistics, nine million people die annually as a result of lung diseases. Globalization in India has
led to emergence of occupational respiratory diseases. latest WHO statistics show that India
has an estimated 15-20 million asthmatics. After cardio-vascular diseases and cancers, chronic
respiratory disease is the major cause for mortality in both the sexes in India. The lungs are the
major route of entry of pollutants, pathogens etc. in the body and as such are constantly
exposed to a wide range of toxic materials. Here Tobacco extract is used as an agent to develop
oxidative stress in alveolar epithelial cell line A549 and modulation of antioxidant and
inflammatory genes is analyzed.
3.1 Morphology of AS49
Fig 3.1 Phase contrast microscopy of A549 monolayer in TCPS dishes
27
Fig 3.2 Fluorescent microscopy of stained with Hoechst 33342 for nuclear DNA
3.2 Oxidative stress assay
Oxidative stress is the steady state level of oxidative damage to a cell, tissue or organ resulting
in the over production of free radicals known as ROS. This assay determines the amount of ROS
produced at various concentrations of tobacco extract at pre-specified time points - 10
minutes, 30 minutes, 1 hour, 4 hour and 24 hours in comparison to the positive control, H 20 2 .
28
100.00 90.00 80.00 70.00 60.00 50.00 40.00 30.00 20.00 10.00
0.00
i 10 min
130 min
lh
i4h
24h
Media Control 100 400
H202(uM) 800
Fig.3.3 Concentration-response graph of percentage increase of DCF fluorescence in A549 after
exposure to 100u.M, 400 u.M, 800u.M concentrations of H202 (Positive control) at various time points
100.00
Media Control
0.1 1 10
Tobacco extract (ug/ml)
100
Fig.3.4 Concentration-response graph of percentage increase of DCF fluorescence in A549 after
exposure to 0.1 ug/ml, 1 ug/ml, 10 ug/ml, 100 ug/ml concentrations of tobacco extract at various
time points
Figure 3.3 shows the concentration-response relationship of cells exposed to H 2 0 2 which is the
positive control. The percentage increase of fluorescence is found to linearly increase with the
concentrations of H 2 0 2 -100u.M, 400u.M and 800u,M at several time points. Similarly, the
concentration-response relationship was also found to linearly increase with the concentrations
of tobacco extract - 0.1 ug/ml, 1 ug/ml, 10 ug/ml, 100 ug/ml (Figure 3.4). Intracellular ROS
29
levels were significantly increased after 4 hour and 24 hour exposure to the various
concentrations of tobacco extract. Under conditions of standardization (Figure 3.3), ROS
formation was found to be concentration and time dependent. Under test conditions (Figure
3.4), when the cells were exposed to TE, linearity was maintained throughout the period of
assay. ROS formation was also found to be concentration and time dependent. At 100 |ig/ml
concentration of TE over a period of 24 hours, a doubling in percentage fluorescence was
observed. 100 ug/ml of tobacco extract was used to represent chronic injury in lung due to
smoking. This may point to the fact that chronic injury would lead to continued generation of
free radicals which could not be corrected by the antioxidant mechanism of the body leading to
oxidative stress damage.
