Chow_Edwin_CY_PhD_thesis.pdf - TSpace

Title BIOLOGICAL ROLES OF THE VITAMIN D RECEPTOR IN THE REGULATION OF

TRANSPORTERS AND ENZYMES ON DRUG DISPOSITION, INCLUDING

CYTOCHROME P450 (CYP7A1) ON CHOLESTEROL METABOLISM

by

Edwin Chiu Yuen Chow

A thesis submitted in conformity with the requirements

For the degree of Doctor of Philosophy

Department of Pharmaceutical Sciences

University of Toronto

© Copyright by Edwin Chiu Yuen Chow (2012)

ii

Biological roles of the vitamin D receptor in the regulation of transporters and enzymes on drug disposition, including cytochrome P450 (CYP7A1) on cholesterol metabolism

Doctor of Philosophy (2012)

Edwin Chiu Yuen Chow Department of Pharmaceutical Sciences, University of Toronto

ABSTRACT

Nuclear receptors play significant roles in the regulation of transporters and

enzymes to balance the level of endogenous molecules and to protect the body from foreign

molecules. The vitamin D receptor (VDR) and its natural ligand, 1,25-dihydroxyvitamin

D3 [1,25(OH)2D3], was shown to upregulate rat ileal apical sodium dependent bile acid

transporter (Asbt) to increase the reclamation of bile acids, ligands of the farnesoid X

receptor (FXR). FXR is considered to be an important, negative regulator of the cholesterol

metabolizing enzyme, Cyp7a1, which metabolizes cholesterol to bile acids in the liver. In

rats, decreased Cyp7a1 and increased P-glycoprotein/multidrug resistance protein 1 (P-

gp/Mdr1) expressions pursuant to 1,25(OH)2D3 treatment was viewed as FXR effects in

which hepatic VDR protein is poorly expressed. In contrast, changes in rat intestinal and

renal transporters such as multidrug resistance associated proteins (Mrp2, Mrp3, and Mrp4),

Asbt, and P-gp after administration of 1,25(OH)2D3 were attributed directly as VDR effects

due to higher VDR levels expressed in these tissues. Higher VDR expressions were found

among mouse hepatocytes compared to those in rats. Hence, fxr(-/-) and fxr(+/+) mouse

models were used to discriminate between VDR vs. FXR effects in murine livers. Hepatic

Cyp7a1 in mice was found to be upregulated with 1,25(OH)2D3 treatment, via the

derepression of the short heterodimer partner (SHP). Putative VDREs, identified in mouse

and human SHP promoters, were responsible for the inhibitory effect on SHP. The increase

iii

in hepatic Cyp7a1 expression and decreased plasma and liver cholesterol were observed in

mice prefed with a Western diet. A strong correlation was found between tissue Cyp7a1

and P-gp changes and 1,25(OH)2D3 plasma and tissue concentrations, confirming that VDR

plays an important role in the disposition of xenobiotics and cholesterol metabolism.

Moreover, renal and brain Mdr1a/P-gp were found to be directly upregulated by the VDR

in mice, and concomitantly, increased renal and brain secretion of digoxin, a P-gp substrate,

in vivo. The important observations: the cholesterol lowering and increased brain P-gp

efflux activity properties suggest that VDR is a therapeutic target for treatment of

hypercholesterolemia and Alzheimer’s diseases, since beta amyloid, precursors of plague,

are P-gp substrates.

iv

ACKNOWLEGMENTS

I would like to thank my supervisor, Dr. K. Sandy Pang who has given me great

guidance and mentorship during my Ph.D. study. She has inspired me to enter the world of

science and research.

I sincerely thank all the members in my advisory committees (Dr. David Hampson,

Dr. Reina Bendayan, Dr. Carolyn L. Cummins, and Dr. Cindy Woodland) for their kind

help and suggestions.

I wish to thank my family members for their support, especially my late father, Hai

Woon Chow, who was a role model to me and who constantly reminded me that education

is an asset that will lead to a better life. I thank my mother, Suk Lun Chow Wong, for her

love and support throughout my studies.

I am very grateful to my colleagues, especially Drs. Hudaong Sun, Jianghong Fan,

Han-joo Maeng, and Matthew R. Durk, Cheng Jin, and Holly P. Quach, for their support

and cooperation.

I wish to thank Lilia Magomedova, Rucha Patel, and Monika Patel in Dr. Cummins’

labortary for providing me with assistance in my Ph.D. project.

I would like to thank Dr. Geny M.M. Groothuis, Dr. Ansar K. Khan, and Myrte

Sondervan and the rest of Dr. Groothuis laboratory for their help and support when I was

working at the University of Groningen, the Netherlands.

I wish to thank Dr. David D. Moore and Dr. Sayeepriyadarshini Anakk at the

Baylor College of Medicine at the Texas Medical Center and Dr. Reinhold Vieth and

Dennis Wagner at Mount Sinai Hospital, University of Toronto, for providing me

assistance and resources for my Ph.D. project.

v

I also would like to thank the financial support from U of T open fellowship, NSERC

Canada Graduate Scholarship, and NSERC Michael Smith Foreign Study Supplements to

travel aboard.

vi

TABLE OF CONTENTS

Title ......................................................................................................................................................................... i

ABSTRACT ................................................................................................................................................................. ii

ACKNOWLEGMENTS .............................................................................................................................................. iv

TABLE OF CONTENTS............................................................................................................................................. vi

LIST OF PUBLICATIONS ......................................................................................................................................... xi

ABBREVIATIONS AND TERMS ........................................................................................................................... xiv

LIST OF FIGURES ................................................................................................................................................... xix

1.1 INTRODUCTION.......................................................................................................................................... 2

1.2 TRANSPORTERS AND ENZYMES AND THEIR REGULATION BY NUCLEAR RECEPTORS.......... 3

1.2.1 Enzymes............................................................................................................................................... 4 1.2.2 Transporters ......................................................................................................................................... 5 1.2.3 The Bile Acid And Xenosensor Nuclear Receptors............................................................................. 6

1.2.3.1 The bile acid sensor: farnesoid X receptor (FXR)........................................................................... 6 1.2.3.2 The short heterodimer partner (SHP) .............................................................................................. 7 1.2.3.3 The xenosenors: pregnane X receptor (PXR) and constitutive androstane receptor (CAR) ............ 8

1.3 THE VITAMIN D RECEPTOR (VDR)......................................................................................................... 9

1.3.1 VDR Protein Sequence Alignment in Human, Rat, and Mouse ........................................................ 10 1.3.2 VDR Ligands ..................................................................................................................................... 11

1.3.2.1 1,25-Dihydroxyvitamin D3 or 1,25(OH)2D3 ............................................................................... 11 1.3.2.2 1,25(OH)2D3 analogues ................................................................................................................. 12 1.3.2.3 Alternative VDR ligands............................................................................................................... 13

1.3.3 The VDR Ligand Binding Pocket...................................................................................................... 13 1.3.4 Physiological Role of the 1,25(OH)2D3-Liganded VDR ................................................................... 14 1.3.5 Disease Association with Vitamin D Deficiency............................................................................... 17

1.3.5.1 Hyperparathyroidism..................................................................................................................... 17 1.3.5.2 Cardiovascular disease and hypertension...................................................................................... 17 1.3.5.3 Inflammation and autoimmune disease ......................................................................................... 18 1.3.5.4 Diabetes......................................................................................................................................... 18 1.3.5.5 Cancer ........................................................................................................................................... 19

1.4 VDR ON TRANSPORTERS, ENZYMES, AND NUCLEAR RECEPTORS............................................. 20

1.4.1 VDR Regulates Phase I and Phase II Enzymes ................................................................................. 20 1.4.2 VDR Regulates Transporters ............................................................................................................ 21 1.4.3 VDR and Cross-Talk with Other Nuclear Receptors ........................................................................ 22 1.4.4 Significance of VDR in Transporters, Enzymes, and Nuclear Receptor Interactions........................ 22

1.5 BILE ACIDS AND CHOLESTEROL HOMEOSTASIS............................................................................. 25

1.5.1 Metabolic Pathways of Cholesterol Metabolism .............................................................................. 26 1.5.2 Regulation of Cholesterol Metabolism .............................................................................................. 27 1.5.3 Species Differences in Transporter and Enzyme Regulation............................................................. 29 1.5.4 The Link between VDR, Bile Acids and Cholesterol ........................................................................ 30

1.6 SIGNIFICANCE OF VDR IN REGULATION OF TRANSPORTERS AND ENZYMES ........................ 32

2.1 STATEMENT OF PURPOSE OF INVESTIGATION ................................................................................ 34

2.2 HYPOTHESES ............................................................................................................................................ 36

PAGE

vii

2.3 THESIS OUTLINE ...................................................................................................................................... 36

3. DIRECT AND INDIRECT EFFECTS OF THE VITAMIN D RECEPTOR (VDR) ON TRANSPORTERS AND ENZYMES IN THE RAT INTESTINE, LIVER AND KIDNEY IN VIVO........ 37

3.1 ABSTRACT ................................................................................................................................................. 38

3.2 INTRODUCTION........................................................................................................................................ 39

3.3 METHODS................................................................................................................................................... 44

3.3.1 Materials ............................................................................................................................................ 44 3.3.2 1,25(OH)2D3 and Vehicle (Corn Oil) Treatment in Rats In Vivo ....................................................... 45 3.3.3 Blood Analysis and Preparation of Tissues ....................................................................................... 45 3.3.4 Preparation of Subcellular Fractions from Enterocytes ..................................................................... 46 3.3.5 Preparation of Subcellular Fractions of Liver Tissue ........................................................................ 47 3.3.6 Liver Microsomal Cyp7a1 Activity ................................................................................................... 48 3.3.7 Western Blotting................................................................................................................................ 49 3.3.8 Quantitative Real-Time Polymerase Chain Reaction (qPCR) ........................................................... 50 3.3.9 Statistical Analysis............................................................................................................................. 51

3.4 RESULTS..................................................................................................................................................... 54

3.4.1 Effect of 1,25(OH)2D3 Treatment on Portal Bile Acid and ALT Levels ........................................... 54 3.4.2 Effect of 1,25(OH)2D3 Treatment on Nuclear Receptors (NRs), Enzymes and Transporters in

Intestinal Segments and Colon........................................................................................................... 54 3.4.2.1 Intestinal nuclear receptors, NRs................................................................................................... 54 3.4.2.2 Intestinal enzymes ......................................................................................................................... 58 3.4.2.3 Intestinal apical absorptive transporter, Asbt ................................................................................ 60 3.4.2.4 Intestinal apical efflux transporter, Mdr1a (P-gp) ......................................................................... 61 3.4.2.5 Intestinal apical efflux transporter, Mrp2...................................................................................... 61 3.4.2.6 Intestinal basolateral efflux transporter, Mrp3 .............................................................................. 62 3.4.2.7 Intestinal basolateral efflux transporter, Mrp4 .............................................................................. 62 3.4.2.8 Intestinal basolateral efflux transporter, Ost-Ost ...................................................................... 66

3.4.3 Effect of 1,25(OH)2D3 on Hepatic Nuclear Receptors, Enzymes, and Transporters ......................... 66 3.4.3.1 Hepatic nuclear receptors, NRs ..................................................................................................... 66 3.4.3.2 Hepatic cytrochrome P450, Cyps.................................................................................................. 67 3.4.3.3 Hepatic transporters....................................................................................................................... 67

3.4.4 Effect of 1,25(OH)2D3 on Nuclear Receptors, Enzymes, Drug Transporters in the Kidney.............. 68 3.4.4.1 Renal nuclear receptors, NRs ........................................................................................................ 68 3.4.4.2 Renal cytochrome P450, Cyps ...................................................................................................... 68 3.4.4.3 Renal transporters.......................................................................................................................... 69

3.5 DISCUSSION .............................................................................................................................................. 74

3.6 ACKNOWLEDGMENTS............................................................................................................................ 81

3.7 STATEMENT OF SIGNIFICANCE OF CHAPTER 3................................................................................ 81

4. 1,25-DIHYDROXYVITAMIN D3 UPREGULATES P-GLYCOPROTEIN ACTIVITIES, EVIDENCED BY INCREASED RENAL AND BRAIN EFFLUX OF DIGOXIN IN MICE IN VIVO ..... 83

4.1 ABSTRACT ................................................................................................................................................. 84

4.2 INTRODUCTION........................................................................................................................................ 85

4.3 METHODS................................................................................................................................................... 87

4.3.1 Materials ............................................................................................................................................ 87 4.3.2 Induction Studies with 1,25(OH)2D3 in fxr(+/+) and fxr(-/-) Mice In Vivo....................................... 88 4.3.3 Preparation of subcellular fractions ................................................................................................... 89 4.3.4 Western Blotting................................................................................................................................ 90

viii

4.3.5 Quantitative Real-Time Polymerase Chain Reaction (qPCR) ........................................................... 91 4.3.6 Pharmacokinetic Study of [3H]Digoxin in Vehicle or 1,25(OH)2D3 Treated Mice ........................... 92 4.3.7 [3H]Digoxin Analyses........................................................................................................................ 92 4.3.8 Modeling and Fitting ......................................................................................................................... 94

4.3.8.1 Whole body physiologically-based pharmacokinetic modeling (PBPK) ...................................... 94 4.3.8.2 Fitting ............................................................................................................................................ 96

4.3.9 Statistical Analysis............................................................................................................................. 97

4.4 RESULTS..................................................................................................................................................... 97

4.4.1 VDR and Mdr1a/P-gp mRNA and protein expression in the ileum, liver, kidney and brain of fxr(+/+) and fxr(-/-) mice .................................................................................................................. 97

4.4.1.1 Distribution of VDR protein expression among tissues ................................................................ 97 4.4.1.2 Effects of 1,25(OH)2D3 on Mdr1 mRNA and P-gp protein expression in both fxr(+/+) and

fxr(-/-) mice .................................................................................................................................... 98 4.4.2 Effects of 1,25(OH)2D3 Treatment on the Pharmacokinetics of [3H]Digoxin in fxr(+/+) Mice...... 102

4.4.2.1 Blood decay profiles and excretion of [3H]digoxin after intravenous administration in fxr(+/+) mice ............................................................................................................................... 102

4.4.3 Tissue Distribution........................................................................................................................... 106 4.4.3.1 Estimation of area under the curves (AUCs)............................................................................... 106 4.4.3.2 Tissue to blood AUC vs. time profile.......................................................................................... 106

4.4.4 Whole Body PBPK Modeling.......................................................................................................... 107

4.5 DISCUSSION ............................................................................................................................................ 116

4.6 APPENDIX ................................................................................................................................................ 120

4.7 ACKNOWLEDGMENTS.......................................................................................................................... 122

4.8 STATEMENT OF SIGNIFICANCE OF CHAPTER 4.............................................................................. 122

5. INHIBITION OF THE SMALL HETERODIMER PARTNER (SHP) BY 1,25-DIHYDROXYVITAMIN D3-LIGANDED VITAMIN D RECEPTOR (VDR) REMOVED THE REPRESSION ON CYTOCHROME 7-HYDROXYLASE (CYP7A1) AND INDUCED CHOLESTEROL LOWERING ................................................................................................................. 124

5.1 ABSTRACT ............................................................................................................................................... 125

5.2 INTRODUCTION...................................................................................................................................... 125

5.3 METHODS................................................................................................................................................. 129

5.3.1 Materials .......................................................................................................................................... 129 5.3.2 Plasmids........................................................................................................................................... 129 5.3.3 1,25(OH)2D3 Treatment of Mice ...................................................................................................... 130 5.3.4 Preparation of Subcellular Tissue Fractions .................................................................................... 131 5.3.5 Immunostaining ............................................................................................................................... 131 5.3.6 Real-Time PCR (qPCR)................................................................................................................... 132 5.3.7 Western Blotting.............................................................................................................................. 132 5.3.8 Cyp7a1 Activity in Microsomes ...................................................................................................... 132 5.3.9 Blood Analyses.............................................................................................................................. 133 5.3.10 Liver Cholesterol ............................................................................................................................. 133 5.3.11 Mouse Primary Hepatocyte Isolation............................................................................................... 134 5.3.12 Cell Culture and Transfection Assays.............................................................................................. 134 5.3.13 Preparation of Nuclear Protein Extracts........................................................................................... 135 5.3.14 Electrophoretic Mobility Shift Assay (EMSA)................................................................................ 135 5.3.15 Statistics........................................................................................................................................... 136

5.4 RESULTS................................................................................................................................................... 136

5.4.1 VDR Protein in Mouse Liver............................................................................................................ 136

ix

5.4.2 1,25(OH)2D3 Increases Hepatic Cyp7a1, Decreases Hepatic SHP and Lowers Cholesterol In Vivo .................................................................................................................................................. 138

5.4.3 Correlation Between Cyp7a1 and SHP But Not FGF15.................................................................... 138 .4.4 1,25(OH)2D3 Lowers Cholesterol in C57BL/6 or fxr(+/+), fxr(-/-), and shp(-/-) Mice Fed a High

Fat/High Cholesterol Diet................................................................................................................. 142 5.4.5 1,25(OH)2D3 Increases Cyp7a1 mRNA and Inhibits SHP Levels in Mouse Primary Hepatocytes .... 143 5.4.6 VDR Activation Strongly Represses Mouse and Human SHP Promoter Activity .......................... 143

5.4.6.1 Binding to the VDREs of SHP.................................................................................................... 144 5.4.6.2 EMSA.......................................................................................................................................... 145

5.5 DISCUSSION ............................................................................................................................................ 151



6. CORRELATION BETWEEN TISSUE 1,25-DIHYDROXYVITAMIN D3 LEVELS AND GENE CHANGES: A TEMPORAL STUDY........................................................................................................ 158

6.1 ABSTRACT ............................................................................................................................................... 159

6.2 INTRODUCTION...................................................................................................................................... 159

6.3 METHODS................................................................................................................................................. 162

6.3.1 Materials .......................................................................................................................................... 162 6.3.2 Pharmacokinetic Study of 1,25(OH)2D3 in Mice ............................................................................. 162 6.3.3 Plasma Calcium and Phosphorus Analysis ...................................................................................... 163 6.3.4 Tissue 1,25(OH)2D3 Extraction and 1,25(OH)2D3 Enzyme-immunoassay (EIA) for Plasma and

Tissue Samples ................................................................................................................................ 163 6.3.5 Pharmacokinetic Analysis: Plasma Concentration-Time Profile ...................................................... 164 6.3.6 Preparation of Subcellular Protein Fractions of Kidneys................................................................. 164 6.3.7 Western Blotting.............................................................................................................................. 165 6.3.8 Quantitative Real-Time Polymerase Chain Reaction (real-time PCR or qPCR) ............................. 166

6.4 RESULTS................................................................................................................................................... 168

6.4.1 Plasma Concentration of 1,25(OH)2D3 and Calcium in Single and Multiple Doses of 1,25(OH)2D3 in Mice ....................................................................................................................... 168

6.4.2 Tissue Concentrations of 1,25(OH)2D3 in Single and Multiple Doses of 1,25(OH)2D3 in Mice ..... 170 6.4.3 Comparison of Renal Cyp24 mRNA and Protein in a Single or Multiple Doses of

1,25(OH)2D3 in Mice ....................................................................................................................... 171 6.4.4 Temporal Changes in Ileal Cyp24, TRPV6 and FGF15, Liver Cyp24, Cyp7a1 and SHP, and

Renal Cyp24, Mdr1 and TRPV6 mRNA Expressions after Multiple Doses of 1,25(OH)2D3 in Mice ................................................................................................................................................. 171

6.5 DISCUSSION ............................................................................................................................................ 176



7. GENERAL DISCUSSION AND CONCLUSIONS................................................................................... 180

REFERENCES ......................................................................................................................................................... 190

APPENDIX A1........................................................................................................................................................ 205

APPENDIX A2........................................................................................................................................................ 217

APPENDIX A3........................................................................................................................................................ 236

APPENDIX A4........................................................................................................................................................ 248

x

APPENDIX A5........................................................................................................................................................ 267

APPENDIX A6........................................................................................................................................................ 282

APPENDIX T1 ........................................................................................................................................................ 294

APPENDIX T2 ........................................................................................................................................................ 296

APPENDIX T3 ........................................................................................................................................................ 298

APPENDIX T4 ........................................................................................................................................................ 298

APPENDIX T5 ........................................................................................................................................................ 299

APPENDIX T6 ........................................................................................................................................................ 299

APPENDIX T7 ........................................................................................................................................................ 300

APPENDIX T8 ........................................................................................................................................................ 300

APPENDIX T9 ........................................................................................................................................................ 301

APPENDIX F1 ........................................................................................................................................................ 302

APPENDIX F2 ........................................................................................................................................................ 303

APPENDIX F3 ........................................................................................................................................................ 304

APPENDIX F4 ........................................................................................................................................................ 305

xi

LIST OF PUBLICATIONS

Peer Reviewed

1. Fan J, Wong B, Hochman J, Chow ECY, and Pang K S (2012) Intracellular stability and hepatic uptake of MK-8544, a cationic lipid nanoparticle/siRNA complex, in rat liver. (submitted).

2. Durk MR, Chow ECY, Henderson JT, and Pang KS (2012) Induction of P-glycoprotein by the Vitamin D receptor ligand, 1α,25-dihydroxyvitamin D3, reduces brain accumulation of amyloid-beta peptides. (submitted).

3. Chow ECY, Durk MR, Cummins CL and Pang KS (2011) 1α,25-Dihydroxyvitamin D3 upregulates P-glycoprotein via the vitamin D receptor and not farnesoid X receptor in both fxr(-/-) and fxr(+/+) mice and increased renal and brain efflux of digoxin in mice in vivo. J Pharmacol Exp Ther 337:846-859.

4. Maeng HJ, Durk MR, Chow ECY, Ghoneim R and Pang KS (2011) 1α,25-Dihydroxyvitamin D3 on intestinal transporter function: studies with the rat everted intestinal sac. Biopharm Drug Dispos 32:112-125.

5. Chow ECY, Sondervan M, Jin C, Groothuis GM and Pang KS (2011) Comparative effects of doxercalciferol (1α-hydroxyvitamin D2) versus calcitriol (1α,25-dihydroxyvitamin D3) on the expression of transporters and enzymes in the rat in vivo. J Pharm Sci 100:1594-1604.

6. Khan AA, Chow ECY, Porte RJ, Pang KS and Groothuis GM (2011) The role of lithocholic acid in the regulation of bile acid detoxification, synthesis, and transport proteins in rat and human intestine and liver slices. Toxicol In Vitro 25:80-90.

7. Chow ECY, Sun H, Khan AA, Groothuis GM and Pang KS (2010) Effects of 1α,25-dihydroxyvitamin D3 on transporters and enzymes of the rat intestine and kidney in vivo. Biopharm Drug Dispos 31:91-108.

8. Chow ECY, Maeng HJ, Liu S, Khan AA, Groothuis GM and Pang KS (2009) 1α,25-Dihydroxyvitamin D3 triggered vitamin D receptor and farnesoid X receptor-like effects in rat intestine and liver in vivo. Biopharm Drug Dispos 30:457-475.

9. Khan AA, Chow ECY, van Loenen-Weemaes AM, Porte RJ, Pang KS and Groothuis GM (2009) Comparison of effects of VDR versus PXR, FXR and GR ligands on the regulation of CYP3A isozymes in rat and human intestine and liver. Eur J Pharm Sci 37:115-125.

10. Khan AA, Chow ECY, Porte RJ, Pang KS and Groothuis GM (2009) Expression and regulation of the bile acid transporter, OST-OST in rat and human intestine and liver. Biopharm Drug Dispos 30:241-258.

11. Sun H, Zhang L, Chow ECY, Lin G, Zuo Z and Pang KS (2008) A catenary model to study transport and conjugation of baicalein, a bioactive flavonoid, in the Caco-2 cell monolayer: demonstration of substrate inhibition. J Pharmacol Exp Ther 326:117-126.

xii

12. Chow ECY, Liu L, Ship N, Kluger RH and Pang KS (2008) Role of haptoglobin on the uptake of native and beta-chain [trimesoyl-(Lys82)-(Lys82)] cross-linked human hemoglobins in isolated perfused rat livers. Drug Metab Dispos 36:937-945.

13. Chen Y, Whetstone HC, Youn A, Nadesan P, Chow ECY, Lin AC and Alman BA (2007) Beta-catenin signaling pathway is crucial for bone morphogenetic protein 2 to induce new bone formation. J Biol Chem 282:526-533.

Review article/Chapters

1. Chow ECY and Pang KS (2012) The segregated-flow model is important for consideration of drug absorption. Curr Drug Metab submitted

2. Maeng HJ, Chow ECY, Chen S, Fan J, and Pang KS (2011) Physiologically-based pharmacokinetic models In, Encyclopedia of Drug Metabolism and Interactions (Alexander V. Lyubimov, ed) Chapter 16, Wiley and Sons, New Jersey.

3. Pang KS, Sun H, and Chow ECY (2010) Impact of physiological determinants: flow, binding, transporters and enzymes on organ and total body clearances, in “Enzymatic- and Transporter-Based Drug-Drug Interactions: Progress and Future Challenges” (KS Pang, AD Rodrigues, and RM Peter, eds) Chapter 5, Springer, NY pp. 107-147.

4. Fan J, Chen S, Chow ECY and Pang KS (2010) PBPK modeling of intestinal and liver enzymes and transporters in drug absorption and sequential metabolism. Curr Drug Metab 11:743-761.

5. Sun H, Chow ECY, Liu S, Du Y and Pang KS (2008) The Caco-2 cell monolayer: usefulness and limitations. Expert Opin Drug Metab Toxicol 4:395-411.

Conference Abstracts

1. Chow ECY, Magomedova L, Patel R, Maeng HJ, Fan J, Durk MR, Irondi K, Cummins CL and Pang KS (2011) 1,25-Dihydroxyvitamin D3-liganded vitamin D receptor (VDR) derepressed cytochrome P450 7A1 (CYP7A1) and lowered cholesterol via inhibition of the small heterodimer partner (SHP). AAPS Annual Meeting, Washington, DC 2011. (recipient of 2011 AAPS Lilly Graduate Student Symposium Award)

2. Quach HP, Durk MR, Chow ECY, and Pang KS (2011) Vitamin D receptor (VDR) effects of lithocholic acid acetate (LCAa), an alternate VDR ligand, on liver, kidney and brain of mice mimic those of 1,25-dihydroxyvitamin D3. AAPS Annual Meeting, Washington DC, October 2011.

3. Durk MR, Chow ECY, and Pang KS (2011) Regulation of brain P-glycoprotein by the vitamin D receptor leads to reduced accumulation of beta amyloids. AAPS National Biotechnology Conference, San Francisco, CA, 2011. (received 2011 AAPS Innovation in Biotechnology Award)

4. Chow ECY, Maeng HJ, Khan AA, Groothuis GM.M, Pang KS (2009) 1α,25-Dihydroxyvitamin D3 triggered vitamin D receptor and farnesoid X receptor-like effects in rat intestine, liver, and kidney in vivo. AAPS Annual Meeting, Los Angeles, CA 2009.

xiii

5. Fan J, Wong B, Chow ECY, Hochman J, Pang KS (2009) Evaluation of intracellular stability and hepatic uptake of MK-8544, a cationic lipid nanoparticle/siRNA complex in the single pass perfused rat liver. AAPS Annual Meeting, Los Angeles, CA 2009.

6. Khan AA, Chow ECY, Pang KS, Groothuis GMM (2008) Expression and regulation of organic solute transporter (OST/) in rat intestine. ISSX Europe, Vienna, 2008.

7. Chow ECY, Liu S, Khan AA, Groothuis GMM and Pang KS (2008) Effects of 1α,25-dihydroxyvitamin D3, the natural ligand of the vitamin D receptor (VDR), on transporters, enzymes, and nuclear receptors in the rat intestine and liver. AAPS Annual Meeting, Atlanta, GA, 2008.

8. Chow ECY, Pang KS (2007) Effects of 1α,25-dihydroxyvitamin D3 on rat intestinal transporters and enzymes involved in bile acid homeostasis by the vitamin D receptor (VDR). Pittsburgh, PA July 27-29, 2007. (Second prize poster award)

9. Chow ECY, Khan AA., Pang KS, Elferink MGL, Groothuis GMM (2007) Precision cut rat intestine tissue slices to study regulation of transporters and enzymes involved in bile acid homeostasis by the vitamin D receptor (VDR): validation with in vivo data. AAPS Workshop, Transporters in ADME, from Bench to Bedside III. Bethesda, MD March 5-7, 2007.

10. Zhao C, Fischer H, Liu J, Liu L, Bergin C, Chow ECY, Chan WCW, Pang KS (2006) Nanogold particles of varying sizes to define changes in permeability of the normal, sham-operated, and metastatic perfused rat liver. Boston, June 2006. (poster award winner)

11. Sun H., Zhang L, Chow ECY, Lin G, Zuo Z, Pang KS. Modeling of transport and metabolism of baicalein (B), a bioactive flavone Chinese herbal medicine, and baicalein 7-glucuronide (BG) in Caco-2 cells. AAPS, October, San Antonio 2006.

12. Chow ECY, Ship N, Liu L, Kluger R, Pang KS. The role of haptoglobin on the uptake of native and cross-linked human hemoglobins in rat liver. First Great Lakes Symposium on Pharmaceutical Sciences at University of Toronto. Toronto July, 2005.

xiv

ABBREVIATIONS AND TERMS 1,25(OH)2D3 1α,25-dihydroxyvitamin D3 or calcitriol

7α-HCO 7α-hydroxy-4-cholesten-3-one

7β-HCO 7β-hydroxycholesterol

ABC ATP-binding cassette

ALT alanine aminotransferase

APC antigen presenting cells

Asbt/ASBT rodent/human apical sodium dependent bile acid transporter

AUC area under the curve

BARE bile acids response element

B/P blood/plasma concentration ratio

Bsep/BSEP rodent/human bile salt export pump

CA cholic acid

Caco-2 human epithelial colorectal adenocarcinoma cell line

cAMP cyclic adenosine monophosphate

CAR constitutive androstane receptor

CaSR calcium-sensing receptor

CDCA chenodeoxycholic acids

CETP cholesteryl ester transfer protein

Cyp24/CYP24 rodent/human cytochrome P450 24-hydroxylase

cGMP cyclic guanosine monophosphate

CHAPS 3-[(3-cholamidopropyl)dimethylammonio]-1-

propanesulfonate

CL clearance

CNS central nervous system

CT calcitonin

Cyp/CYP cytochrome P450 enzyme

DCA deoxycholic acid

DDI drug-drug interaction

DTT dithiothreitol

xv

EHBR Eisai hyperbilirubinemic rat

EHC enterohepatic circulation

EIA enzyme-immunoassay

fP and fB unbound fraction in plasma and blood, respectively

FGF fibroblast growth factor

FGFR fibroblast growth factor receptor

FR fraction reabsorbed

FXR farnesoid X receptor

Gapdh/GAPDH rodent/human glyceraldehyde-3-phosphate dehydrogenase

HDL-C high-density lipoprotein cholesterol

HEK293 human embryonic kidney 293 cell line

HepG2 human hepatocellular liver carcinoma cell line

HIV human immunodeficiency virus

HNF hepatocyte nuclear factor

HPLC high pressure liquid chromatography

ICP-AES inductively coupled plasma atomic emission spectroscopy

INF-γ interferon gamma

IL interleukin

k elimination rate constant

ka absorption rate constant

KTB tissue/blood partition coefficient

LCA lithocholic acid

LRH-1 liver receptor homolog-1

LXRα liver X receptor alpha

Mdr1/MDR1/P-gp rodent/human multidrug resistance protein 1 or P-

glycoprotein (P-gp)

Mrp/MRP rodent/human multidrug resistance associated protein

MSC model selection criterion

NADPH nicotinamide adenine dinucleotide phosphate

Ntcp/NTCP rodent/human sodium taurocholate co-transporting

polypeptide

xvi

Oatp/OATP rodent/human organic anion transporting polypeptides

Ost/OST organic solute transporter

PBPK physiologically-based pharmacokinetic

PMSF phenylmethylsulfonyl fluoride

PPAR peroxisome proliferator-activated receptor

PTH parathyroid hormone

PTG parathyroid gland

PXR pregnane X receptor

Q organ flow rate

RXRα retinoid X receptor alpha

SHP short heterodimer partner

SLC solute carriers

Sult2a1/SULT2A1 rodent/human hydroxysteroid sulfotransferase 2A1

TBS-T Tris-buffered saline with 0.1% Tween 20

TGF-1 transforming growth factor beta 1

TNF-α tumor necrosis factor alpha

TRPV transient receptor potential cation channel, subfamily V

UGT UDP-glucuronosyltransferase

V blood and tissue volumes

VDR vitamin D receptor

VDRE vitamin D response element

xvii

LIST OF TABLES

Chapter 1

Table 1-1 A summary table of common nuclear receptors/transcription factors and

their ligands that when activated, changes the level of transporters and

enzymes and other nuclear receptors/transcription factors

Table 1-2 Regulation of enzymes by VDR activation

Table 1-3 Regulation of transporters by VDR activation

Table 1-4 Regulation of nuclear receptor cross-talked by VDR activation

Chapter 3

Table 3-1 Rat primer sets for quantitative real-time PCR

Table 3-2 Changes in body weight and blood analysis with various intraperitoneal

injections of 1,25-dihydroxyvitamin D3 treatment for 4 days to the rat in

vivo

Table 3-3 Changes in mRNA expression of rat hepatic nuclear receptors, enzymes, and

transporters, expressed as fold expression compared to vehicle treatment

Table 3-4 Changes in mRNA expression of rat renal nuclear receptors, enzymes, and

transporters, expressed as fold expression compared to vehicle treatment

Chapter 4

Table 4-1 Mouse primer sets for quantitative real-time PCR

Table 4-2 Noncompartmental estimates of digoxin parameters in tissue and blood of

vehicle- and 1,25(OH)2D3-treated wild-type mice

Table 4-3 Assigned parameters for PBPK modeling of [3H]digoxin for fxr(+/+) mice

which were treated i.p. with vehicle (0) or 2.5 μg/kg of 1,25(OH)2D3 every

other day for 8 days

Table 4-4 Fitted parameters (±SD) for [3H]digoxin for fxr(+/+) mice treated i.p. with

vehicle (0) or 2.5 μg/kg of 1,25(OH)2D3 every other day for 8 days based on

the PBPK model shown in Fig. 4-1

xviii

Table 4-5 Correlation between fold-changes in protein expression of P-gp (from

Western blotting in Fig. 4-3) and ratio of the estimated apparent efflux

intrinsic clearances of P-gp (from PBPK modeling) between the

1,25(OH)2D3- and vehicle-treated mice

Chapter 5

Table 5-1 Mouse Primer Sequences

Chapter 6

Table 6-1 Mouse primer sets for quantitative real-time PCR

Table 6-2 Pharmacokinetic parameters of 1,25(OH)2D3 in mice

xix

LIST OF FIGURES Chapter 1

Figure 1-1 Common nuclear receptor structure

Figure 1-2 Bioactivation of vitamin D

Figure 1-3 Alternative Vitamin D analog and LCA derivative structures from Brown

and Sltopolsky (2008) and Ishizawa et al. (2008)

Figure 1-4 1,25(OH)2D3 and plasma calcium homeostasis

Figure 1-5 Regulation of Cyp7a1 by bile acids in the liver

Figure 1-6 Species differences in negative feedback regulation of rat and mouse Asbt

Chapter 3

Figure 3-1 Distribution and dose-dependent effects of 1,25(OH)2D3 on rat intestinal

VDR mRNA and protein

Figure 3-2 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal (A)

FXR (B) SHP and (C) LRH-1 mRNA

Figure 3-3 Dose-dependent effects of 1,25(OH)2D3 on intestinal FGF15 mRNA in the

ileum

Figure 3-4 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Cyp3a

enzymes

Figure 3-5 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Cyp24

mRNA

Figure 3-6 Dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of

Asbt in the ileum

xx

Figure 3-7 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Mdr1a

mRNA and P-gp protein

Figure 3-8 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal

mRNA and protein of Mrp2





Figure 3-11 Dose-dependent effects of 1,25(OH)2D3 on intestinal Ostα and Ostβ mRNA

in the ileum

Figure 3-12 Dose-dependent effects of 1,25(OH)2D3 on changes in protein of hepatic

cytochrome P450 isozymes (A), and sinusoidal (B) and canalicular (C)

transporters

Figure 3-13 Dose-dependent effects of 1,25(OH)2D3 on changes in (B) protein of renal

nuclear receptor, cytochrome P450 isozymes and transporters

Figure 3-14 A schematic diagram highlighting direct and indirect effects of 1,25(OH)2D3

on intestinal and hepatic nuclear receptors, drug transporters and enzymes

Chapter 4

Figure 4-1 Whole body PBPK modeling with enterohepatic circulation and renal

reabsoprtion of [3H]digoxin

Figure 4-2 Effects of 1,25(OH)2D3 on VDR (A) mRNA and (B) protein expression in

the ileum, liver, kidney, and brain

xxi

Figure 4-3 Effects of 1,25(OH)2D3 on Mdr1 (A) mRNA and (B) P-gp protein in the

brain, kidney, liver, and ileum

Figure 4-4 Plots of [3H]digoxin (A) blood concentration, and cumulative amounts in (B)

urine and (C) feces vs. time

Figure 4-5 Plot of the amount [3H]digoxin excreted to (A) urine and (B) feces vs. the

blood AUC(0→t)

Figure 4-6 Plots of amount [3H]digoxin in (A) small intestine, (B) liver, (C) kidney, (D)

brain, and (E) heart

Figure 4-7 Tissue to blood AUC ratio of [3H]digoxin over time profile for the (A) small

intestine, (B) liver, (C) kidney, (D) brain and (E) heart

Figure 4-8 Simulation of [3H]digoxin concentrations vs. time for (A) blood, (B) kidney

and (C) brain, and amounts vs. time in urine (D)

Chapter 5

Figure 5-1 Tissue distribution and localization of the VDR

Figure 5-2 Effect of 1,25(OH)2D3 treatment on (A) serum bile acids and plasma and

liver cholesterol and (B) Cyp7a1 mRNA and protein expressions and

activity in fxr(+/+) and fxr(-/-) mice

Figure 5-3 Changes in (A) hepatic FXR, SHP, LRH-1, LXR, and HNF-4 and (B)

ileal FXR, SHP, LRH-1, FGF15, and Asbt mRNA expressions in both

fxr(+/+) and fxr(-/-) mice

xxii

Figure 5-4 Correlation between murine Cyp7a1 mRNA, protein, and catalytic activity

vs. SHP mRNA (A, left column) and FGF-15 mRNA (B, right column) in

fxr(+/+) mice which were treated with 1,25(OH)2D3

Figure 5-5 Effects of 1,25(OH)2D3 treatment on (A) serum bile acids and plasma and

liver cholesterol and (B) Cyp7a1 mRNA and protein expressions in wild-

type, fxr(-/-) and shp(-/-) mice prefed with a high fat/high cholesterol diet (n

= 4-6) for 3 weeks

Figure 5-6 Changes in (A) hepatic FXR, SHP, LRH-1, LXR, and HNF-4 and (B)

ileal FXR, SHP, LRH-1, FGF15, and Asbt mRNA expressions in wild-type,

fxr(-/-) and shp(-/-) mice prefed with a high fat/high cholesterol diet (n = 4-6)

for 3 weeks

Figure 5-7 Gene expression changes in mouse primary hepatocytes treated with 100 nM

1,25(OH)2D3

Figure 5-8 1,25(OH)2D3 suppresses SHP expression via direct binding of VDR to a

DR3 response element located within the proximal SHP promoter

Chapter 6

Figure 6-1 Plasma 1,25(OH)2D3 and calcium concentration-time profiles after (A) a

single dose or (B) multiple doses of 2.5 µg/kg i.p. 1,25(OH)2D3 or vehicle to

mice.