3.3 Effect of tobacco extract on inducing expression of oxidative stress genes in alveolar
epithelial cells
Relative analysis of HO-1 expression 5.00
0.00
• 1h
4h
24 h
o . i I 10 100
Tobacco extract (ug/ml)
Fig 3.5 Relative gene expression of Hemoxygenase 1 (HO-1)
30
Relative analysis of IL-8 expression
1h 4h 24 h
0.1 1 10 100
Tobacco extract (ug/ml)
Fig.3.6 Relative gene expression of IL-8
HO-1 is an enzyme produced under an insult or injury leading to oxidative stress. The
epithelium is a rich source of HO-1 expression induced in the lung under hyperoxic injury and its
role in protection against oxidative stress has been established. There was a baseline
expression of HO-1 mRNA in A549 lung epithelial cells (figure 3.5). At low concentrations of
tobacco extract, only prolonged exposure increased the expression levels of HO-1. However,
culture of cells in the presence of tobacco extract at a concentration of 100u,g/ml had a
pronounced effect on the mRNA expression of HO-1 and a steep increase was observed in the
4 t h hour itself which is an indicator of chronic lung injury. The mRNA levels were found to be up
regulated at the 24 t h hour interval. This would suggest that elevated concentrations of the
chemical stimulant over a prolonged duration induce considerable oxidative stress injury to the
alveolar epithelial cells. It may be inferred that the over expression of HO-1 gene in A549 may
have a role for this protein in protection against oxidative stress [Donnelly LE and Barnes PJ,
2001]. At earlier time points and lower concentrations of TE, the expression of genes remains
reasonably constant. From figure 3.6, it is clear that the culture of cells in the presence of
tobacco extract at a concentration of 100u.g/ml had a significant effect on the mRNA expression
of IL-8. Similar to HO-1, the mRNA levels were found to be highly upregulated at the 24 t h hour
interval. This would suggest that elevated concentrations of the chemical stimulant over a
31
1 I
prolonged duration induce inflammatory injury to the alveolar epithelial cells. ll-8 is a potent
chemotaxin for neutrophil influx in vitro. Elevated levels of ll-8 levels were found in sputum
recovered from COPD patients [Repine JE et al, 1997]. The expression levels of IL-8 are
stimulated to only one-fold increase initially. Prolonged duration and increasing concentrations
of tobacco extract leads to a two-fold increase in IL-8 expression at 101lg/ml & a four-fold
increase in IL-8 expression at 10011g/ml. This is supported by the study that ultrafine Ti02
particles are known to elicit significantly stronger oxidant generation and IL-8 release in A549
triggering exaggerated inflammatory responses [Singh S et al, 2007]. It is also evident from a
study by Marwick JA et al, animal models of smoke exposure results in neutrophil influx in the
lungs that is associated with increased JL-8 gene expression [Marwick JA et al, 2004].
Exacerbations of COPD are associated with excessive influx of inflammatory cells into peripheral
airways of patients with COPD and increased IL-8 levels in bronchiolar lavage in stable COPD
patients [ Drost EM et al, 2005]. The release of IL-8 from alveolar airspace epithelial cells is
associated with particulate matter in the environment mediated by oxidative stress [Gilmour PS
et al, 2002].
32
1
I Chapter IV
Summary & Conclusion
The pulmonary epithelium serves multiple functions which includes maintenance of alveolar
homeostasis, synthesis of surfactant for functional integrity and metabolism of xenobiotics. Any
insult or injury would offset these roles of the lung. Prolonged oxidative stress induced by
chronic smoking would lead to oxidative damage which would be the end result of the interplay
of modulation of such antioxidant and pro-inflammatory genes. Such chronic damage would
result in the pathophysiology of chronic obstructive pulmonary diseases.
Oxidative stress as reflected in ROS content was positively correlated with the length of the
exposure to several concentrations of the tobacco extract. It is worth noting that concentration
specific analyses reveal that minor oxidative stress occur under exposure conditions (0.1 j..tg/ml,
11J,g/m! and 10 IJ.g/ml, 4 and 24h) that are insufficient to cause cytotoxicity. The increase in H0-
1 and IL-8 expression levels reveals that high concentrations of tobacco extract over a long
period of time are key mediators of airway inflammatory diseases.
In summary, it is revealed from the present study that 100 IJ.g/ml tobacco extract induces
cytotoxicity in cultured A549 lung epithelial cells while elevating oxidative stress in a
concentration- and time-dependent fashion. Exposure to OS-inducible, 100 IJ.g/ml
concentration of tobacco extract has altered the expression of genes involved in oxidative
stress. Further genetic analysis has to be done in order to appreciate the true nature and extent
of this response.
Future Prospective
A three-dimensional cell culture system incorporating alveolar epithelial cells, fibroblasts and
alveolar macrophages using a suitable scaffold which more closely resemble the in vivo
situation can be used to extrapolate this study and understand cell-cell interactions. The signal
transduction pathways activated in cell death can be analyzed in detail in order to find suitable
interventions.
33
1
References
~ Abraham V, Chou ML, George P, Pooler P, Zaman A, Savani RC and Koval M. Heterocellular
gap junctional communication between alveolar epithelial cells. Am J Physiol Lung Cell Mol
Physiol. 2001; 280: P 1085-1093.