Figure 6-2 Tissue (ileum, liver, kidney, and brain) 1,25(OH)2D3 concentration-time

profile from (A) a single dose or (B) multiple doses of 2.5 µg/kg i.p.

1,25(OH)2D3 to mice

xxiii

Figure 6-3 Renal Cyp24 mRNA and protein expressions resulted in (A) a single dose or

(B) multiple doses of 2.5 µg/kg i.p. 1,25(OH)2D3 to mice

Figure 6-4 mRNA expressions of (A) ileal Cyp24, TRPV6 and FGF15, (B) hepatic

Cyp24, Cyp7a1 and SHP, and (C) renal Cyp24, Mdr1 and TRPV6 after

multiple doses of 2.5 µg/kg i.p. 1,25(OH)2D3 to mice

Chapter 7

Figure 7-1 Summary of nuclear receptor, transporter and enzyme changes in the

intestine, liver, and kidney of the rat treated with 1,25(OH)2D3

Figure 7-2 VDR increases cholesterol metabolism and lowers cholesterol via repression

of hepatic SHP (major mechanism) and possibly intestinal FGF15 (minor

mechanism)

1

CHAPTER 1

THE VITAMIN D RECEPTOR (VDR)

2

1.1 INTRODUCTION

Transporters and enzymes play a critical role in the biological fates of endo- and

exogenous molecules. In the past few decades, much was learnt on how the transporters

and enzymes are regulated in the body, especially in the small intestine, liver, and kidney. It

is now known that nuclear receptors and transcription factors play a crucial role in

regulating the existence of these proteins (Mangelsdorf et al., 1995; Makishima, 2005). All

nuclear receptors have a common structure (Fig. 1-1), which includes an amino terminal

ligand-independent activation domain (AF-1) for the interaction with cofactors, a central

DNA binding domain (DBD) consisting of two zinc finger motifs and targets the nuclear

receptor to highly specific DNA sequences or DNA response elements, a hinge region, and

a carboxy-terminal ligand binding domain (LBD) that differs for every nuclear receptor and

allows for specific hormonal and nonhormonal ligand binding, receptor dimerization and

coregulator interactions (AF-2) for biological response (Mangelsdorf et al., 1995; Wagner

et al., 2011). These nuclear receptors contain variable length and sequences in the N-

terminal and C-terminal domains and the length of the hinge region between the DBD and

LBD. In absence of a ligand, nuclear receptors are either located unliganded in the

cytoplasm or in the nucleus binding to their DNA response elements repressed by a

corepressor complex. In the presence of a ligand, they can form as a homo- or heterodimers

with each partner, acting as a transcription factor and binding to a specific response element

sequence that is present as half-sites of direct or inverted repeats separated by different

length of nucleotides (Olefsky, 2001). Currently, these nuclear receptors are categorized

into four different classes (Mangelsdorf et al., 1995): Class 1 nuclear receptors are known

as steroid hormone nuclear receptors, functioning as homodimers binding to response

3

element of inverted repeats; Class 2 nuclear receptors are adopted orphan nuclear receptors

that form heterodimer with retinoid X receptors (RXR) and function in a ligand dependent

manner; Class 3 and Class 4 receptors are orphan receptors that function as homodimers

binding to direct repeats in the response element or as momers binding to a single site

response element, respectively. The NR1 superfamily is commonly known for their role in

the regulation of transporters and enzymes affecting the balance of not only endogenous

molecules such as cholesterol, bile acids, and ions, but as well as the disposition of

xenobiotics.

1.2 TRANSPORTERS AND ENZYMES AND THEIR REGULATION BY

NUCLEAR RECEPTORS

It has long been known that adaptive biological responses are present in the body to

combat potential toxic effects of foreign substances such as xenobiotics. Early studies have

illustrated that phenobarbtial treatment decreased the plasma concentration of phenytoin

and coumarin anticoagulants, most likely due to upregulation of drug metabolism or

elimination to increase clearance (Cucinell et al., 1963; Schoene et al., 1972; Remmer et al.,

1973). Studies later revealed that a transcriptional mechanism was involved in the increase

in hepatic drug metabolism (Adesnik et al., 1981), likely due to presence of a xenobiotic

sensing and response system. Today, we know that proteins in the cell such as CYP and

membrane proteins on cell membrane bilayers, known as transporters, are responsible for

the fate of both endogenous molecules such as bile acids and cholesterol and xenobiotics,

DBD LBDAF-1 AF-2Hinge N CDBD LBDAF-1 AF-2Hinge N C

Figure 1-1 Common nuclear receptor structure

4

and that they are under the regulation of nuclear receptors that effect changes in levels of

proteins and in turn, alter the disposition of these molecules. A summary table of the

ligands for various nuclear transporters is listed in Table 1-1.

Table 1-1 A summary table of common nuclear receptors/transcription factors and their ligands, which when activated, could change levels of transporters and enzymes and other nuclear receptors/transcription factors

1.2.1 Enzymes

Drug metabolism is one of the major routes of drug clearance or elimination. These

enzymes include the Phase I enzymes such as the cytochrome P450s (CYP) and reductases,

sulfatases, and glucuronidases, and Phase II enzymes for sulfation (SULT), glucuronidation

(UGT), glutathione conjugation (GST), N-acetylation (NAT), and methylation

(methyltransferases) (Grant et al., 1991; Omura, 1999; Ritter, 2000; Venkatakrishnan et al.,

2001; Pang et al., 2010). CYP3A4 is the most abundant CYP isoform in the liver and

↑CYP7A1, ↑ABCG5, ↑ABCG8, ↑ ABCA1OxysterolLXR (Liver X Receptor)

↑CYP7A1, ↑ASBT LRH-1 (liver receptor homolog-1)

↑HNF-1α, ↑CYP27A1, ↑CYP8B1, ↑CYP7A1, ↑CYP3A

HNF-4α (Hepatocyte Nuclear Factor 4α)

↓LRH-1, ↓HNF-4α, ↓CYP7A1, ↓NTCP, ↓OATP1B1

SHP (Short Heterdimer Partner)

↑ SHP, ↓CYP7A1, ↑MRP2, ↑BSEPBile AcidsFXR (Farnesoid X Receptor )

↑CYP3A4, ↑SULT2A1, ↑ASBT, ↑MRP3 1,25(OH)2D3,

lithocholic acidVDR (Vitamin D Receptor)

↑CYP3A4, ↑CYP2C9, ↑ CYP2B6, ↑SULT2A1, ↑MRP2, ↑MRP3, ↑MRP4,

↑P-gpPhenobarbital

CAR (Constitutive AndrostaneReceptor)

↑CYP3A4, ↑ CYP2C9, ↑ CYP2B6, ↑SULT2A1, ↑UGT1A1, ↑rOatp1a4,

↑MRP2, ↑P-gp,

Rifampin, phenobarbital,

dexamethasone, PCNPXR (Pregnane X Receptor)

Target GenesLigandsNuclear Receptors/

Transcription Factors

↑CYP7A1, ↑ABCG5, ↑ABCG8, ↑ ABCA1OxysterolLXR (Liver X Receptor)

↑CYP7A1, ↑ASBT LRH-1 (liver receptor homolog-1)

↑HNF-1α, ↑CYP27A1, ↑CYP8B1, ↑CYP7A1, ↑CYP3A

HNF-4α (Hepatocyte Nuclear Factor 4α)

↓LRH-1, ↓HNF-4α, ↓CYP7A1, ↓NTCP, ↓OATP1B1

SHP (Short Heterdimer Partner)

↑ SHP, ↓CYP7A1, ↑MRP2, ↑BSEPBile AcidsFXR (Farnesoid X Receptor )

↑CYP3A4, ↑SULT2A1, ↑ASBT, ↑MRP3 1,25(OH)2D3,

lithocholic acidVDR (Vitamin D Receptor)

↑CYP3A4, ↑CYP2C9, ↑ CYP2B6, ↑SULT2A1, ↑MRP2, ↑MRP3, ↑MRP4,

↑P-gpPhenobarbital

CAR (Constitutive AndrostaneReceptor)

↑CYP3A4, ↑ CYP2C9, ↑ CYP2B6, ↑SULT2A1, ↑UGT1A1, ↑rOatp1a4,

↑MRP2, ↑P-gp,

Rifampin, phenobarbital,

dexamethasone, PCNPXR (Pregnane X Receptor)

Target GenesLigandsNuclear Receptors/

Transcription Factors

5

intestine and is involved in the biotransformation of many xenobiotics (Guengerich, 1999;

Dresser et al., 2000). In addition, endogenous substances, such as cholesterol and bile acids,

are found to be metabolized by this enzyme (Araya and Wikvall, 1999; Furster and Wikvall,

1999). Many of these enzymes are under the regulation of many nuclear receptors, which

will be discussed later. Thus, changes in the level of enzymes can ultimately change the

disposition of endogenous and exogenous molecules.

1.2.2 Transporters

Drug transport proteins transport endogenous and exogenous molecules in and out

of cells and are categorized into two major classes, the solute carriers (SLC) and ATP-

binding cassette (ABC) transporters (Dean and Allikmets, 2001; Kim, 2002b; Tirona and

Kim, 2005; Fredriksson et al., 2008; Szakacs et al., 2008; Klaassen and Aleksunes, 2011).

Solute carriers include the apical sodium dependent bile acids transporter (ASBT;

SLC10A2) in the ileum and kidney, sodium taurocholate cotransporting polypeptide

(NTCP; SLC10A1) in the liver, organic anion transporting polypeptides (OATPs) in the

intestine, liver and kidney, and organic solute transporters (OSTα-OSTβ) in the ileum and

liver where they are major proteins for the transport of bile acids in enterohepatic

recirculation. ASBT is present on the apical membrane for intestinal absorption and NTCP

and major OATPs on the sinusoidal membrane transport bile acids into hepatocytes,

whereas OSTα-OSTβ located on the basolateral membrane efflux bile acids out of the

intestine and liver. In addition to the transport of bile acids, some of these transporters such

as NTCP and OATPs are able to uptake exogenous molecules such as HMG-CoA reductase

inhibitors (statins) (Ho et al., 2006; Ho et al., 2007), angiotensin-converting enzyme

inhibitors (Liu et al., 2006a), angiotensin receptor II antagonists (Ishiguro et al., 2006) and

6

cardiac glycosides (König et al., 2006; Klaassen and Aleksunes, 2011). ATP-binding

cassette (ABC) transporters, present normally at the apical membrane, are able to efflux

molecules against a concentration gradient and utilize ATP. These transporters include the

apical membrane transporters, the bile acids export pump (BSEP; ABCB11) in the liver, the

multidrug resistance associated proteins 2 (MRP2; ABCC2) and the multidrug resistance

protein 1 or P-glycoprotein (MDR1/P-gp; ABCB1), and the basolateral transporter, MRP3

(ABCC3) in the intestine, liver, and kidney (Dean and Allikmets, 2001; Szakacs et al., 2008;

Klaassen and Aleksunes, 2011). MRP4 (ABCC4) is located on the basolateral membrane in

the intestine and liver, and on the apical membrane in the intestine and kidney (van Aubel

et al., 2002; Maeng et al., 2011). These ATP efflux transporters - BSEP, MRP2, MRP3, and

MRP4 - reduce the cellular concentration of bile acids (Zöllner et al., 2006), whereas P-gp

is found to play a role in the transport of cholesterol (Leon et al., 2006; Tamashevskii et al.,

2011). These transporters are cellular protective because they protect the cell from toxicity

by effluxing harmful drug molecules and their metabolites out of the cell. Over the past

decades, many studies have alluded to the fact that these SLC and ABC transporters are

under the regulation of nuclear receptors, and these changes can affect the disposition of

drug chemical entities.

1.2.3 The Bile Acid And Xenosensor Nuclear Receptors

1.2.3.1 The bile acid sensor: farnesoid X receptor (FXR)

The FXR is in the NR1 superfamily (NR1H4) and is known as a bile acids sensor

that affects the balance of bile acids and cholesterol in the body by regulating many bile

acid related transporters and enzymes, mainly in the liver and intestine. FXR is expressed

in liver, kidney, intestine and adrenal gland (Zhu et al., 2011). Bile acids, such as the

7

chenodeoxycholic acids (CDCA), lithocholic acid (LCA), deoxycholic acid (DCA), and

cholic acid (CA), and conjugates of the bile acids are the endogenous ligands of FXR

(Makishima et al., 2002). Activated FXR heterodimerizes with the retinoid X receptor

(RXR; NR2B1) to initiate in the transcription of genes (Goodwin et al., 2000). FXR

activation directly induces BSEP and MRP2 in the liver and OSTα-OSTβ in the ileum to

increase bile acid secretion (Zöllner et al., 2006). FXR indirectly reduces bile acid synthesis

by downregulating the cholesterol metabolizing enzyme, CYP7A1, through the induction

of another transcription factor, the short heterodimer partner (SHP; NR0B2), which inhibits

CYP7A1 transcription (Goodwin et al., 2000; Lu et al., 2000; Lee and Moore, 2002;

Zöllner et al., 2006). In mice and humans, intestinal ASBT is subject to negative feedback

regulation by FXR via SHP-dependent repression of the liver receptor homolog-1 (LRH-1;

NR5A2), a transcription factor, that regulates ASBT transcription (Chen et al., 2003). In

addition, bile acids can activate FXR to induce a hormonal signaling molecule, FGF15/19

(fibroblast growth factor 15 in rodents; FGF19 in humans) in the ileum to repress hepatic

CYP7A1 after entry into the liver via the membrane receptor FGFR4 (fibroblast growth

factor receptor 4), which, when activated, decreases CYP7A1 through the c- Jun kinase

signaling pathway in the liver (Wang et al., 2002; Inagaki et al., 2005).

1.2.3.2 The short heterodimer partner (SHP)

SHP is a unique transcription factor because it lacks an identified endogenous

ligand and belongs to the orphan member of the nuclear receptor superfamily (Seol et al.,

1996; Zhang et al., 2011). Moore and colleagues were one of the first to discover that SHP

functions as an atypical nuclear receptor because it lacks a DNA binding domain and

consists of a putative ligand binding domain (Seol et al., 1996). SHP acts as a

8

transcriptional repressor or coregulator of various nuclear receptors by interacting with

other transcription factors bound to DNA. SHP is expressed in the adrenal gland, stomach,

intestine, gall bladder, liver, kidney, ovary, and heart (Bookout et al., 2006), and has been

found to regulate mainly transporters and enzymes through protein-protein interactions

with other nuclear receptors and transcription factors to inhibit transcription (Zhang et al.,

2011). SHP is repressive on liver receptor homolog 1 (LRH-1; NR5A2) and hepatocyte

nuclear factor 4 (HNF-4; NR2A1) (Lee et al., 1998; Lee and Moore, 2002). SHP also

interacts with the liver X receptor (LXR; NR1H3), a stimulatory regulator of CYP7A1

that is activated by oxysterols (Brendel et al., 2002; Gupta et al., 2002; Schoonjans and

Auwerx, 2002) in the modulation of cholesterol absorption, transport, and elimination in

rodents but not man (Peet et al., 1998; Chiang et al., 2001; Goodwin et al., 2003). Most

studies focus on the role of SHP in the liver where it plays an important role in bile acids,

fatty acid and triglyceride biosynthesis, cholesterol transport, and drug and hormone

metabolism. SHP, as mentioned earlier, is a negative regulator of CYP7A1 in cholesterol

metabolism (Goodwin et al., 2000; Lu et al., 2000).

1.2.3.3 The xenosenors: pregnane X receptor (PXR) and constitutive

androstane receptor (CAR)

The pregnane X receptor (PXR; NR1I2) and the constitutive androstane receptor

(CAR; NR1I3) are members of the NR1 superfamily. These nuclear receptors

heterodimerize with RXR, which, when activated by a ligand, initiates gene transcription.

These nuclear receptors are commonly known as xenobiotic sensors due to their roles in the

regulation of transporters such as MRP and MDR1 and enzymes such as CYP, SULT, UGT

in affecting drug disposition (Reschly and Krasowski, 2006). PXR and CAR serve not only

9

to protect the body from harmful xenobiotics but also provide alternative pathways to lower

bile acid concentrations, mainly via enhanced metabolism (hydroxylation and conjugation),

and protect the liver from bile acid induced toxicity (Staudinger et al., 2001; Xie et al.,

2001; Guo et al., 2003).

1.3 THE VITAMIN D RECEPTOR (VDR)

The vitamin D receptor (VDR) is also part of the NR1 superfamily (NR1I1). In

rodents, the VDR is mainly localized in the intestine, kidney, skin, bone (Sandgren et al.,

1991), and low but detectable level in mouse and human livers (Gascon-Barré et al., 2003;

Song et al., 2009). 1,25-Dihydroxyvitamin D3 [1,25(OH)2D3] or calcitriol is the natural

ligand of the VDR. The VDR becomes a ligand-activated transcription factor when it is

bound to 1,25(OH)2D3, resulting in a conformational change of the receptor, which

translocates into the nucleus and heterodimerizes with the RXR (Dusso et al., 2005). This

complex then binds to the vitamin D response elements (VDREs) in the promoter region of

1,25(OH)2D3-responsive genes, recruiting nuclear proteins/coregulators into the

transcriptional pre-invitation complex to initiate gene transcription. The VDR shares

similar homology with PXR and CAR and can also be activated by lithocholic acid (LCA),

a toxic bile acid, to induce CYP3A as detoxicification pathways of bile acids (Reschly and

Krasowski, 2006). Interests in the VDR as a regulator in drug disposition initially arose

when 1,25(OH)2D3 was found to increase CYP3A4 and MDR1 in the intestinal Caco-2 cell

line (Schmiedlin-Ren et al., 1997). Because enzymes and transporters are important in the

absorption, distribution, metabolism and elimination of exogenous as well as endogenous

compounds for biological, pharmacological, and toxicological events, there is the need for

10

more studies to determine whether VDR, similar to PXR and CAR, plays an important role

in drug disposition.

1.3.1 VDR Protein Sequence Alignment in Human, Rat, and Mouse

Mouse, human and rat VDR protein alignments have been examined previously

(Kamei et al., 1995), showing that the DNA-binding domain is extremely highly conserved

across species (100%). The mouse VDR ligand-binding domain is 89% identical to that in

human and 96% identical to that in the rat (See APPENDIX F1). However, the mouse

hinge region is different from that of man and rat, and is only 55% identical to that in

human, and 78% identical to that in rat (Kamei et al., 1995).

7-dehydrocholesterol

Vitamin D(Cholecalciferol)

Liver

Kidney

1,25-dihydroxyvitamin D3Calcitriol

[1,25(OH)2D3]

25-hydroxyvitamin D3

UV270-300nm

CYP27A1(mitochondria)

CYP1α or CYP27B1(mitochondria)

7-dehydrocholesterol

Vitamin D(Cholecalciferol)

Liver

Kidney

1,25-dihydroxyvitamin D3Calcitriol

[1,25(OH)2D3]

25-hydroxyvitamin D3

UV270-300nm

CYP27A1(mitochondria)

CYP1α or CYP27B1(mitochondria)

Figure 1-2 Bioactivation of vitamin D

11

1.3.2 VDR Ligands

1.3.2.1 1,25-Dihydroxyvitamin D3 or 1,25(OH)2D3

1,25(OH)2D3 is formed via the sequential metabolism by the liver and kidney prior

to its binding and activation of the VDR (Fig. 1-2). There are two main forms of vitamin D;

vitamin D2, which comes from plants and vitamin D3, which comes from animals (Jones et

al., 1998). Vitamin D3 can be obtained from exogenous source such as milk and oily liver,

or produced endogenously by the exposure of UV rays from sunlight, converting 7-

dehydrocholesterol to vitamin D3 (Jones et al., 1998). Vitamin D3 is lipophilic and is stored

mainly in adipose tissue rather than circulating in blood (Heaney et al., 2009). However,

the first step in the bioactivation of vitamin D3 is by the hydroxylation of carbon 25, which

occurs primarily in the liver by 25-hydroxylases, CYP27A1 and CYP2R1 (Cheng et al.,

2003) to form 25-hydroxyvitamin D3 [25(OH)D3] in the nM range. Over 99% of vitamin D

metabolites are bind to plasma protein, mostly to the vitamin D binding protein (DBP) and

also to albumin and lipoproteins to a lesser extent. In plasma, 25(OH)D3, which exhibits the

highest binding affinity towards DBP and whose concentration is 20 times higher than

other vitamin D metabolites, is highly bound to plasma DBP (Cooke and Haddad, 1989).

The low concentration of free vitamin D metabolite such as 25(OH)D3 in plasma

contributes to reduced metabolism in tissues for elimination and a long circulating half life

(28 h) (Safadi et al., 1999). The 25(OH)D3-bound DBP complex is filtered through the

glomerulus in the kidney and is recognized and taken up by endocytic receptor, megalin,

present on the brush border of the renal proximal tubule cells (Safadi et al., 1999).

Once in tubular cells in the kidney, DBP is degraded by legumain (Yamane et al.,

2002), and the free 25(OH)D3 is metabolized by the mitochondrial 1-hydroxylase or

12

CYP27B1, to form the active 1,25(OH)2D3 (Fraser and Kodicek, 1970; Fu et al., 1997),

though there is recent evidence that the enzyme is also present in the brain and skin (Eyles

et al., 2005; Anderson et al., 2008). The plasma levels of vitamin D metabolites are

controlled by further hydroxylation, mostly in the kidney, by the 24-hydroxylase (CYP24),

at the C-24 position of both 25(OH)D3 and 1,25(OH)2D3 to produce 24,25-(OH)2D3 and

1,24,25(OH)2D3, respectively (DeLuca, 1988; Reddy and Tserng, 1989) or at other

positions (Wang et al., 2011b). The expressions of CYP1 and CYP24 are tightly regulated

in the kidney, which will be discussed later in the chapter.

1.3.2.2 1,25(OH)2D3 analogues

The four major vitamin D analogs (Fig. 1-3) have been used to treat

hyperparathyroidism due to their lower hypercalcemic side effects are 22-oxa-1,25(OH)2D3

or oxacalcitriol, 19-nor-1,25(OH)2D2, 1(OH)D2 or doxercalciferol, and 1,25(OH)2-26,27-

F6-D3 or falecalcitriol (Brown and Slatopolsky, 2008). 1-Hydroxyvitamin D2 or 1(OH)D2,

a prodrug of 1,25(OH)2D2, needs to be activated in the liver, and is less toxic than 1(OH)D3

(Sjoden et al., 1985). Similarly, 19-nor-1,25(OH)2D2 and 1(OH)D2 have been used to treat

chronic kidney disease (Brown and Slatopolsky, 2008). Calcipotriol is used to treat

psoriasis, having similar binding affinity for VDR compared to 1,25(OH)2D3 and 200 times

less potent. In addition, 1,25(OH)2-16-ene-23-yne-D3 (EB1089) has been used to treat

cancers such as leukemia, colon, breast and prostate cancer. MC1288 is used to suppress

immune cells in transplantation.

13

Figure 1-3 Vitamin D analogs and LCA derivative structures from Brown and Sltopolsky (2008) and

Ishizawa et al. (2008)

1.3.2.3 Alternative VDR ligands

Not all VDR analogs have a chemical structure similar to that of 1,25(OH)2D3.

Lithocholic acid (LCA), a secondary toxic bile acid, structurally dissimilar to 1,25(OH)2D3,

is also a VDR ligand (Makishima et al., 2002). This bile acid is found to activate VDR at

µM concentrations rather than pM concentrations for 1,25(OH)2D3, and regulates VDR

target genes such as Cyp24 and Cyp3a without triggering hypercalcemic effects

(Makishima et al., 2002; Nehring et al., 2007). There are increasing numbers of lithocholic

acid derivatives synthesized as an alternative VDR ligand (Ishizawa et al., 2008). LCA

acetate and LCA propionate (Fig. 1-3) are some of the recent developed VDR candidates to

be used as VDR modulators (Ishizawa et al., 2008).

1.3.3 The VDR Ligand Binding Pocket

Activation of the VDR requires binding of the ligand to the binding pockets of the

receptor. There is currently no crystal structure of the unoccupied ligand binding domain of

the VDR. However, upon ligand binding with 1,25(OH)2D3, many crystal structures exist,

14

and subsequent analyses reveal that there are residues in the ligand binding pocket that

interact with the ligand and trigger transcriptional activity (Vanhooke et al., 2004;

Yamagishi et al., 2006). In human VDR, 6 amino residues in the ligand binding pocket are

found to interact strongly, due to hydrogen bonding, to 3 hydroxyl groups on the

1,25(OH)2D3 molecule (Yamagishi et al., 2006): Ser237 and Arg274 interact to the 1

hydroxyl group; Tyr143 and Ser278 interact with the 3 hydroxyl group; His305 and His397

interact with the 25-hydroxyl group. Arg274 is found to form the strongest hydrogen bond

with 1,25(OH)2D3, and mutation of this residue is found in type II rickets (Yamagishi et al.,

2006). Similarly, the same type of amino acid residues are found in the ligand binding

pocket of the rat VDR, but at different positions, are found to interact with hydroxyl groups

of 1,25(OH)2D3 (Vanhooke et al., 2004): Ser233 and Arg270 interact to the 1 hydroxyl

group; Tyr143 and Ser274 interact with the 3 hydroxyl group; and His301 and His393

interact with the 25-hydroxyl group. However, there is no information about mouse VDR

ligand binding pocket; though it is speculated that the amino resides in the ligand binding

pocket would be similar to the human and rat, due to the similarity in the amino acids

binding sequence of the VDR protein (Kamei et al., 1995).

1.3.4 Physiological Role of the 1,25(OH)2D3-Liganded VDR

To date, vitamin D is not only known for its role for calcium and phosphate

homeostasis, but also known to control cell proliferation and differentiation, as well as

synthesis and secretion of cytokines and other hormones (Valdivielso et al., 2009). The

presence of the VDR in many tissues suggests a definitive role of 1,25(OH)2D3 in the body

(Andress, 2006; Wang et al., 2008b). Although 1,25(OH)2D3 could be synthesized in many

of these tissues, it is produced specifically for direct cell use, and not for mineral

15

requirements. The therapeutic use of 1,25(OH)2D3 for cancer, immune and endocrine

modulation has been abandoned due to its hypercalcemic side effects. Thus, many vitamin

D analogs have been produced to separate those effects (Fig. 1-3) (Brown and Slatopolsky,

2008; Ishizawa et al., 2008).

The function of the vitamin D endocrine system is to ensure that calcium (Fig. 1-4)

and phosphate are kept in balance for proper body functions. Thus, this system requires

adequate communication between organs, such as the kidney, bone, parathyroid gland and

intestine to maintain appropriate plasma levels of 1,25(OH)2D3. The physiological role of

1,25(OH)2D3 in plasma is to increase the absorption of calcium from the intestine,

reabsorption in the kidney and bone. In enterocytes of the small intestine, 1,25(OH)2D3 and

the VDR are required to induce epithelial calcium channels [transient receptor potential

cation channel, subfamily V, member 6 or TRPV6 (den Dekker et al., 2003)] for calcium

absorption from lumen, increase the transport of calcium across the cell by inducing

calbindin D9K, a cytosolic calcium binding protein, and elevate basolateral plasma

membrane ATPase (PMCA1) that transports calcium into the bloodstream (Dusso et al.,

2005). VDR activation also increases active phosphate transport through the induction of

the apical Na-Pi cotransporter in the intestine (Yagci et al., 1992). In bone, 1,25(OH)2D3

activates osteoblasts and stimulates the maturation of osteoclasts to resorb calcium from

bone and reverse transport calcium from bone compartment to plasma (Jones et al., 1998).

In kidney, 1,25(OH)2D3 upregulates TRPV5 and calbindin D28K to increase calcium

reabsorption (Enomoto et al., 1992; Dusso et al., 2005).

16

Figure 1-4 1,25(OH)2D3 and plasma calcium homeostasis

For control of plasma calcium, a negative feedback mechanism exists to reduce

1,25(OH)2D3 production and calcium reabsorption. The calcium-sensing receptor (CaSR) is

present in the parathyroid glands for the detection of plasma calcium (Jones et al., 1998). A

high concentration of 1,25(OH)2D3 and calcium in the plasma leads to inhibition of

parathyroid hormone (PTH) synthesis and secretion (Silver et al., 1996; Dusso et al., 2005),

and decreased plasma PTH leads to inhibition of 1-hydroxylase expression in the kidney

to reduce 1,25(OH)2D3 synthesis (Henry and Norman, 1984). 1,25(OH)2D3 can also

increase its own catabolism by upregulating the expression of its catabolic enzyme, CYP24,

in the kidney (Chen and DeLuca, 1995). In addition, calcitonin (CT), a 32-amino acid

polypeptide produced in the parafollicular cells of the thyroid gland is increased when

plasma calcium is high, and inhibits calcium absorption from the intestine and osteoclast

activity in bones (Jones et al., 1998). These events act as feedback controls and lead to

decreases in the plasma levels of 1,25(OH)2D3 and calcium.

Kidney

1,25(OH)2D3

PTH PTG

↑Ca2+

Parafollicular cells

CT

Suppression

Stimulation

17

1.3.5 Disease Association with Vitamin D Deficiency

Approximately 30 to 50% of the population in the United States is vitamin D

deficient (Lee et al., 2008; Wang et al., 2008b). Because 25(OH)D3 is the major metabolic

form of vitamin D in the plasma and represents the summation of both vitamin D intake

and vitamin D synthesized from sun exposure, it is used as an indicator to determine a

patient’s vitamin D status (Sarkinen, 2011). In humans, a plasma level of less than 50 nM

or 20 ng/ml of 25(OH)D3 is considered vitamin D deficient, whereas a level of more than

374 nM is considered toxic (Sarkinen, 2011). Bone diseases, such as rickets in children,

and osteomalacia and osteoporosis in adults are diseases found to be associated to vitamin

D deficiency (Sarkinen, 2011). However, over the last decade, studies have found that

numerous other diseases such as hyperparathyroidism, vascular stiffness, cardiovascular

disease, hypertension, inflammation, diabetes, and cancer have been linked to vitamin D

deficiency (Valdivielso et al., 2009).

1.3.5.1 Hyperparathyroidism

Increases in the parathyroid gland size and parathyroid hormone synthesis have

been found to be associated with a decrease in circulating plasma calcium (Jones et al.,

1998). This is usually associated with patients with chronic kidney diseases, as low or

inactive forms of 1,25(OH)2D3 are present in their plasma. Low concentrations of calcium

in the plasma triggers the parathyroid gland to stimulate the production of parathyroid

hormone, leading to hyperparathyroidism (Jones et al., 1998).

1.3.5.2 Cardiovascular disease and hypertension

Mice lacking the VDR show signs of hypertension and ventricular hypertrophy,

which are markers of cardiovascular disease (Xiang et al., 2005). In vitro studies of isolated

18

cardiomyocytes from VDR knockout mice are found to be associated with accelerated

contraction and relaxation rates (Tishkoff et al., 2008). However, 1,25(OH)2D3 treatment

has been found to regulate contractility, growth, hypertrophy, collagen deposition, and

differentiation of cardiomyocytes (O'Connell et al., 1995; Wu et al., 1996; O'Connell et al.,

1997; Rahman et al., 2007), suggesting an important role for the VDR in cardiac

physiology. There is also an association between low 25(OH)D3 levels in plasma and

higher risk of hypertension (Forman et al., 2007; Wang et al., 2008b), likely due to

alterations of the renin-angiotensin system. Studies have shown that inhibition of

1,25(OH)2D3 synthesis elevates renin expression and plasma angiotensin II synthesis,

leading to hypertension (Li et al., 2002; Yuan et al., 2007).

1.3.5.3 Inflammation and autoimmune disease

Vitamin D deficiency is associated with a number of autoimmune diseases, such as

multiple sclerosis, Crohn disease, diabetes mellitus, systemic lupus erythematosus (SLE),

asthma, Sjögren’s syndrome, systemic vasculitis and antiphospholipid syndrome (Zhang

and Wu, 2011). Studies have found that vitamin D plays a role in the immune system by

regulating functions of T cells, natural killer (NK) cells, B cells, and antigen presenting

cells (APCs) by reducing the release of inflammatory factors, such as of interleukin (IL)-1,

IL-2, tumor necrosis factor alpha (TNF-α), and interferon (INF)-γ, and elevating IL-10

synthesis (Cutolo et al., 2007; Almerighi et al., 2009; Zhang and Wu, 2011).

1.3.5.4 Diabetes

There are two forms of diabetes - type 1 diabetes that is the result of autoimmune

destruction of pancreatic β cells, which produced insulin, and type 2 diabetes in which there

is resistance to insulin and insulin secretion from pancreatic β cells (Seshadri et al., 2011) -

19

both types have been associated with vitamin D deficiency. Studies found that children

with serum 25(OH)D3 levels less than 15 ng/ml were more likely to have elevated blood

glucose levels than those having levels greater than 26 ng/ml (Reis et al., 2009). One

theory for this association might be that type 1 diabetes is associated with an imbalance of

pro-/anti-inflammatory cytokines such as transforming growth factor beta 1 (TGF-β1), INF-

γ, IL-1α, IL-1β, IL-4, IL-6, IL-12, and tumor necrosis factor (TNF)-α. These factors have

been found to be decreased with 1,25(OH)2D3 treatment (Zhang and Wu, 2011). In addition,

the VDR is present in pancreatic β cells. Thus, 1,25(OH)2D3 may play a role in insulin

secretion and insulin sensitivity in type 2 diabetes by either increasing the intracellular

calcium concentration via non-selective voltage-dependent calcium channels in the β-cell to

induce insulin secretion or by increasing the conversion of proinsulin to insulin (Seshadri et

al., 2011).

1.3.5.5 Cancer

A comprehensive review of anti-tumor effects of 1,25(OH)2D3 is found in Deeb et

al. (2007). Treatment with 1,25(OH)2D3 and vitamin D analogs has been found to disrupt

the G0/G1 cell cycle, differentiation, induction of apoptosis, and inhibition of angiogenesis

in tumors of prostate, ovary, pancreatic, breast and lung cancer (Colston et al., 1992;

Nakagawa et al., 2005; Zhang et al., 2005; Banach-Petrosky et al., 2006; Chiang and Chen,

2009). In addition, 1,25(OH)2D3 act synergistically with chemotherapeutic agents,

including platinum analogues, taxanes, and DNA-intercalating agents (Deeb et al., 2007).

One theory is that 1,25(OH)2D3 increases apoptosis in tumor cells, which is increased with

the genotoxic stimulus by chemotherapeutic drugs (Hershberger et al., 2002).

20

1.4 VDR ON TRANSPORTERS, ENZYMES, AND NUCLEAR RECEPTORS

1.4.1 VDR Regulates Phase I and Phase II Enzymes

Schmiedlin-Ren et al. (1997) studied the role of intestinal CYP3A4 in the oral

bioavailability of midazolam, and observed that 1,25(OH)2D3 induced intestinal CYP3A4

expression and increased midazolam metabolism. It was not until several years later that

this VDR mediated event was shown to be due to the presence of a VDRE in the human

CYP3A4 gene (Schmiedlin-Ren et al., 2001; Thummel et al., 2001). More studies (Table 1-

2) reported that 1,25(OH)2D3 treatment of human cell lines increased CYP3A4 in vitro

(Thompson et al., 2002; Pfrunder et al., 2003; Aiba et al., 2005; Wang et al., 2008a; Fan et

al., 2009). Later studies revealed that the inductive role of the VDR is not limited to

CYP3A4. The expression of human CYP3A4 as well as CYP2B6 and CYP2C9 was shown

to be induced with 1,25(OH)2D3 treatment in primary human hepatocytes (Reschly and

Krasowski, 2006). However, human CYP7A1, a cholesterol metabolizing enzyme, was

reported to be downregulated with 1,25(OH)2D3 treatment in primary human hepatocytes

and HepG2 cells, a human liver cancer cell line (Han and Chiang, 2009; Han et al., 2010).

In vivo studies found that rat Cyp3a9 (Zierold et al., 2006) and Cyp3a1/3a23 (Xu et al.,

2006), isoforms of the human CYP3A4, are induced in the intestine. Kutuzova and DeLuca

(2007) demonstrated that 1,25(OH)2D3 regulates genes for its detoxification in the rat

intestine, such as inducing the expression of the 1,25(OH)2D3 catabolic enzyme, Cyp24, as

well as Cyp3a1 and Cyp1a1. In rat and human intestinal slices, exposure of 1,25(OH)2D3

led to induced expression of Cyp3a1, Cyp3a2 and human CYP3A4 (Khan et al., 2009b).

Vitamin D analogs, such as 19-nor-1,25(OH)2D2, LCA, and 1(OH)D3, increased the

expression of CYP3A and Cyp24 (Schmiedlin-Ren et al., 2001; Thummel et al., 2001;

21

Makishima et al., 2002; Zierold et al., 2006; Nehring et al., 2007; Nishida et al., 2009;

Khan et al., 2011). In addition, 1,25(OH)2D3 treatment brought about increase phase II

enzymes such as sulfotransferases, human SULT2A1 (Echchgadda et al., 2004) and mouse

Sult2a2 (McCarthy et al., 2005), and the UDP glucuronosyltransferase, rat Ugt1a

(Kutuzova and DeLuca, 2007).

1.4.2 VDR Regulates Transporters

There are fewer studies on the regulation of transporters by the VDR. The classic

targets of 1,25(OH)2D3 have been known to regulate channels and transporters involved in

calcium, phosphate and sulfur homeostasis (Taketani et al., 1998; Dawson and Markovich,

2002; den Dekker et al., 2003). However, the role of VDR in xenobiotic transporters has

been studied less. Although induction of P-gp by 1,25(OH)2D3 treatment was observed in

various studies for a over a decade (Schmiedlin-Ren et al., 1997; Pfrunder et al., 2003; Aiba

et al., 2005; Fan et al., 2009), it is not until recently that Saeki et al. (2008) reported that a

VDRE exists in the human MDR1 genome. Many more studies (Table 1-3) have since

examined the role of VDR on transporters. In vivo, 1,25(OH)2D3 was shown to induce the

expression of murine multidrug resistance-associated protein 3 (Mrp3) (McCarthy et al.,

2005). Previously, our laboratory noted that a VDRE existed in the rat apical sodium

dependent bile acid transporter (Asbt) genome, and that induction of rat Asbt occurred with

1,25(OH)2D3 treatment to increase bile acid absorption in the ileum (Chen et al., 2006). Fan

et al. (2009) found that 1,25(OH)2D3 treatment of Caco-2 cells induces human MRP2 and

MRP4, through a post transcriptional event. Induction of mouse Mrp2, Mrp3, and Mrp4 in

vivo in rat and human intestinal slices was demonstrated to occur with vitamin D analogs,

LCA and 1(OH)D3 (Nishida et al., 2009; Ogura et al., 2009; Khan et al., 2011). One other

22

study further noted that the VDR played a role in intestinal folate transport in humans at

rats (Eloranta et al., 2009).