~ Adamson IV and Young L. Alveolar type II cell growth on a pulmonary endothelial
extracellular matrix. Am J Physiol. 1996; 270: L1017-1022.
~ Adamson IV, Young L, Bowden DH. Relationship of alveolar epithelial injury and repair to the
induction of pulmonary fibrosis. Am J Pathol. 1988; 130(2): 377-383.
~ Aggarwal BB, Vijayalekshmi RV and Sung B. Targeting inflammatory pathways for
prevention and therapy of cancer: short-term friend, long-term foe. Clin Cancer Res. 2009;
15:425-430.
~ Ballard PL, 1986. Hormones and Lung Maturation. Berlin: Springer-Verlag.
~ Bangham AD and Horne RW. Negative staining of phospholipids and their structural
modification by surface active agents as observed in the electron microscope. Journal of
Molecular Biology. 1964; 8: 660-668.
~ Barnes PJ, Shapiro SD, Pauwels RA. Chronic obstructive pulmonary disease: molecular and
cellular mechanisms. Eur Respir J. 2003. 22:672-688.
~ Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev
lmmunol. 2008; 8:183-192.
~ Barnes PJ. Role of HDAC2 in the Pathophysiology of COPD. Annu Rev Physiol. 2009;. 71:451-
64.
~ Bartosz G. Reactive oxygen species: destroyers or messengers? Biochemical pharmacology.
2009; 77(8):1303-1315.
~ Bridges JP, Davis HW, Damodarasamy M, Kuroki Y, Howles G, Hui DY and McCormack FX.
Pulmonary Surfactant Proteins A and D Are Potent Endogenous Inhibitors of Lipid
Peroxidation and Oxidative Cellular Injury. JBC. 2000; 275 (49): 38848-38855.
~ Crosby LM and Waters CM. Epithelial repair mechanisms in the lung. Am J Physiol Lung Cell
Mol Physiol. 2010; 298(6): L715-731.
~ Crouch E and Wright JR. Surfactant proteins A and D and pulmonary host defense. Annu Rev
Physiol. 2001; 63: 521-554.
34
>- D. Eugene Rannels. Gap junction communication in alveolar epithelia! cells. Am J Physiol
Lung Cell Mol Physiol. 2001. 280: L1083-L1084.
>- Donnelly LE and Barnes PJ. Expression of Heme Oxygenase in Human Airway Epithelial Cells.
Am. l Respir. Cell Mol. Bioi. 2001; 24: 295-303.
>- Drost EM, Skwarski KM, Sauleda J, Soler N, Roca J, Agusti A, MacNee W. Oxidative stress
and airway inflammation in severe exacerbations of COPD. Thorax. 2005; 60:293-300.
>- Feldhaus MJ, Weyrich AS, Zimmerman GA, Mcintyre TM. Ceramide generation in situ alters
leukocyte cytoskeletal organization and beta 2-integrin function and causes complete
degranulation. J Bioi Chern. 2002; 277: 4285-4293.
>- Finkel T, Holbrook NJ. Oxidants, oxidative stress and the biology of ageing. Nature. 2000;
408(6809}:239-47.
>- Gilmour PS, Rahman I, Stone V, Donaldson K and MacNee W. PMw-mediated IL-8 Release
from Epithelial Cells Involves Histone Acetylation. Ann. occup. Hyg. 2002; 46: 436-439.
>- Heffner JE and Repine JE. Pulmonary strategies of antioxidant defense. Am Rev Respir Dis.
1989; 140(2): 531-554.
>- Hoshino Y, Mia T, Nagai S, Miki H, Ito I and Izumi T. Cytotoxic effects of cigarette smoke
extract on an alveolar type II cell-derived cell line. Am J Physiol Lung Cell Mol Physiol. 2001;
281: L509-L516.
>- Isakson BE, Seedorf GJ, Lubman RL, Boitano S. Heterocellular cultures of pulmonary alveolar
epithelial cells grown on laminin-5 supplemented matrix. In Vitro Cell Dev Bioi Anim. 2002;
38(8):443-9.