1.4.3 VDR and Cross-Talk with Other Nuclear Receptors

The cross-talk between VDR and other nuclear receptors has recently been

examined (Table 1-4). The VDR was found to inhibit the farnesoid X receptor (FXR)

(Honjo et al., 2006) and activation of the liver X receptor (LXR) (Jiang et al., 2006),

important regulators of bile acid and cholesterol homeostasis. Other studies further found

that the VDR positively impacted the expression of peroxisome proliferator-activated

receptor and (PPAR and PPAR) (Sertznig et al., 2009), and that PXR activation

could lead to vitamin D deficiency (Holick, 2005). Recently, a VDRE was found in the

fibroblast growth factor 15 (FGF15 or FGF19 in human), which is a negative regulator of

Cyp7a1 (Schmidt et al., 2010).

1.4.4 Significance of VDR in Transporters, Enzymes, and Nuclear Receptor

Interactions

The notion that the VDR may play a role in the regulation of transporters and

enzymes is now viewed as an understatement. Alterations in enzymes, transporters and

nuclear receptors by VDR ligands are listed in Table 1-2, 1-3, and 1-4, respectively. The

VDR regulates many enzymes such as CYPs, SULTs, and UGTs, and transporters such as

P-gp and MRPs, which are major players in the disposition of drugs. The role of the VDR

is not only limited to transporter and enzyme regulations, but may also plays a role in bile

acid and cholesterol homeostasis. Transporters and enzymes such as MRPs, CYP3A, and

23

CYP7A1 and nuclear receptors such as FXR and LXR, which are VDR targets, are

important components in bile acid formation and transport and cholesterol metabolism.

Table 1-2 Regulation of enzymes by VDR activation VDR Ligands Target Genes Species References 1,25(OH)2D3 ↑CYP3A4 LS180 (in vitro)

Caco-2 (in vitro) (Thummel et al., 2001)

1,25(OH)2D3 ↑CYP3A4 LS180 (in vitro) HPAC (in vitro) Human Hepatocytes (in vitro)

(Schmiedlin-Ren et al., 2001)

1,25(OH)2D3 ↑CYP3A4 HT-29 colorectal cell (in vitro) (Thompson et al., 2002)

1,25(OH)2D3 ↑CYP7A1 HepG2 (in vitro) Human Hepatocytes (in vitro)

(Han and Chiang, 2009)

1,25(OH)2D3 ↑CYP3A4 HepG2 (in vitro) Caco-2 (in vitro) Mouse Hepatocytes (in vitro)

(Wang et al., 2008a)

1,25(OH)2D3 ↑SULT2A1 (human, rat, mouse gene)

HepG2 (in vitro) Caco-2 (in vitro)

(Echchgadda et al., 2004)

1,25(OH)2D3 ↑Cyp3a9 Rat (in vivo) (Zierold et al., 2006) 1,25(OH)2D3 ↑Cyp24a1

↑Cyp3a1 ↑Cyp1a1 ↑Ugt1a

Rat (in vivo) (Kutuzova and DeLuca, 2007)

1,25(OH)2D3 ↑Cyp3a1/23 Rat (in vivo) (Xu et al., 2006) 1,25(OH)2D3 ↑Cyp24a1 Mouse (in vivo) (Intestine and

kidney) (Meyer et al., 2007)

1,25(OH)2D3 ↑CYP3A4 ↑CYP2B6 ↑CYP2C9

Human Hepatocytes (in vitro) (Drocourt et al., 2002)

1,25(OH)2D3 ↑CYP3A4 Caco-2 (in vitro) LS-180 (in vitro)

(Pfrunder et al., 2003)

1,25(OH)2D3 ↑CYP3A4 Caco-2 (in vitro) LS-180 (in vitro)

(Aiba et al., 2005)

1,25(OH)2D3 ↑Sult2a2 (colon) Mouse (in vitro) (McCarthy et al., 2005)

1,25(OH)2D3 ↑Cyp3a1 (rat intestine) ↑Cyp3a2 (rat intestine) ↑CYP3A4 (human intestine) ↑CYP3A4 (human liver)

Rat (in vitro) Human (in vitro)

(Khan et al., 2009b)

1,25(OH)2D3 ↓Cyp7a1 Human hepatocytes (in vitro) (Han et al., 2010) 1(OH)D3 ↑CYP3A4 Caco-2 (in vitro)

(Schmiedlin-Ren et al., 2001)

1(OH)D3 ↑CYP3A4 Caco-2 (in vitro) (Thummel et al., 2001)

1(OH)D3 ↑Cyp3a11 Mouse (in vivo) (Makishima et al., 2002)

24

19-nor-1,25(OH)2D2 ↑Cyp3a9 Rat (in vivo) (Zierold et al., 2006) 1(OH)D3 ↑Cyp24 (intestine

and kidney) ↑Cyp7a1 (liver)

Mouse (in vivo) (Nishida et al., 2009)

1(OH)D3 ↑Cyp7a1 (liver) Mouse (in vivo) (Ogura et al., 2009) LCA ↑Cyp24 Rat (in vivo) (intestine and

kidney) (Nehring et al., 2007)

LCA acetate ↓CYP7A1 HepG2 (in vitro) Human Hepatocytes (in vitro)


LCA ↑Cyp3a11 (intestine and liver)

Mouse (in vivo) (Makishima et al., 2002)

LCA ↑Cyp3a1 (rat intestine) ↑Cyp3a2 (rat intestine) ↑Cyp3a9 (rat intestine and liver) ↓Cyp7a1 (rat liver) ↑CYP3A4 (human intestine)


(Khan et al., 2011)

Table 1-3 Regulation of transporters by VDR activation VDR Ligands Target Genes Species References 1,25(OH)2D3 ↑MDR1 LS180 (in vitro) (Pfrunder et al.,

2003) 1,25(OH)2D3 ↑MDR1 LS180 (in vitro) (Aiba et al., 2005) 1,25(OH)2D3 ↑MDR1 Caco-2 (in vitro) (Saeki et al., 2008) 1,25(OH)2D3 ↑Mrp3 (colon) Mouse (in vivo)

MCA-38 (in vitro) (McCarthy et al., 2005)

1,25(OH)2D3 ↑MDR1 LS180 (in vitro) (Thummel et al., 2001)

1,25(OH)2D3 ↑Asbt (intestine) Rat (in vivo) (Chen et al., 2006) 1,25(OH)2D3 ↓Ostα (rat

intestine) ↓Ostβ (rat intestine) ↓Ostα (human liver)


(Khan et al., 2009a)

1,25(OH)2D3 ↑PepT1 (intestine) ↑Mrp2 (Intestine) ↑Mrp4 (Intestine)

Rat (in vivo) (Maeng et al., 2011)

1,25(OH)2D3 ↑PCFT Caco-2 (in vitro) (Eloranta et al., 2009)

1(OH)D3 ↑Mrp2 (kidney) ↑Mrp4 (kidney)

Mouse (in vivo) (Ogura et al., 2009)

1(OH)D3 ↑Asbt (intestine) ↑Mrp2 (kidney) ↑Mrp3 (kidney) ↑Mrp4 (intestine and kidney)

Mouse (in vivo) (Nishida et al., 2009)

LCA ↑Mrp3 (colon) Mouse (in vivo) MCA-38 (in vitro)

(McCarthy et al., 2005)

LCA ↑Mrp2 (rat Rat (in vitro) (Khan et al., 2011)

25

intestine) ↑Mrp2 (human intestine) ↑Mrp3 (human intestine)

Human (in vitro)

Table 1-4 Regulation of nuclear receptor cross-talk by VDR activation VDR Ligands Target Genes Species References 1,25(OH)2D3 VDR→↓FXR

→↓SHP HepG2 (in vitro) Caco-2 (in vitro)

(Honjo et al., 2006)

1,25(OH)2D3 VDR→↓LXRα →↓rCyp7a

HepG2 (in vitro) (Jiang et al., 2006)

1,25(OH)2D3 and LCA acetate

VDR→↓HNF-4α→↓CYP7A1

HepG2 (in vitro) Human Hepatocytes (in vitro)


1.5 BILE ACIDS AND CHOLESTEROL HOMEOSTASIS

Cholesterol is an important component in the structure of cell membranes and is a

precursor of steroids including corticosteroids, vitamin D, and bile acids. However, excess

cholesterol in blood can lead to atherosclerosis and coronary heart disease as well as

cerebrovascular disease. Methods to reduce blood cholesterol have become a popular

research goal. Most medications currently used to treat hypercholesterolemia include the

statins or HMG-CoA reductase inhibitors, niacin, and bile-acid sequestrants, which reduce

the amount of cholesterol synthesis in the liver or reduce the amount of dietary cholesterol

that is absorbed from the intestine (Gupta et al., 2010). Cholesterol homeostasis in

mammals is maintained through the coordinate regulation of several major pathways in

liver (Chiang, 2002): endocytosis of low-density lipoprotein (LDL) receptor uptake of

serum cholesterol esters; reverse cholesterol transport from peripheral tissues to the liver

and the uptake of high density lipoprotein (HDL) by the scavenger receptor subtype B1;

absorption of dietary cholesterol from the intestine to the liver by LDL receptor-mediated

mechanism of an endogenous biosynthetic pathway in which acetate is converted into

cholesterol by HMG-CoA reductase.

26

1.5.1 Metabolic Pathways of Cholesterol Metabolism

In mammals, excess cholesterol is metabolically biotransformed to form bile acids,

whereas a small portion of cholesterol is used to synthesize steroid hormones (Boggaram et

al., 1984; Rezen et al., 2010). There are two major pathways in the formation of bile acids

from cholesterol in the liver, the classic and alternative pathways (Chiang, 2004).

Cytochrome P450 7A1 or cholesterol 7-cholesterase (CYP7A1) catalyzes the first and

rate-limiting enzymatic reaction in the classical pathway, whereas the alternate pathway is

catalyzed by CYP27A1 and CYP7B1 (Russell and Setchell, 1992; Javitt, 1994). Cholic acid

and chenodeoxycholic acid are the primary bile acids synthesized from cholesterol (Chiang,

2002). The bile acids are then conjugated with taurine or glycine before being excreted into

bile by canalicular transporters such as BSEP and MRP2 (Kullak-Ublick et al., 2000). The

function of bile acids in the small intestine is to act as detergent-like molecules to facilitate

lipid uptake as mixed micelles (Hofmann, 1999). In humans, about 95% of bile acids are

reclaimed through the ASBT in enterocytes of the ileum (Shneider, 2001; Chiang, 2002).

Once taken up into enterocytes, bile acids are bound to intracellular trafficking proteins, the

ileal lipid binding protein or ileal bile acid-binding protein (ILBP or I-BABP) (Sacchettini

et al., 1990), and are shuttled to the basolateral surface for efflux into the portal blood via

OST-OST (Dawson et al., 2005) and MRP3 (McCarthy et al., 2005). Hepatic uptake

transporters on the sinusoidal membranes such as Na+-taurocholate cotransporting

polypeptide (NTCP), which belongs to the same family of transporters as ASBT

(Hagenbuch and Meier, 1994), and organic anion-transporting polypeptides (OATPs)

(Zöllner et al., 2006) can mediate uptake of bile acids into hepatocytes and transport

amphipathic endogenous and exogenous organic compounds (Hagenbuch and Meier, 2004),

27

completing the enterohepatic circulation of bile acids. MRP3 and MRP4, which are located

at the basolateral membrane of hepatocytes, are capable of transporting bile acids back to

blood, but are present at low expression (Zöllner et al., 2006) unless MRP2 is compromised

or upon bile duct ligation (Akita et al., 2001; Akita et al., 2002; Ogura et al., 2009). Bile

acids that escape hepatic uptake can be filtered by the glomerulus, excreted in urine by

renal Mrp4 (Nishida et al., 2009), or be reabsorbed back to blood by ASBT and OST-

OST (Dawson et al., 2009), depending on the blood bile acid concentrations.

1.5.2 Regulation of Cholesterol Metabolism

Bile acids are detergent-like molecules and are toxic when they accumulate at high

concentration (Hofmann, 1999). Thus, the body controls tightly bile acid synthesis and

transport (Fig. 1-5). Numerous nuclear receptors, upon activation by their ligand, have been

found to affect cholesterol metabolism by regulating the amount of CYP7A1. The promoter

of the CYP7A1 gene contains a hexameric repeat of nucleotide sequence (AGGTCA), the

bile acid response element (BARE) that is highly conserved among species (Chiang, 2003).

LRH-1 and HNF-4α are transcription factors that increase CYP7A1 transcription (Chiang

and Stroup, 1994; Crestani et al., 1998; Goodwin et al., 2000). The murine liver X receptor

α (LXRα; NR1H3), upon transactivation with excess oxysterols, increases Cyp7a1 to

increase cholesterol metabolism (Chiang et al., 2001). Excess bile acids evoke a negative

regulatory pathway to reduce CYP7A1 transcription because bile acids are ligands of the

FXR that negatively regulates CYP7A1 (Goodwin et al., 2000; Lu et al., 2000). Upon FXR

activation of SHP, inhibition of binding of LRH-1, a competency factor, and HNF-4α to the

CYP7A1 promoter region (Chiang, 2002) occurs. FXR can also reduce bile acid

accumulation in liver directly by decreasing NTCP and inducing the bile acid efflux

28

transporters, BSEP and MRP2, which are present on the canalicular membrane of

hepatocytes (Zöllner et al., 2006). In addition, HNF-4α stimulates rat CYP7A1 (Crestani et

al., 1998) and CYP3A4 promoter activity (Tirona et al., 2003) whereas HNF-1α, which is

highly dependent on HNF-4α, upregulates rat Ntcp and the organic anion transporting

polypeptides, Oatp1a1 (Slc21a1) and Oatp1a4 (Slc21a10) (Trauner and Boyer, 2003), but

these are downregulated by SHP (Fig. 1-5).

In the intestine, excess bile acids activate FXR that in turn induces the fibroblast

growth factor (FGF19 in human and FGF15 in mouse), a hormonal signaling molecule,

which travels in the portal blood and activates the liver surface fibroblast growth factor

receptor 4 (FGFR4), and, acting through the c-Jun signaling pathway, decreases Cyp7a1

(Inagaki et al., 2005). PXR also negatively regulates Cyp7a1 (Staudinger et al., 2001). It is

apparent that there are various nuclear receptors and transcription factors regulate CYP7A1

expression and cholesterol homeostasis.

Figure 1-5 Regulation of Cyp7a1 by bile acids in the liver

bile acidHepatocyte

+bile acid FXR

↑Mrp2

SHP

↓Cyp7a1

RXR

BA

RE

Nucleus

Gen

e

↑Bsep

Bile

↓Ntcp

LRH-1

HNF-4α

HNF-1α

↓Oatp1a1

↓Oatp1a4

FGF15/19FGFR4

bile acidHepatocyte

+bile acid FXR

↑Mrp2↑Mrp2

SHP

↓Cyp7a1

RXR

BA

RE

BA

RE

Nucleus

Gen

e

↑Bsep↑Bsep

Bile

↓Ntcp↓Ntcp

LRH-1

HNF-4α

HNF-1α

↓Oatp1a1↓Oatp1a1

↓Oatp1a4↓Oatp1a4

FGF15/19FGFR4

29

1.5.3 Species Differences in Transporter and Enzyme Regulation

Species differences are found in the regulation of transporters and enzymes due to

differences in transcriptional regulation of the conserved regions of the target genes. In the

intestine, bile acids are reabsorbed into enterocytes through ASBT (Zöllner et al., 2006).

The increase in bile acids in enterocytes triggers the activation of FXR. FXR increases SHP,

Ostα and Ostβ, and FGF15 to increase bile acid efflux and decreases Cyp7a1 in the liver

(Goodwin et al., 2000; Inagaki et al., 2005; Rao et al., 2008). Due to the absence of a LRH-

1 cis-acting element binding in the rat Asbt promoter, the negative feedback for FXR and

SHP to downregulate rat Asbt to decrease bile acid absorption would be absent (Chen et al.,

2003), namely, the feedback regulation of Asbt by bile-acid-FXR-SHP cascade does not

exist in the rat (Fig. 1-6). In addition, the stimulatory effect of LXR on Cyp7a1 only

occurs in the rodent, and not the human (Chiang et al., 2001); HNF-4 and HNF-1

regulate rat Ntcp, but this does not occur in the human nor the mouse (Jung et al., 2004),

whose transcriptional regulatory regions are different among species. FGF19 is found

present in human hepatocytes and downregulates CYP7A1 (Song et al., 2009), but FGF15

is absent in the mouse liver (Inagaki et al., 2005). In addition, the expression of VDR is

higher in the mouse and human compared to the rat (Gascon-Barré et al., 2003; Han and

Chiang, 2009), suggesting differences in the role of VDR in the liver among species. These

species differences in the regulation of transporters and enzymes are important because a

specific ligand to a nuclear receptor can eventually lead to different outcomes among

species.

30

1.5.4 The Link between VDR, Bile Acids and Cholesterol

There is certainly a link between the effects of nuclear receptors on bile acid and

cholesterol homeostasis, as well as drug disposition. Nuclear receptors regulate drug

transporters and drug metabolic enzymes, which are also involved in the handling of bile

acid and cholesterol (Zöllner et al., 2006; Rezen, 2011; Tirona, 2011). Bile acids are

substrates of ASBT, NTCP, BSEP, and OATPs (Zöllner et al., 2006), and some of these

transporters can also transport xenobiotics such as pitavastatin, rifampin, enalapril,

docetaxel (You and Morris, 2007). Thus, activation of FXR by bile acids could

theoretically alter the disposition of these drugs. Changes in the level of cholesterol are

known to affect P-gp activity (Tamashevskii et al., 2011), and P-gp is reported to play a

role in the transport of cholesterol in the liver (Luker et al., 2001; Leon et al., 2006). The

VDR is a major regulator of the expression of CYP3A4 (Thummel et al., 2001), which, in

Figure 1-6 Species differences in negative feedback regulation of rat, mouse, and human Asbt

FXR

SHPLRH-1+

-BABA

no Lrh-1 in Asbt promoter; no feedback inhibition; ↑ bile acid

feedback inhibition on Asbt

APICAL BASOLATERAL

FXR

SHP +

INTESTINE

Asbt

BA

Mouse & Human

Rat

BA

BA

BA BA VDR

VDR

ASBTBABA

LRH-1

-

BA

BA FXR

SHPLRH-1+

-BABA

no Lrh-1 in Asbt promoter; no feedback inhibition; ↑ bile acid

feedback inhibition on Asbt

APICAL BASOLATERAL

FXR

SHP +

INTESTINE

AsbtAsbtAsbt

BA

Mouse & Human

Rat

BA

BA

BA BA VDR

VDR

ASBTBABA

LRH-1

-

BA

BA

31

turn detoxifies xenobiotics and metabolizes bile acids to less toxic and more easily excreted

derivatives, affecting the concentrations of bile acids in the body. Thus, the VDR is

expected to play a role in the regulation of transporters and enzymes, as well as bile acid

and cholesterol homeostasis.