>- Ito K, Barnes PJ. COPD as a disease of accelerated lung aging. Chest. 2009; 135:173-180.
>- Jain D, Atochina-Vasserman EN and Beers MF. Surfactant Protein D Protects against Acute
Hyperoxic Lung Injury. Am J Respir Crit Care Med. 2008; 178: 805-813.
> Kelley EE, Hock T, Khoo NK, Richardson GR, Johnson KK, Powell PC, Giles Gl, Agarwal A,
Lancaster JR Jr, Tarpey MM. Moderate hypoxia induces xanthine oxidoreductase activity in
arterial endothelial cells. Free Radic Bioi Med. 2006; 40: 952-959.
> Kinnula VL, Fattman CL and Oury TD. Oxidative stress in pulmonary fibrosis: a possible role
for redox modulatory therapy. Am. J. Respir. Crit. Care Med. 2005; 172: 417-422.
> Li C, Wright MM, Jackson RM. Reactive species mechanisms of cellular hypoxia
reoxygenation injury. Am J Physiol Cell PhysioL 2010; 282: C227- C24.
35
~ Liu PL, Liu YJ, Tang GJ, Yien HW, Wu YL, Kou YR. Wood smoke extract induces oxidative
stress-mediated caspase-independent apoptosis in human lung endothelial cells: role of AIF
and EndoG. Am J Physiol Lung Cell Mol Physiol. 2005; 289: L739-49.
~ Lopez-Encuentra A. GCCB-S. Comorbidity in operable lung cancer: a multicenter descriptive
study on 2992 patients. Lung Cancer 2002; 35:263-9.
~ Mak JC. Pathogenesis of COPD. Part II. Oxidative-antioxidative imbalance. lnt J Tuberc Lung
Dis. 2008; 12(4):368-74.
~ Mannino OM, Watt G, Hole D, Gillis C, Hart C, McConnachie A, Davey Smith G, Upton M,
Hawthorne V, Sin DO et al. The natural history of chronic obstructive pulmonary disease: the
global burden of chronic obstructive pulmonary disease, number 3. Eur Respir J. 2006;
27:627-643.
~ Marwick JA, Kirkham P, Stevenson CS, Dana hay H, Giddings J, Butler K, Donaldson K, Macnee
W, Rahman I. Cigarette smoke alters chromatin remodelling and induces proinflammatory
genes in rat lungs. Am J Respir Celll\llol Bioi. 2004; 31: 633-642 .
. ~ Morbt N, Tomm J, Feltens R, Mogel I, Kalkhof S, Murugesan K, Wirth H, Vogt C, Binder H,
Lehmann I and Bergan M. Chlorinated Benzenes Cause Concomitantly Oxidative Stress and
Induction of Apoptotic Markers in Lung Epithelial Cells (A549) at Nonacute Toxic
Concentrations. Journal of Proteome Research. 2011; 10: 363-378.
~ Morse D and Choi AM. Heme Oxygenase -1: from bench to bedside. Am J Respir Crit Care
Med. 2005; 172(6):660-70.
~ Muller L, Riediker M, Wick P, Mohr M, Gehr P and Rothen-Rutishauser B. Oxidative stress
and inflammation response after nanoparticle exposure: differences between human lung
cell monocultures and an advanced three-dimensional model of the human epithelial
airways. J. R. Soc. Interface. 2010; 7: S27-S40.
~ Nagata M. Inflammatory cells and oxygen radicals. Curr Drug Targets lnflamm Allergy. 2005;
4: 503-504.
~ Park HS, Kim SR, Lee YC. Impact of oxidative stress on lung diseases. Respirology. 2009; 14:
27-38.
~ Piotrowski WJ, Marczak J. Cellular sources of oxidants in the lung. lnt J Occup Med Environ
Health. 2000; 13: 369-385.
36
1
);> Rada B, Leto TL.Oxidative innate immune defenses by Nox/Duox family NADPH Oxidases.
Contributions to Microbiology. 2008; 15: 164-87.
);> Rahman I, MacNee W. Role of transcription factors in inflammatory lung diseases. Thorax.
1998; 53: 601-12.
);> Rahman, I. and W. MacNee. Oxidative stress and regulation of glutathione in lung
inflammation. Eur. Respir. J. 2000; 16: 534-554.
);> Rajendrasozhan S, Yang SR, Edirisinghe I, Yao H, Adenuga 0, Rahman I. Deacetylases and NF
kappaB in redox regulation of cigarette smoke-induced lung inflammation: epigenetics in
pathogenesis of COPD. Antioxid Redox Signal. 2008; 10(4):799-811.
);> Ramachandran S, Xie LH, John SA, Subramaniam S, Lal R. A Novel Role for Connexin
Hemichannel in Oxidative Stress and Smoking-Induced Cell Injury. PLoS ONE. 2007; 2(8):
e712.
);> Rangasamy T, Cho CY, Thimmulappa RK, Zhen L, Srisuma SS, Kensler TW, Yamamoto M,
Petrache I, Tuder RM, Biswal S. Genetic ablation of Nrf2 enhances susceptibility to cigarette
smoke-induced emphysema in mice. J Clin Invest. 2004; 114: 1248-1259.
);> Repine JE, Bast A, Lankhorst I and the Oxidative Stress Study Group. Oxidative Stress in
Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 1997; 156: 341-357.
);> Rocksen D, Johansson L and Bucht A . Vitamin E reduces transendothelial migration of
neutrophils and prevents lung injury in endotoxin-induced airway inflammation. Am. J.
Respir. Cell Mol. Bioi. 2003; 28: 199-207.
);> Rutgers SR, Timens W, Kauffman HF, Postma OS. Markers of active airway inflammation and
remodeling in chronic obstructive pulmonary disease. Clin Exp Allergy. 2001; 31(2): 193-205.
);> Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Bioi. 2002; 4: E131-6.
);> Singh S, Shi T, Duffin R, Albrecht C, van Berlo D, Hohr D, Fubini B, Martra G, Fenoglio I, J.A.
Borm P, P.F. Schins R. Endocytosis, oxidative stress and IL-8 expression in human lung
epithelial cells upon treatment with fine and ultrafine Ti02: Role of the specific surface area
and of surface methylation of the particles. 2007; 222(2):141-151.
);> Smith BT and Fletcher WA. Pulmonary epithelial - mesenchymal interaction: beyond
organogenesis. Human Pathology. 1979; 10(3):248-250.
);> Snell RS (2007), Clinical Anatomy by Systems, Baltimore: Lippincot, Williams & Wilkins. ISSN
0903-1936R.
37
~ Standiford TJ, Kunkel SL, Basha MA, Chensue SW, Lynch JP, Toews GW, Westwick J and
Strieter RM. lnterleukin-8 gene expression by a pulmonary epithelial cell line. J. Clin. Invest.
1990.86:1945-1953.
~ Tetley TD. Macrophages and the Pathogenesis of COPD. Chest. 2002; 121:156S-159S.
~ Thannickal VJ, Fanburg BL. Activation of an H20 2-generating NADH oxidase in human lung
fibroblasts by transforming growth factor ~1. J Bioi Chem. 1995; 270: 30334-30338.
~ Tikoo K, Lau KS and Monks TJ. Histone H3 phosphorylation is coupled to poly(ADP
ribosylation) during reactive oxygen species-induced cell death in renal proximal tubular
epithelial cells. Mol PharmacaL 2001; 60: 394-402.
~ Travis SM, Conway BA, Zabner J, Smith JJ, Anderson NN, Singh PK, Greenberg EP, Welsh MJ.
Activity of abundant antimicrobials of the human airway. J Respir Cell Mol Bioi. 1999; 20 (5):
872-9.
~ Tuder RM, Zhen L, Cho CY, Taraseviciene-Stewart L, Kasahara Y, Salvemini D, Voelkel NF,
Flores SC. Oxidative stress and apoptosis interact and cause emphysema due to vascular
endothelial growth factor receptor blockade. Am J Respir Cell Mol Bioi. 2003, 29: 88-97.
~ Van Klaveren RJ, Roelant C, Boogaerts M, Demedts M, Nemery B. Involvement of an
NAD(P)H oxidase-like enzyme in superoxide anion and hydrogen peroxide generation by rat
type II cells. Thorax. 1997; 52: 465-471.