There has been some controversy with regard to the role of the VDR in regulating

human CYP7A1 and rodent Cyp7a1. The VDR has recently been found to potentially play

a role in the negative regulation of Cyp7a1 in the rat. Our study showed that activated VDR

induced Asbt, which increased bile acid transport in the ileum (Chen et al., 2006) and could

potentially lead to indirect FXR effects in the liver where VDR is virtually absent, whereas

higher VDR protein expression is shown to exist in both human and mouse livers (Gascon-

Barré et al., 2003), though the levels are still low compared to those in the intestine and

kidney (Sandgren et al., 1991). Studies in human primary hepatocytes and HepG2 cells

suggest that VDR inhibits CYP7A1 upon activation by 1,25(OH)2D3 (Han and Chiang,

2009; Han et al., 2010). However, in some of these studies, the proper time-matched

control was absent and time-dependent changes on the stability of the gene or mRNA could

affect the interpretation. Though, other in vitro studies showed human VDR inhibits FXR

(Honjo et al., 2006) and LXRα (Jiang et al., 2006), which would increase CYP7A1.

Recently, treatment in mice with 1α-hydroxyvitamin D3 [1α(OH)D3], a vitamin D prodrug,

resulted in upregulation of Cyp7a1 mRNA (Nishida et al., 2009; Ogura et al., 2009),

whereas inhibition of Cyp7a1 was observed after a high dose of 1,25(OH)2D3 to mice

(Schmidt et al., 2010). However, these two studies did not conclusively show whether the

mRNA changes observed were due to VDR or FXR, or whether the changes could affect

Cyp7a1 protein and cholesterol levels. The time-course of determination of Cyp7a1

32

changes is another important factor when examining these data since different treatment

periods or doses may result in opposite changes in Cyp7a1.

1.6 SIGNIFICANCE OF VDR IN REGULATION OF TRANSPORTERS AND

ENZYMES

Nuclear receptors are viewed as important regulators of transporters and enzymes.

The VDR is one of the major players in the regulation of xenobiotic transporters and

enzymes as a detoxification pathway. Studies have examined the involvement of VDR as a

bile acid sensor and exert a role in cholesterol metabolism. There are various levels of VDR

present in tissues. Changes in transporters and enzymes can be attributed to direct and

indirect VDR effects or to FXR. Bile acids and cholesterol and their derivatives are ligands

of many nuclear receptors. As a result, changes in the concentrations of bile acids and

cholesterol result from VDR activation can also influence changes in other transporters and

enzymes. Thus, VDR is an important regulator in transporters and enzymes as well as

cholesterol metabolism.

33

CHAPTER 2

STATEMENT OF PURPOSE OF INVESTIGATION

34

2.1 STATEMENT OF PURPOSE OF INVESTIGATION

Nuclear receptors play a significant role in protection of the body by regulating the

balance of endogenous molecules, such as cholesterol and bile acids and minimizing the

potential toxic effects of foreign molecules, such as xenobiotics, by affecting the level of

transporters and enzymes. Current findings have demonstrated that VDR is a potential

candidate in the regulation of transporters and enzymes in vitro (Schmiedlin-Ren et al.,

1997; Echchgadda et al., 2004; Aiba et al., 2005; Fan et al., 2009) and in vivo (Xu et al.,

2006; Nishida et al., 2009; Ogura et al., 2009). VDR is known as a regulator of calcium and

phosphate homeostasis (Jones et al., 1998), but has recently been shown to be a bile acid

sensor, due to its ability to induce CYP3A and detoxify the toxic bile acids, LCA

(Makishima et al., 2002). In addition, VDR inhibits FXR and LXR activation, suggesting

the involvement of VDR in cholesterol metabolism (Honjo et al., 2006; Jiang et al., 2006).

Thus, the role of VDR may be expanded from calcium and phosphate homeostasis, to that

of a contributor of bile acid and cholesterol homeostasis.

To date, there exist only a few but inconclusive studies on the role of the VDR in

the regulation of transporters and enzymes of the intestine and kidney and in cholesterol

metabolism in the liver in vivo. My Ph.D. dissertation examines the role of the VDR,

namely, the effects on transporters and enzymes that affect drug disposition and cholesterol

metabolism. Previously, our laboratory had shown that transactivation of rat Asbt may

potentially lead to an increase in intestinal bile acid absorption (Chen et al., 2006). Due to

the low expression of VDR in rat liver and the unresponsive LRH-1 cis-acting element in

the rat ileal Asbt promoter for negative feedback control of Asbt (Chen et al., 2003;

35

Gascon-Barré et al., 2003), an increase in bile acid absorption would induce secondary

FXR effects in liver because bile acids are ligands of FXR. The direct role of the VDR on

rat intestine and tissue slices were examined, in collaboration with Dr. Geny Groothuis in

Groningen, The Netherlands, and the resulting published works are included in APPENDIX

A1, A2, and A3.

However, a direct effect of VDR cannot be ruled out, especially in species such as

mouse and human that have a higher expression of liver VDR than the rat (Gascon-Barré et

al., 2003). Because of the possibility of indirect FXR effects on hepatic transporters and

enzymes after 1,25(OH)2D3 administration and the possible antagonism exerted by VDR on

FXR to increase the expression of CYP7A1 (Honjo et al., 2006), fxr(+/+) and fxr(-/-) mice

with C57BL/6 background were used to isolate the VDR effects from those of FXR in vivo.

The correlation between Cyp7a1 vs. SHP or FGF15 was investigated. To examine the

molecular mechanism of VDR in cholesterol metabolism and the potential cholesterol

lowering properties, we chose to investigate the effects of VDR in wild-type, fxr(-/-) and

shp(-/-) mice pretreated with a high (42%) fat and (0.2%) cholesterol diet/western diet.

Because P-gp or MDR1, a critical transporter in drug disposition, was found to be

upregulated both by VDR and FXR (Martin et al., 2008; Fan et al., 2009), we also used the

fxr(+/+) and fxr(-/-) mice to differentiate these effects, and interpreted the impact of

pharmacokinetic changes with the use of a physiologically-based pharmacokinetic (PBPK)

model. Lastly, to relate the changes observed in these studies to the activation of VDR, we

examined and correlated the plasma and tissue levels of 1,25(OH)2D3 in mice to changes in

gene expression.

36

2.2 HYPOTHESES

1. Due to the differences in the expression of VDR in the rat intestine, liver and

kidney, VDR regulates transporters and enzymes directly via the VDR in the

intestine and kidney, and indirectly via FXR in liver in vivo.

2. The change and regulation of P-gp/Mdr1 in mice are attributed only to the

direct actions of VDR, and this has direct implications on the in vivo

pharmacokinetics of P-gp substrates

3. VDR plays a direct role in the upregulation of Cyp7a1 via repression of SHP

on cholesterol metabolism in mice, leading to a cholesterol lowering effect.

2.3 THESIS OUTLINE

The major studies of my project were:

1) To study the effects of 1,25(OH)2D3 on rat intestine, liver, and kidney enzymes

and transporters: the low liver VDR expression in rat liver gives way to

secondary FXR effects in liver (Chapter 3, test hypothesis 1)

2) To determine changes in Mdr1/ P-gp in vivo greatly change the disposition of

digoxin after 1,25(OH)2D3 treatment in mice (Chapter 4, test hypothesis 2)

3) To examine changes in mouse liver Cyp7a1 and cholesterol lowering with

1,25(OH)2D3 treatment in mice (Chapter 5, test hypothesis 3)

4) To compare the concentrations of 1,25(OH)2D3 in plasma and tissue vs. changes

of VDR target genes in mice (Chapter 6, test hypotheses 1-3)

5) General Discussion and Conclusion (Chapter 7)

37

CHAPTER 3

3. DIRECT AND INDIRECT EFFECTS OF THE VITAMIN D RECEPTOR (VDR)

ON TRANSPORTERS AND ENZYMES IN THE RAT INTESTINE, LIVER AND

KIDNEY IN VIVO

Edwin C.Y. Chow1, Han-joo Maeng1, Huadong Sun1, Ansar A. Khan2, Geny M.M.

Groothuis2, and K. Sandy Pang1

1Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of

Toronto, Canada

2Pharmacokinetics, Toxicology and Targeting, Department of Pharmacy, University of

Groningen, The Netherlands

Reprinted with permission of Biopharmaceutics & Drug Disposition. All rights reserved. Biopharm Drug Dispos 2009; 30:457-475. Biopharm Drug Dispos 2010; 31:91-108.

38

3.1 ABSTRACT

Bile acids are substrates of transporters and enzymes involved in bile acid

homeostasis and are ligands of the farnesoid X receptor (FXR). Activation of the FXR

triggers a negative feedback mechanism that regulates the expression of transporters and

enzymes to decrease bile acid synthesis, increase bile acid secretion, and reduce bile acid

uptake into cells. 1α,25-Dihydroxyvitamin D3 [1,25(OH)2D3], the natural ligand of the

vitamin D receptor (VDR), was found to regulate many of the bile acid related transporters

and enzymes in vitro. Previously, our laboratory found that VDR transactivated the rat ileal

apical sodium-dependent bile acid transporter (Asbt) to increase bile acid absorption in vivo.

However, VDR effects on transporters and enzymes in the rat intestine and kidney, which

are VDR-rich target organs, and in liver, whose expression is low, is ill-defined. Thus,

protein and mRNA levels of various target genes in the rat small intestine, colon, liver, and

kidney were measured by qPCR and Western blotting, respectively, after intraperitoneal

dosing of 1,25(OH)2D3 (0 to 2.56 nmol/kg/day for 4 days) to rats. 1,25(OH)2D3 increased

the protein expression of total cytochrome P450 3a (Cyp3a1), the multidrug resistance

associated proteins (Mrp2, Mrp3, Mrp4) in proximal small intestine, and Asbt in ileum, as

well as mRNA expression of the short heterodimer partner (SHP), fibroblast growth factor

15 (FGF15), and the organic solute transporters (Ost and Ost. 1,25(OH)2D3 treatment

resulted in approximately 50% higher bile acid concentration (65.1 ± 14.9 vs. 41.9 ± 7.8

µM, P < .05) in portal blood and elevated hepatic FXR and SHP mRNA. Increased bile salt

export pump (Bsep) and Ostα mRNA levels in liver tissue, and a >50% reduction in

Cyp7a1 protein and cholesterol metabolism in rat liver microsomes is likely a consequence

of the bile acid-FXR-SHP cascade and activation of the c-Jun N-terminal kinase signaling

39

pathway by FGF15. Increased multidrug resistance protein 1 (Mdr1a/P-gp) expression was

also observed in rat liver. In kidney, VDR, Cyp24, Asbt and Mdr1a mRNA and protein

expression increased (2- to 20-fold) in 1,25(OH)2D3- treated rats, and a 28-fold increase of

Cyp3a9 mRNA, but not of total Cyp3a protein nor Cyp3a1 or Cyp3a2 mRNA was observed,

suggesting that VDR plays a significant, renal-specific role in Cyp3a9 induction. We

conclude that changes in hepatic transporters and enzymes are indirect, secondary effects of

the liver FXR-SHP cascade because of increased intestinal absorption of bile acids, an

event that leads to activation of FXR. In contrast, 1,25(OH)2D3 treatment resulted in direct

VDR effects in the intestine and kidney, VDR-rich organs, and changes in transporter and

enzymes levels were tissue-specific.

3.2 INTRODUCTION

Nuclear receptors (NRs) play an important role in the regulation of enzymes and

hepatobiliary transporters in bile acid homeostasis (Zöllner et al., 2006). The farnesoid X

receptor (FXR; NR1H4) is the most important bile acid sensor and responds to high bile

acid concentrations by inducing the short heterodimer partner (SHP; NR0B2), which in turn

inhibits the liver receptor homolog-1 (LRH-1; NR5A2) (Goodwin et al., 2000). One of the

major FXR effect is the downregulation of cholesterol 7α-hydroxylase, CYP7A1,

(Goodwin et al., 2000), the rate-limiting enzyme among a series of metabolic reactions in

the formation of bile acids from cholesterol in liver (Chiang, 1998). In contrast, the LRH-1,

liver X receptor- (LXR; NR1H3), and hepatocyte nuclear factor 4α (HNF-4α; NR2A1)

in rat are known to increase CYP7A1 (Crestani et al., 1998b; Goodwin et al., 2000; Chiang

et al., 2001). The activation of FXR in intestine increases fibroblast growth factor 15

40

(FGF15) or FGF19 in humans (Song et al., 2009), a signaling hormone that binds to

fibroblast growth factor receptor 4 (FGFR4) on the liver membrane to decrease CYP7A1

(Inagaki et al., 2005; Song et al., 2009). FXR further counteracts the hepatic cytotoxicity

of bile acids by decreasing the expression of sodium taurocholate cotransporting

polypeptide (NTCP; SLC10A1) at the sinusoidal membrane to reduce bile acid uptake

(Denson et al., 2001), and by inducing the bile salt export pump (BSEP; ABCB11)

(Goodwin et al., 2002) and the multidrug resistance associated protein 2 (MRP2; ABCC2)

(Kast et al., 2002), the canalicular transporters, for the excretion of bile acids. Transcription

factors are also affected by FXR: the hepatocyte nuclear factor 1-alpha (HNF-1α), which is

highly regulated by HNF-4α, activates rat Ntcp and the organic anion transporting

polypeptides, Oatp1a1 (Slco1a1) and Oatp1a4 (Slco1a4) (Trauner and Boyer, 2003),

transporters that promote bile acid uptake into liver; inhibition of HNF-1α or HNF-4α

would lead to decreased Ntcp and bile acid uptake into the rat liver.

In the intestine, bile acids are reabsorbed into enterocytes through the apical sodium

dependent bile acid transporter (Asbt; SLC10A2) (Zöllner et al., 2006). The increase in bile

acids in enterocytes could trigger the activation of FXR. FXR then increases SHP, Ostα and

Ostβ, and FGF15 to increase bile acid efflux, and downregulate Cyp7a1 in liver (Goodwin

et al., 2000; Inagaki et al., 2005; Rao et al., 2008). Due to the absence of LRH-1 cis-acting

element in the rat Asbt promoter, there is an absence of the negative feedback mechanism

of FXR to downregulate Asbt (Chen et al., 2003). Therefore, FXR activation due to

increased bile acid absorption led to an unabated, higher level of rat Asbt. FXR remains as

an important nuclear receptor involved in the regulation of bile acid homeostasis, not only

41

on the reabsorption of bile acids in the intestine, but also on FXR effects in the liver,

potentially on Ntcp, Bsep, as well as bile acid synthesis via Cyp7a1 in rat liver.

Vitamin D, the inert precursor of the active ligand, 1,25-dihydroxyvitamin D3

[1,25(OH)2D3], has been widely used as a nutraceutical in the prevention of cancer and

prolongation of longevity (Holick, 2004; Thomas, 2006; Mullin and Dobs, 2007; Schwartz

and Skinner, 2007). Much is known about the molecular actions of vitamin D to regulate

calcium and phosphorus homeostasis, and its indirect feedback on parathyroid hormone

(Jones et al., 1998). The activation of vitamin D requires the consecutive metabolism by

the liver and the kidney to form 25-hydroxyvitamin D3 and then 1-25-dihydroxyvitamin

D3, the ligand of the vitamin D receptor (VDR) (Prosser and Jones, 2004; Feldman et al.,

2005). The toxic bile acid, lithocholic acid, is also a VDR ligand that activates the VDR,

albeit at µM rather than the nM concentrations required for 1,25(OH)2D3 (Makishima et al.,

2002; Nehring et al., 2007). VDR is present abundantly in the rat intestine and kidney

(Sandgren et al., 1991), but is expressed much less in liver, where VDR is found mostly in

stellate cells, Kupffer cells, endothelial cells, and cholangiocytes and not hepatocytes

(Gascon-Barré et al., 2003). In contrast, in human or mouse livers, VDR is expressed in

hepatocytes at low but measureable levels, and is also present in non-parenchymal cells

(Han and Chiang, 2009).

During the last few years, more in vitro and in vivo studies were performed to

investigate the effects of 1,25(OH)2D3 on enzymes and transporters within first pass and

elimination organs, namely the intestine, liver, and kidney. 1,25(OH)2D3 was shown to

regulate calcium homeostasis (Abrams and O'Brien, 2004; Walters et al., 2007) and

42

involved in the regulation of transporters and enzymes (Schmiedlin-Ren et al., 2001;

McCarthy et al., 2005; Chen et al., 2006; Xu et al., 2006; Fan et al., 2009; Khan et al.,

2009a; Khan et al., 2009b). Activation of VDR by 1,25(OH)2D3 upregulates human

cytochrome P450 (CYP3A4), hydroxysteroid sulfotransferase (SULT2A1), and drug

transporters such as the multidrug resistance protein (MDR1 or P-gp) and the multidrug

resistance associated proteins (MRP2 and MRP4) in Caco-2 cells (Schmiedlin-Ren et al.,

1997; Echchgadda et al., 2004; Aiba et al., 2005; Fan et al., 2009). A vitamin D response

element has been identified in MDR1 (Saeki et al., 2008). In vivo, the VDR transactivates

the murine Mrp3 (McCarthy et al., 2005) and the rat apical sodium dependent bile acid

transporter (Asbt) (Chen et al., 2006). In addition, rat intestinal Cyp3a1 has been observed

to be upregulated by 1,25(OH)2D3 treatment, both in vivo and in vitro (Xu et al., 2006;

Khan et al., 2009b). Interestingly, VDR activation is able to blunt LXRsignaling in

HepG2 cells (Jiang et al., 2006) and antagonize the activities of FXR (Honjo et al., 2006),

suggesting that the cross-talk between these bile acid related nuclear receptors could lead to

changes in transporter and enzyme levels in liver. LCA activation of VDR induces Cyp3a

in murine liver and intestine, serving as a detoxification mechanism pathway of bile acids

in colon (Makishima et al., 2002), and in intestinal and liver slices of rats and humans

(Khan et al., 2009b). However, these effects are difficult to be identified in vivo due to

confounding effects and inter-organ interactions.

To date, there exists little or no systematic study that describes the effects of

1,25(OH)2D3-liganded VDR in vivo nor on the regulation of transporters and enzymes for

bile acid homeostasis and drug disposition in vivo. Ogura et al. (2009) have recently

reported on changes in hepatic and renal mRNA expression of transporters and enzymes in

43

mice that underwent sham or bile duct ligation and were treated with an extremely high

dose (31 nmol/kg) of 1-hydroxyvitamin D3, an inert precursor of 1,25(OH)2D3. However,

the physiology of the animal was compromised by bile duct ligation and protein expression

and the functions of the transporters and enzymes were not evaluated. Moreover, 1-

hydroxyvitamin D3 may not be an effective modulator of intestinal-related effects because

the prodrug requires activation by 25-hydroxylase in liver to form the active compound,

1,25(OH)2D3 (Theodoropoulos et al., 2003).

The objective of this study was to examine the direct and indirect roles of VDR on

transporters and enzymes in intestine, liver, and kidney of rats in vivo. The small intestine

and kidney are two major target organs of VDR (Jones et al., 1998), and kidney plays a

central role in the formation of 1,25(OH)2D3. In comparison, very low levels of VDR exist

in rat hepatocytes (Gascon-Barré et al., 2003), and thus, little or no VDR-related change in

genes of transporters and enzymes is expected to occur in rat livers. Previous in vitro

studies with precision cut rat liver slices have failed to show observable induction of

Cyp3a1, Cyp3a2, or Cyp3a9 by 1,25(OH)2D3 (Khan et al., 2009b). However, the increased

portal bile acid absorption due to elevated Asbt in the rat in vivo (Chen et al., 2003) could

trigger indirect or secondary changes in hepatic transporters and enzymes due to the

activation or inhibition of other nuclear receptors, specifically, FXR. In addition, bile acids

regulate and utilize many of the transporters and enzymes involved in drug disposition such

as Asbt, Ntcp, Oatps, Mrps and Cyp3a (Zöllner et al., 2006). Hence, my goal was to

identify direct VDR inductive effects in vivo in rats with 1,25(OH)2D3 treatment on

intestinal and renal transporters and enzymes and indirect VDR effects in liver associated

with FXR by studying the changes in protein and mRNA levels of VDR and FXR target

44

genes in intestine, liver, and kidney. We tested the hypothesis that changes in the liver in

vivo were secondary FXR-related effects and not VDR effects. We further examined the

possible VDR effects on other NRs in the rat liver, because an antagonism of the VDR on

chenodeoxycholate-activated FXR effect had been documented in FXR- and VDR-

transfected HepG2 cells (Honjo et al., 2006).