~ Wan ES and Silverman EK. Genetics of COPD and Emphysema. Chest. 2009; 136:859-866.
~ Weinberger SB. Decreased locomotor activity produced by repeated, but not single,
administration of murine-recombinant interferon-gamma in mice. Life Science. 1988.
42(10): 1085-90.
~ Wilson MR, Lightbody JH, Donaldson K, Sales J, Stone V. Interactions between ultrafine
particles and transition metals in vivo and in vitro. Toxicol Appl Pharmacal. 2002; 84:172-
179.
~· Widdicombe JG, Pack RJ. The Clara CeiL Eur J Respir Dis. 1982; 63(3): 202-20.
38
Ham's F12K complete medium:
Ham's F12 K incomplete -90ml
Fetal bovine serum -lOml
Gentamycin - 100111
Amphotericin -lml
Phosphate buffered saline (PBS), pH -7.2
Sodium chloride -8.5 g/L
Disodium hydrogen phosphate - 1.91 g/L
Potassium dihydrogen phosphate- 0.38 g/L
Appendix 1
Sterilize by autoclaving at 10 lbs pressure (115°C) for 10 minutes.
Dilution of drugs:
Tobacco extract (1001lg/ml)
TE stock
Serum free media
Tobacco extract (101lg/ml)
TE working (1001lg/ml)
Serum free media
Tobacco extract (O.lllg/ml)
-10!-ll
- 990jll
TE working (lOilg/ml) - 10111
39
Serum free media
Tobacco extract (lllg/ml)
TE working
Serum free media
DCFDA stock (lOmM)
DC FDA
Serum free media
- 990j11
-5mg
-1000jll
DCFDA intermediate working solution (lmM)
DCFDA stock - 100 jll
Serum free media - 900 Ill
DCFDA working solution (20j1M)
DCFDA (lmM) - 20 jll
Serum free media - 980 Ill
75% Ethanol:
Absolute ethanol -75ml
Distilled water - 25ml
40
Appendix 2
Revival of A549
Collect the cells from liquid nitrogen storage wearing appropriate cryogloves. Place the frozen
screw-cap vial in a water bath at 37°C. Quickly thaw the cells for 1-2 minutes. Wipe the vial with
70% alcohol before transferring to the cell culture hood. Dilute the cells in a 10-fold volume of pre
warmed growth medium in a culture dish or flask slowly adding drop by drop. Incubate at 3rC in a
humidified atmosphere containing 5% C02• Change medium after a few hours or overnight
incubation until the cells have attached to the culture dish or flask. Examine cells microscopically
(phase contrast) after 24 hours and subculture as necessary.
Subculture of adherent A549
View cultures using an inverted microscope to check confluence and confirm the absence of
bacterial and fungal contaminants. Remove the spent medium. Wash the cell monoiayer with PBS.
Add trypsin-EDT A to the washed cell monolayer. Rotate flask to cover the entire surface with trysin.
Return the flask to the incubator and incubate for 1-3 minutes or until cells are detached. Examine
the cells using an inverted microscope to ensure that the cells are detached and floating. Resuspend
the cells in a small volume of Ham's F-12K complete growth media and transfer to a sterile 15ml
falcon tube. Centrifuge at 125g for 5 minutes at ambient temperature. Carefully remove the
supernatant without disrupting the cell pellet and add 5ml growth media to it. Mix thoroughly and
seed onto a 25cm2 T-flask. Label it and place at 3rC in a humidified atmosphere containing 5% C02•
Cryopreservation of A549
View cultures using an inverted microscope to check confluence and confirm the absence of
bacterial and fungal contaminants. Remove the spent medium and wash with PBS. Trypsinize cells
and centrifuge to remove the medium. Resuspend cells in freezing medium (Ham's F-12K complete
growth media + 5% DMSO) at a concentration of 2-4 million cells per mi. Add lml of cells into
labeled cryovials. Place cryovials on ice for 1 hour before transferring to the -80°C freezer overnight.
Transfer the vials to liquid nitrogen for long term storage.
41
Related Documents