3.3 METHODS

3.3.1 Materials

1,25(OH)2D3 powder was purchased from Sigma-Aldrich Canada (Mississauga, ON,

Canada). Antibodies to villin (C-19) and rat Cyp7a1 (N-17) were purchased from Santa

Cruz Biotechnology (Santa Cruz, CA); anti-Mrp2 (ALX-801-016-C250) was from Alexis

Biochemicals, San Diego, CA; anti-P-gp (C219) was from Abcam, Cambridge, MA; anti-

Gapdh (14C10) was from Cell Signaling Technology, Danvers, MA; anti-VDR (MA1-710)

was from Affinity BioReagents, Golden, CO; and anti-Cyp3a2 antibodies (458223) that

failed to distinguish from Cyp3a1 or Cyp3a9, were from BD Biosciences, Mississauga, ON.

Other antibodies were kind gifts from various investigators: anti-Oatp1a1, anti-Oatp1a4,

and anti-Ntcp (Dr. Allan W. Wolkoff, Albert Einstein College of Medicine, the Bronx, NY),

anti-Oatp1b2 (Dr. Richard B. Kim, University of Western Ontario, ON); anti-Asbt (Dr.

Paul A. Dawson, Wake Forest University, Salem, NC); anti-Mrp3 (Dr. Yuichi Sugiyama,

University of Tokyo, Japan); anti-Mrp4 (Dr. John D. Schuetz, St. Jude Children’s Research

Hospital, TN); and anti-Bsep (Dr. Bruno Stieger, University Hospital, Zurich, Switzerland).

All other reagents were purchased from Sigma-Aldrich Canada (Mississauga, ON, Canada)

and Fisher Scientific (Mississauga, ON, Canada).

45

3.3.2 1,25(OH)2D3 and Vehicle (Corn Oil) Treatment in Rats In Vivo

1,25(OH)2D3 was dissolved in anhydrous ethanol and the concentration was

quantified spectrophotometrically at 265 nm (UV-1700, Shimadzu Scientific Instruments,

MD); then the solution was diluted in filtered corn oil (Sigma-Aldrich, ON) for injection.

Male Sprague-Dawley rats (260-280 g), purchased from Charles River (St. Constant, QC),

were given water and food ad libitum and maintained under a 12:12-h light and dark cycle

in accordance to animal protocols approved by the University of Toronto (ON, Canada).

Rats (n = 4 in each group) were injected with 0, 0.64, 1.28, and 2.56 nmol/kg/day

1,25(OH)2D3 in 1 ml/kg corn oil intraperitoneally for 4 days. At 24 h following the last day

of 1,25(OH)2D3 treatment, rats were anesthetized with ketamine and xylazine (90 mg/kg

and 10 mg/kg, respectively) by intraperitoneal injection. An aliquot (0.5 ml) of portal and

systemic blood was collected and centrifuged at 3000 rpm for 10 min to obtain serum.

3.3.3 Blood Analysis and Preparation of Tissues

Portal bile acid concentrations were determined using a Total Bile Acids Assay Kit

(BQ042A-EALD from BioQuant, San Diego, CA) following the manufacturer’s protocol.

Serum alanine aminotransferase was assayed with a Reagent Kit (BQ004A-CR from

BioQuant, San Diego, CA) following the manufacturer’s protocol.

After blood collection, the portal vein was cannulated and flushed with 50 ml of ice-

cold physiological saline solution. The small intestine was removed and placed on ice, and

cut into eight segments (Chen et al., 2006). Segment 1 (S1) is the duodenum, spanning

from the pyloric ring to the ligament of Treitz; segment 2 (S2) is the proximal jejunum

segment of equal length that is immediately distal to the ligament of Treitz. The remaining

46

small intestine was then divided into six segments of equal length (S3 to S8, with S8

representing the ileum proximal to the ileocecal junction) (Chen et al., 2006). Enterocytes

were isolated by mucosal scraping of everted tissue with a tissue-scraper (Johnson et al.,

2006) (n = 4). The colon (taken 10-cm section after the ileocecal junction) was freed of

fecal matters via flushing with 1 mM phenylmethylsulfonyl fluoride (PMSF) in 0.9% NaCl,

and stored in the same solution. Enterocytes from the colon were obtained by mucosal

scraping. Enterocytes from all segments were immediately snapped frozen in liquid

nitrogen and stored at -80°C until analyses. The liver and kidney were removed, weighed,

cut into small pieces, and snapped frozen in liquid nitrogen, and then stored in the -80°C

freezer for future analyses.

3.3.4 Preparation of Subcellular Fractions from Enterocytes

Frozen mucosal scrapings (50-100 mg of tissue) from intestinal segments and the

colon were immediately mixed with 1 ml of Trizma HCl (0.1 M, pH 7.4) buffer containing

1% protease inhibitor cocktail (Sigma-Aldrich, ON) and homogenized on ice for three 30

sec periods at 8,000 rpm using an Ultra-turrax T25 homogenizer (Janke & Kunkel, Staufen,

Germany), then sonicated for 10 sec. Samples were centrifuged at 1,000 g at 4°C for 10

min, and the pellet, or the crude nuclear protein fraction, was resuspended in nuclear buffer

[60 mM KCl, 15 mM NaCl, 5 mM MgCl2•6H2O, 0.1 mM EGTA, 300 mM sucrose, 0.5

mM DTT, 0.1 mM PMSF, 300 mM sucrose, 15 mM Trizma HCl pH 7.4] containing 1%

protease inhibitor cocktail. The nuclear fraction was used for Western Blot analysis of

VDR. The supernatant was transferred to a new tube and spun again at 21,000 g at 4°C for

1 h to yield another supernatant (crude cytosolic faction) and pellet (crude membrane

47

fraction); the pellet was resuspended in the same homogenizing buffer and used for

Western blot analyses of the intestinal transporters.

3.3.5 Preparation of Subcellular Fractions of Liver Tissue

For preparation of the crude membrane fraction, ~0.5 g of liver or whole kidney

tissue was homogenized in the crude membrane homogenizing buffer (250 mM sucrose, 10

mM HEPES, and 10 mM Trizma base, pH 7.4) containing 1% protease inhibitor cocktail as

described above. The resultant homogenate was centrifuged at 3,000 g for 10 min at 4°C.

The supernatant was transferred to an ultracentrifuge tube and spun at 33,000 g for 60 min

at 4°C. The resultant pellet yielded the crude membrane protein fraction, and was placed in

resuspension buffer (50 mM mannitol, 20 mM HEPES, 20 mM Trizma base, pH 7.4)

containing 1% protease inhibitor cocktail, and was used for Western blot analyses of

hepatic transporters.

For preparation of the microsomal fraction, ~0.5 g of liver tissue was homogenized

with the microsome homogenizing buffer [250 mM sucrose, 10 mM Trizma HCl, 1 mM

EDTA, pH 7.4] containing 1% protease inhibitor cocktail as described above. The

homogenate was centrifuged at 9000 g for 10 min at 4°C. The supernatant was transferred

to an ultracentrifuge tube and spun at 100,000 g for 60 min at 4°C. The resulting pellet

containing microsomes was resuspended in the same homogenizing buffer and used for

Western blot analyses of cytochrome P450 enzymes.

Protein concentrations of the samples were assayed by the Lowry method (Lowry et

al., 1951) using bovine serum albumin as the standard. Samples were then stored at -80°C

until Western blot analyses.

48

3.3.6 Liver Microsomal Cyp7a1 Activity

Livers were homogenized with a Potter-Elvehjem homogenizer in the microsome

homogenizing buffer described above in absence of protease inhibitors because we wished

to test for the functional activity of Cyp7a1. The microsomal fraction, obtained by

differential centrifugation as described above, was used to examine Cyp7a1 activity

outlined by Hylemon et al. (1989). Microsomal protein (50 µl of 40 mg/ml solution) was

suspended in microsomal reaction buffer [415 µl containing 100 mM potassium phosphate,

50 mM NaF, 1 mM EDTA, 0.015 % 3-[(3-cholamidopropyl)dimethylammonio]-1-

propanesulfonate (CHAPS), 20 % glycerol, and 5 mM DTT] and preincubated for 5 min at

37°C. The reaction was initiated by the addition of a NADPH generating system (25 µl of

solution A and 5 l of solution B, BD Biosciences) and 5 µl of 10 mM cholesterol in

acetone, resulting in 2 mg of microsomal protein in 500 µl of incubation mixture. After 30

min of incubation, the reaction was terminated by the addition of 15 µl of ice-cold 20%

sodium cholate and then 15 µl of the internal standard, 92 µg/ml 7-hydroxycholesterol

(Steraloids Inc, Newport, RI), was added. The 7-hydroxycholesterol formed in the

reaction was converted to 7α-hydroxy-4-cholesten-3-one upon incubation with 44 µl 12.5

U/ml cholesterol oxidase (Sigma) in cholesterol oxidase buffer (10 mM potassium

phosphate, 20% glycerol, and 1 mM DTT) for 10 min at 37°C. This reaction was

terminated by the addition of 1 ml of ice-cold methanol. The product, 7α-hydroxy-4-

cholesten-3-one, was extracted into 9 ml of hexane after mixing the contents vigorously for

15 min, followed by centrifugation at 4°C for 5 min at 5000 g. After evaporation of the

hexane extract under N2 (Boc Canada, Ltd., Mississauga, ON), the residue was

reconstituted in 100 µl mobile phase (acetonitrile: methanol 70:30 v/v), and 20 µl was

49

injected into a Shimadzu HPLC (LC 10AT pump, SPD-10A UV-Vis detector, SIL-10A

autoinjector, and SCL-10A system controller). Separation was achieved with an Altex 10

m C-18 reverse phase column (4.6 mm × 250 mm) at flow rates varying from 0.7 to 2

ml/min, with detection carried out at 240 nm; data integration was performed by the

software, Star Chrom Lite®. Standards (0.05 to 2.5 nmole) containing varying amounts of

7-hydroxycholesterol (Steraloids Inc, Newport, RI) were processed under identical

conditions and were converted to 7α-hydroxy-4-cholesten-3-one for construction of the

calibration curve. The plot of the peak area ratios of 7α-hydroxy-4-cholesten-3-one/internal

standard against 7α-hydroxycholesterol concentration was linear. The reaction rate was

normalized to the amount of microsomal protein and the reaction time.

3.3.7 Western Blotting

Protein samples (20 or 50 µg total protein) were mixed with the loading buffer

containing 0.1 M of DTT and incubated at an optimized, denaturing condition (room

temperature for 30 min, 37°C for 15 min or 95°C for 2 min). Loaded proteins (n = 3 or 4

for each treatment group) were separated by 7.5% or 10% SDS-polyacrylamide gels that

were overlaid with a 4% polyacrylamide stacking gel at 100 V. After separation, proteins

were transferred onto a nitrocellulose membrane (Amersham Biosciences, Piscataway, NJ).

The membrane was blocked with 5% (w/v) skim milk in Tris-buffered saline (pH 7.4) and

0.1% Tween 20 (TBS-T) (Sigma-Aldrich, ON) for 1 h at room temperature, and then

washed with 0.1% TBS-T for 10 min. The membrane was incubated with primary antibody

solution (1:1000 to 1:5000 in 2% skim milk in 0.1% TBS-T) overnight at 4°C. The next

morning, the membrane was washed with 0.1% TBS-T three times for 10 min each before

50

incubation with the secondary antibody (1:2000; anti-rat for VDR; 1:2000; anti-rabbit for

Mrp3, Mrp4, Bsep, Oatp1a1, Oatp1a4, Oatp1b2, Ntcp, Asbt, GAPDH, and Cyp3a2; anti-

goat for villin and Cyp7a1; anti-mouse for P-gp and Mrp2) with 2% skim milk in 0.1%

TBS-T for 2 h at room temperature, and again washed three times with 0.1% TBS-T for 10

min each. Bands were visualized using chemiluminescence reagents (Amersham

Biosciences, Piscataway, NJ) and quantified by scanning densitometry (NIH Image

software; http://rsb.info.nih.gov/nih-image/). Band intensity of target protein was

normalized against that of villin for intestinal samples or Gapdh for liver and kidney

samples, to correct for loading errors.

3.3.8 Quantitative Real-Time Polymerase Chain Reaction (qPCR)

Total RNA was obtained from 50-100 mg of scraped enterocytes, liver and kidney

tissue using the TRIzol extraction method (Sigma-Aldrich) according to the manufacturer’s

protocol, with modifications. The extracted RNA pellet was air dried and then dissolved in

TE buffer (Applied Biosystems Canada, ON). Total RNA was quantified by UV

spectrometry quantified at 260 nm. The purity was checked by ratios of the readings at 260

/280 nm and 260/230 nm (≥1.8). cDNA was immediately synthesized from RNA samples,

using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems Canada,

ON) by following the instruction provided by the manufacturer. In brief, 1.5 µg of total

RNA was transcribed in a 20 µl reaction volume in the Applied Biosystems 2720 Thermal

Cycler. The program consisted of 10 min for annealing at 25°C, 120 min for reverse

transcription at 37°C, and 5 min for inactivation at 85°C. Real-time quantitative polymerase

chain reaction (PCR) was performed with two detection systems (SYBR Green or Taqman

assay), depending on the availability of primer sets. Information on primer sequences is

51

summarized in Table 3-1. These primer sets were analyzed using BLASTn to ensure primer

specificity for the gene of interest (http://www.ncbi.nlm.nih.gov/BLAST/). The PCR

mixture (20 µl final volume) consisted of 75 ng cDNA, 1 µM of forward and reverse

primers, and 1 Power SYBR Green PCR Master Mix (Applied Biosystems) was used to

perform PCR analysis. Amplification and detection were performed using the ABI 7500.

The real-time PCR system was designated the following PCR reaction profile: 95°C for 10

min, and 40 cycles of 95°C for 15 sec and 60°C for 1 min, followed by the dissociation

curve. All target mRNA data (n = 4 for each treatment group) were normalized to villin

mRNA for intestinal samples and Gapdh mRNA for liver and kidney samples. Levels of

villin or Gapdh in the intestine for each segment and liver, respectively, were not altered by

1,25(OH)2D3 treatment. Data were analyzed using the ABI Sequence Detection software

version 1.4 to obtain critical threshold cycle (CT) value, the cycle number at which the

fluorescence increased linearly. For intestinal samples, the CT value of villin was subtracted

from the CT value of the target gene (∆CT = CT.Target – CT.villin). The ∆CT was then compared

to the corresponding ∆CT of the vehicle control (∆∆CT) and expressed as fold expression 2-

(∆∆CT). The same analytical method is applied for the analysis of liver and kidney samples.

3.3.9 Statistical Analysis

Results were expressed as mean ± standard deviation. Data comparing the

difference between two groups were analyzed using the two-tailed Student's t test, ANOVA,

and the Mann-Whitney U test for errors that were normally- or non-normally-distributed,

respectively. For intestinal and colon mRNA and protein analyses, the vehicle-treated S1

sample (value set as unity for normalization) was used for normalization of other vehicle-

and 1,25(OH)2D3-treated samples from other segments and colon. For liver and kidney

52

mRNA and protein analyses, the vehicle-treated sample was usually set as the control

(value set as unity), and was used for comparison with those of the treated samples. A P

value of less than 0.05 was set as the level of significance.

53

Table 3-1 Rat primer sets for quantitative Real-Time PCR

Gene Bank Number Forward (5’→ 3’ Sequence) Reverse (5’→ 3’ Sequence) Gapdh XR_007996 CGCTGGTGCTGAGTATGTCG CTGTGGTCATGAGCCCTTCC Villin NM_001108224 GCTCTTTGAGTGCTCCAACC GGGGTGGGTCTTGAGGTATT Mrp2 NM_012833 CTGGTGTGGATTCCCTTGG CAAAACCAGGAGCCATGTGC Mrp3 NM_080581 ACACCGAGCCAGCCATATAC TCAGCTTCACATTGCCTGTC Mrp4 NM_133411 GCCCTTACCCAGCTGCTGA CAGAATCCAGAGAGCCTCTTTTACA

Oatp1a1 NM_017111 CTACTGCCCTGTTCAAGGCC ATTGTATCTCTCAGGATTCCGAGG Oatp1a4 NM_131906 TGCGGAGATGAAGCTCACC TCCTCCGTCACTTTCGACCTT Oatp1b2 NM_031650 AGACGTTCCCATCACAACCAC GCCTCTGCAGCTTTCCTTGA

Asbt NM_017222 TCAGTTTGGAATCATGCCTCTCA ACAGGAATAACAAGCGCAACCA Ost# NM_001107087 TGTCATCCTGACCGCCCT AAGCGATCTGCCCGCTG Ost XM_001076555 TATTCCATCCTGGTTCTGGCAGT CGTTGTCTTGTGGCTGCTTCTT

Mdr1a AY582535 GGAGGCTTGCAACCAGCATTC CTGTTCTGCCGCTGGATTTC Bsep XM_579531 TGGAAAGGAATGGTGATGGG CAGAAGGCCAGTGCATAACAGA Ntcp NM_017047 CTCCTCTACATGATTTTCCAGCTTG CGTCGACGTTCGTTCCTTTTCTTG

Cyp3a1 NM_013105 GGAAATTCGATGTGGAGTGC AGGTTTGCCTTTCTCTTGCC Cyp3a2 XM_573414 AGTAGTGACGATTCCAACATAT TCAGAGGTATCTGTGTTTCCT Cyp3a9 U60085 GGACGATTCTTGCTTACAGG ATGCTGGTGGGCTTGCCTTC Cyp7a1 X17595 CTGTCATACCACAAAGTCTTATGTCA ATGCTTCTGTGTCCAAATGCC Cyp24 NM_201635 GCATGGATGAGCTGTGCGA AATGGTGTCCCAAGCCAGC VDR NM_017058 ACAGTCTGAGGCCCAAGCTA TCCCTGAAGTCAGCGTAGGT

LXR NM_031627 TCAGCATCTTCTCTGCAGACCGG TCATTAGCATCCGTGGGAACA FXR NM_021745 AGGCCATGTTCCTTCGTTCA TTCAGCTCCCCGACACTTTT SHP BC088117 CCTTGGCTAGCTGGGTACCA GTCCCAAGGAGTACGCATACCT

LRH-1 NM_021742 GCTGCCCTGCTGGACTACAC TGTAGGGCACATCCCCATTC FGF15 AB078900 ACGGGCTGATTCGCTACTC TGTAGCCCAAACAGTCCATTTCCT

HNF-1α X54423 CTCCTCGGTACTGCAAGAAACC TTGTCACCCCAGCTTAAGACTCT HNF-4α EF193392 CCAGCCTACACCACCCTGGAGTT TTCCTCACGCTCCTCCTGAA

# Ost primer set includes probe 5’ FAM-CAGCCCTCCATTTTCTCCATCTTGGC-TAMRA 3’ for Taqman® Gene Expression Assay

54

3.4 RESULTS

3.4.1 Effect of 1,25(OH)2D3 Treatment on Portal Bile Acid and ALT Levels

Total portal bile acid concentrations for the highest 1,25(OH)2D3 dose (2.56

nmol/kg) were significantly higher (55%) compared to that of control (Table 3-2). However,

there was no change in alanine aminotransferase (ALT) in serum, suggesting a lack of

damage to the liver by the treatment of 1,25(OH)2D3 at the doses chosen.

Table 3-2 Changes in blood analysis with various intraperitoneal injections of 1,25-dihydroxyvitamin D3 treatment for 4 days to the rat in vivo

Daily Dose of 1,25(OH)2D3 (nmol/kg/day)

0 0.64 1.28 2.56

Portal Bile Acid (µg/ml) 41.9 ± 7.8 44.6 ± 10.1 49.9 ± 16.8 65.1 ± 14.9*

Alanine Aminotransferase, ALT (IU/l)

11.7 ± 8.2 19.9 ± 2.3 12.0 ± 4.5 17.1 ± 7.1

* P < .05, compared to vehicle treatment (0 nmol 1,25(OH)2D3/kg/day) using two-tailed Student’s t test

3.4.2 Effect of 1,25(OH)2D3 Treatment on Nuclear Receptors (NRs), Enzymes and

Transporters in Intestinal Segments and Colon

The abundance of mRNA and protein of NRs, transporters, and enzymes in the

small intestine was examined under control conditions and compared to those in the colon.

The effects of 1,25(OH)2D3 on transporter and enzyme expression were then determined in

the segment(s) of greatest abundance.

3.4.2.1 Intestinal nuclear receptors, NRs

Intestinal NRs were found to be distributed differentially in the small intestine and

colon. The mRNA distribution of VDR revealed a slight decreasing gradient, from the

55

duodenum (S1) to ileum (S8), and was higher in the colon (1.23-fold of duodenum) (Fig. 3-

1A). Less VDR mRNA was detected in kidney and liver than in the small intestine (S1)

(Fig. 3-1A). There was no difference in VDR protein levels in small intestine, colon, and

kidney, however the VDR protein in liver was only 14% that of S1 (Fig. 3-1A). The

1,25(OH)2D3-treated rats exhibited little change in intestinal VDR mRNA and protein (Fig.

3-1B), although VDR protein increased 50% in the S2 portion of the small intestine for the

1.28 nmol/kg treated group (Fig. 3-1B).

Unlike VDR, FXR mRNA increased from duodenum to ileum, and was highest in

colon (Fig. 3-2A). There was no induction of FXR mRNA except for a small increase in the

colon for the 1.28 nmol/kg treatment group (Fig. 3-2A). Surprisingly, the distribution of

SHP in the small intestine is in sharp contrast to that of FXR (Fig. 3-2B). The expression

of SHP mRNA was evenly distributed in the small intestine and was highest in the colon, as

observed by others for the rat small intestine (Los et al., 2007). A 2- to 6-fold induction in

SHP mRNA was observed for the proximal jejunum and ileum relative to the control, as

found previously (Chen et al., 2006). Similar to FXR, the expression of LRH-1 mRNA

increased from the duodenum to ileum, and was highest in colon (Fig. 3-2C); LRH-1

mRNA was relatively unaltered by 1,25(OH)2D3 treatment in the small intestine, though a

small (36%) increase occurred at the highest 1,25(OH)2D3 dose in S1 (Fig. 3-2C). Because

the mRNA of FGF15 was highest in S8 in mice (Song et al., 2009), our appraisal of

induction in tissue was based on that for the S8 segment, which showed at least a 3-fold

increase in the 1,25(OH)2D3 treated rats over the control group (Fig. 3-3).

56

Tissue Distribution

S1 S2 S7 S8 Colon Liver Kidney

Rel

ativ

e V

DR

Exp

ress

ion

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2.0

2.2

mRNAProtein

†

†

††

†

0

VDR

Gapdh

52 kDa

37 kDa

MWS1 S2 S7 S8 Colon Liver Kidney

VDR

Gapdh

52 kDa

37 kDa

MWS1 S2 S7 S8 Colon Liver Kidney

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e V

DR

mR

NA

Exp

ress

ion

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2.0

2.2

00.641.282.56

Treatment (nmol / kg / day)

0

†

††

†

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e V

DR

Pro

tein

Exp

ress

ion

0

1

2

3

4

5

6

00.641.282.56


*

†

(A)

Figure 3-1 Distribution and dose-dependent effects of 1,25(OH)2D3 on rat intestinal VDR mRNA and protein (n = 3 or 4 in each group). (A) mRNA and protein distributions of VDR in the small intestine [duodenum (S1), proximal jejunum (S2), distal jejunum (S7), and ileum (S8)] and colon, liver and kidney, normalized to Gapdh expression. (B) mRNA and protein changes of VDR, normalized to villin. The molecular weights of Gapdh, VDR, and villin bands were detected at 37, 52, and 95 kDa, respectively. “*” indicates P < 0.05 compared to vehicle control in the same segment whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using the two-tailed Student’s t test.

(B)

57

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e LR

H-1

mR

NA

Exp

ress

ion

0

5

10

15

20

00.641.282.56


0

*†

†

†

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e F

XR

mR

NA

Exp

ress

ion

0

5

10

15

20

25

30

35

00.641.282.56


*

†

††

†

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e S

HP

mR

NA

Exp

ress

ion

0

1

2

3

4

5

00.641.282.56


***

*

*

* †

(C) S8 Intestinal Segment

FGF15

Rel

ativ

e F

GF

15 m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

5.5

6.0

6.5

7.0

00.641.282.56


*

0

*

*

Figure 3-2 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal (A) FXR (B) SHP and (C) LRH-1 mRNA (n = 3 or 4 in each group). “*” indicates P < 0.05 compared to vehicle control in the same segment whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using the two-tailed Student’s t test.

(A)

(B)

Figure 3-3 Dose-dependent effects of 1,25(OH)2D3 on intestinal FGF15 mRNA in the ileum (n = 3 or 4 in each group). “*” indicates P < 0.05 compared to vehicle control in the same segment using the two-tailed Student’s t test.

58

3.4.2.2 Intestinal enzymes

Intestinal Cyp3a1 and Cyp3a9 mRNAs were preferentially localized in proximal

segments of the small intestine, and was lowest in the colon (Figs. 3-4A and 3-4B),

whereas Cyp3a2 mRNA was undetectable (data not shown). All doses of 1,25(OH)2D3

resulted in an induction (> 10-fold of control) of Cyp3a1 mRNA in the S1 and S2 segments

(Fig. 3-4A), as well as an increase of total Cyp3a protein (all Cyp3a1, Cyp3a2, Cyp3a9

isoforms) (Liu et al., 2006b). In contrast, intestinal Cyp3a9 mRNA was not altered in rats

treated for 4 days after 1,25(OH)2D3 (Fig. 3-4B). Dose-dependent increases of total Cyp3a

protein (> 2-fold) were clearly observed with 1,25(OH)2D3 treatment (Fig. 3-4C). The

mRNA expression of Cyp24, a catabolic enzyme that inactivates 1,25(OH)2D3 (Healy et al.,

2003; Meyer et al., 2007), exhibited an increasing trend, from duodenum to ileum (3.6-fold

of S1), and was highest in colon (41-fold of S1; Fig. 3-5). However, the mRNA expression

of Cyp24 in intestine was low (CT value about 27 to 29 in the small intestine and ~24 in the

colon). Cyp24 mRNA were induced with 1,25(OH)2D3 treatment along the length of the

small intestine, but not in the colon at the highest dose. For the other doses, a trend of

upregulation was seen, however, the results failed to reach statistical significance due to the

high variation observed (1.6 to 90-fold compared to control; Fig. 3-5).

59

Intestinal Segments

S1 S2 S7 S8 ColonRel

ativ

e C

yp3a

1 m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.050.0

1000.0

3000.0

00.641.282.56


0

** **

*

*† ††

#

#

Intestinal Segments

S1 S2 S7 S8 ColonRel

ativ

e C

yp3a

9 m

RN

A E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

00.641.282.56


0

††

†

Intestinal Segments

S1 S2

Rel

ativ

e C

yp3a

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

00.641.282.56


0

*

*

*

*

(A)

(B)

0 0.64 1.28 2.56

1,25(OH)2D3 (nmol/kg)

S1

S2

Cyp3aVillin

Cyp3aVillin

0 0.64 1.28 2.56


S1

S2

Cyp3aVillin

Cyp3aVillin

Figure 3-4 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Cyp3a enzymes (n = 3 or 4 in each group). The distribution and changes in Cyp3a1 (A) and Cyp3a9 (B) mRNA and changes in Cyp3a protein in S1 and S2 segments (C) with 1,25(OH)2D3 treatments are shown. The Cyp3a protein band was detected at 56 kDa. Cyp3a protein for S1 and S2 controls were viewed as unity. “*” indicates P < 0.05 compared to vehicle control in the same segment whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using the two-tailed Student’s t test. “#” indicates P < 0.05 compared to vehicle control in the same segment using Mann-Whitney U test.

(C)

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e C

yp24

mR

NA

Exp

ress

ion

0

50

100

200

300

400

500

1000

00.641.282.56


** * *

†

††# #

#

#

##

Figure 3-5 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Cyp24 mRNA (n = 3 or 4 in each group). “*” indicates P < 0.05 compared to vehicle control in the same segment whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using two-tailed Student’s t test. “#” indicates P < 0.05 compared to vehicle control in the same segment using Mann-Whitney U test.

60

3.4.2.3 Intestinal apical absorptive transporter, Asbt

Asbt mRNA was most abundant in the ileum (S8) (Chen et al., 2006), and with only

1% of that mRNA in the colon (data not shown). These levels were unchanged after

1,25(OH)2D3 treatment (Fig. 3-6A). Asbt protein, present most abundantly in S8 (Chen et

al., 2006), was increased significantly for the 2.56 nmol/kg treatment group (Fig. 3-6B).

Intestinal Segment

S8

Rel

ativ

e A

sbt

Pro

tein

Exp

ress

ion

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2.0

00.641.282.56

Treatment (nmol / kg / day)*

0

Intestinal Segment

S8

Re

lativ

e A

sbt m

RN

A E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2.0

00.641.282.56


0

(A)

(B)

0 0.64 1.28 2.56


Asbt

Villin

48

95

MW

0 0.64 1.28 2.56


Asbt

Villin

48

95

MW

Figure 3-6 Dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Asbt in the ileum (n = 3 or 4 in each group). Asbt mRNA (A) and protein (S8) with 1,25(OH)2D3 treatment are shown; the Asbt protein band was detected at 48 kDa in the ileum (S8). “*” indicates P < 0.05 compared to vehicle control in the same segment using the two-tailed Student’s t test.

61

3.4.2.4 Intestinal apical efflux transporter, Mdr1a (P-gp)

Levels of Mdr1a mRNA displayed an increasing trend, from the duodenum to the

ileum, as observed by others (Liu et al., 2006b), and levels were highest in the colon: S1 =

S2 < S7 = S8 << colon (Fig. 3-7A). 1,25(OH)2D3 failed to alter the mRNA expression of

intestinal Mdr1a, excepting a small decrease (34%) in the S7 segment at the highest

1,25(OH)2D3 dose (Fig. 3-7A). P-gp protein expression in the S8 segment (ileum) was the

highest, but did not show any demonstrable trend of induction with 1,25(OH)2D3 treatment

(Fig. 3-7B).

3.4.2.5 Intestinal apical efflux transporter, Mrp2

Unlike Mdr1a, the distribution of Mrp2 mRNA and protein was found to decrease

from the duodenum to ileum, as found earlier (Mottino et al., 2000), then to very low levels

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e M

dr1a

mR

NA

Exp

ress

ion

0

5

10

15

20

00.641.282.56


*

† †

†

Intestinal Segment

S8

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

00.641.282.56


0

(A) (B)

Figure 3-7 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Mdr1a mRNA and P-gp protein (n = 3 or 4 in each group). Mdr1a mRNA (A) and P-gp protein, detected at 170 kDa, for S8 are shown. “*” denotes P < 0.05 compared to vehicle control in the same segment, whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using two-tailed Student’s t test.

62

in the colon; the mRNA of the transporter were highest in S1 and S2 (Figs. 3-8A, 3-8B, and

3-8C). 1,25(OH)2D3 did not alter the mRNA levels of Mrp2 among all of the intestinal

segments (Fig. 3-8A) and colon, but the protein expressions of Mrp2 in the S1 and S2

segments were significantly induced by 1,25(OH)2D3 (Figs. 3-8B, and 3-8D).

3.4.2.6 Intestinal basolateral efflux transporter, Mrp3

The mRNA expression of Mrp3 exhibited an ascending distribution pattern,

increasing from duodenum to ileum, then the colon (Fig. 3-9A). Mrp3 protein expression

was highest at the duodenum, but this drastically dropped within the proximal jejunum,

with levels gradually increasing towards the ileum (Figs. 3-9B and 3-9C). However, in the

colon, protein levels of Mrp3 were even higher than in the jejunum. 1,25(OH)2D3 failed to

perturb Mrp3 mRNA levels, but increased Mrp3 protein levels in both S1 and S2,

especially with higher 1,25(OH)2D3 doses (Figs. 3-9B and 3-9D).

3.4.2.7 Intestinal basolateral efflux transporter, Mrp4

The mRNA and protein distributions of Mrp4 were similar to those of Mrp3: an

ascending distribution pattern, increasing from the duodenum to ileum, as was observed for

Mrp4 mRNA (Fig. 3-10A). Significantly higher mRNA was observed in colon.

Interestingly, Mrp4 protein expression was highest in S1, but decreased precipitously in S2,

followed by a gradual increasing trend towards S8 in the small intestine (Figs. 3-10B and 3-

10C). Mrp4 protein in the colon was quite high and was only 17% lower compared to that

of the duodenum. Dose-dependent 1,25(OH)2D3 induction of Mrp4 was observed in the S2

segment (Figs. 3-10B and 3-10D).

63

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e M

rp2

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.000.641.282.56


0

† ††

(C)

180Mrp2

S1 S2 S3 S4 S5 S6 S7 S8 ColonVillin 95

MW

180Mrp2

S1 S2 S3 S4 S5 S6 S7 S8 ColonVillin 95

MW

Intestinal Segments

S1 S2 S3 S4 S5 S6 S7 S8 Colon

Re

lativ

e M

rp2

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

8.0

00.641.282.56


* *

*

*

*

0

††

† †

(A) (B)

Figure 3-8 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Mrp2 (n = 3 or 4 in each group). Mrp2 mRNA (A) and protein distribution (B,C) in the small intestine [duodenum (S1), jejunum (S2-S7), and ileum (S8)] and colon and (D) the inductive changes of Mrp2 protein in S1 and S2, detected at 180 kDa, with 1,25(OH)2D3 treatments are shown. “*” indicates P < 0.05 compared to vehicle control in the same segment, whereas “†” indicates P < 0.05 compared to the level of vehicle-control, S1 segment using two-tailed Student’s t test.

(D)

0 0.64 1.28 2.56 0 0.64 1.28 2.56


S1 S2

Mrp2

Villin

180

95

MW

0 0.64 1.28 2.56 0 0.64 1.28 2.56


S1 S2

Mrp2

Villin

180

95

MW

64

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e M

rp3

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

10.0

12.0

14.0

16.0

18.0

20.0

00.641.282.56


0

*†

†

†

Intestinal Segments


Re

lativ

e M

rp3

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

00.641.282.56


*

***

0

†† † † †

†

†

(A) (B)

Mrp3


17095Villin

MW

Mrp3


17095Villin

MW

(C)

Mrp3

Villin 95

170

S1 S2

0 0.64 1.28 2.56 0 0.64 1.28 2.56


MW

Mrp3

Villin 95

170

S1 S2

0 0.64 1.28 2.56 0 0.64 1.28 2.56


MW

Figure 3-9 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Mrp3 (n = 3 or 4 in each group). Mrp3 mRNA (A) and protein (B,C) distribution in the small intestine [duodenum (S1), jejunum (S2-S7), and ileum (S8)] and colon are shown. Inductive changes in Mrp3 protein in S1 and S2, detected at 170 kDa, with the 1,25(OH)2D3 treatments were observed (D). “*” indicates P < 0.05 compared to vehicle control in the same segment, whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using two-tailed Student’s t test.

(D)

65

Intestinal Segments

S1 S2 S7 S8 Colon

Rel

ativ

e M

rp4

mR

NA

Exp

ress

ion

0

5

10

15

20

25

30

35

4000.641.282.56


† †

†

Figure 3-10 Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Mrp4 (n = 3 or 4 in each group). Mrp4 mRNA (A) and protein (B,C) distribution in the small intestine [duodenum (S1), jejunum (S2-S7), and ileum (S8)] and colon are shown. Changes in Mrp4 protein by 1,25(OH)2D3 treatments in S1 and S2 segments were observed (D). Mrp4 protein band was detected at 160 kDa. “*” indicates P < 0.05 compared to vehicle control in the same segment, whereas “†” indicates P < 0.05 compared to the level of vehicle-control S1 segment using two-tailed Student’s t test.

Intestinal Segments


Re

lativ

e M

rp4

Pro

tein

Exp

ress

ion

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8

2.0

2.2

2.4

00.641.282.56


*

*

0

† † † † † † †

†

(C) (D)

Mrp4

Villin

16095


MW

Mrp4

Villin

16095


MW

(A) (B)

Mrp4

Villin 95

160

0 0.64 1.28 2.56 0 0.64 1.28 2.56


S1 S2 MW

Mrp4

Villin 95

160

0 0.64 1.28 2.56 0 0.64 1.28 2.56


S1 S2 MW

66

3.4.2.8 Intestinal basolateral efflux transporter, Ost-Ost

Ost and Ost mRNA, noted to be localized mostly in the ileum (Rao et al., 2008),

was modestly induced by the lowest dose of 1,25(OH)2D3 (Fig. 3-11), but did not change at

higher doses.

Figure 3-11 Dose-dependent effects of 1,25(OH)2D3 on intestinal Ostα and Ostβ mRNA in the ileum (n = 3 or 4 in each group). “#” indicates P < 0.05 compared to vehicle control in the same segment using the Mann-Whitney U test.

3.4.3 Effect of 1,25(OH)2D3 on Hepatic Nuclear Receptors, Enzymes, and

Transporters

3.4.3.1 Hepatic nuclear receptors, NRs

At the highest dose of 1,25(OH)2D3 (2.56 nmol/kg), FXR and VDR mRNA were

increased 43% to 75%, respectively, over those of control rats (Table 3-3). SHP mRNA

was also induced (2.5- to 5-fold) (Table 3-3). In addition, significant increases in LRH-1

and LXRα mRNA were observed at doses exceeding 1.28 nmol/kg; HNF-4α and HNF-1

mRNA were increased at the highest dose, though the increase (about 37%) was modest

(Table 3-3).

S8 Intestinal Segment

Ost Ost.

Rel

ativ

e O

st m

RN

A E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.600.641.282.56


#

#

0

67

3.4.3.2 Hepatic cytrochrome P450, Cyps

In liver, only Cyp3a2 mRNA was significantly induced (66%) over that of the

control at the highest dose, whereas Cyp3a1 mRNA remained unchanged; the small

increase in mRNA of Cyp3a9 was insignificant (Table 3-3). A probable explanation is that

Cyp3a2 is present only in bile duct epithelial cells (Khan et al., 2009b) where VDR is

present (Gascon-Barré et al., 2003), whereas Cyp3a1, Cyp3a2 and Cyp3a9 are found in

hepatocytes (Khan et al., 2009b), where VDR is absent. In liver, the total Cyp3a protein

was unchanged. Cyp24 mRNA was very low, and was not altered with 1,25(OH)2D3

treatment (data not shown).

The mRNA level of Cyp7a1 was unchanged (Table 3-3), but there was a significant

reduction in Cyp7a1 protein (>50%) at all doses of 1,25(OH)2D3 treatment (Fig. 3-12A).

Moreover, Cyp7a1 activity in rat liver microsomes (4 mg/ml) was reduced from 0.81 ± 0.14

nmol/h/mg in controls to 0.32 ± 0.14 nmol/h/mg protein in 1,25(OH)2D3 (2.56 nmol/kg/day)

treated rats (P = 0.002; n = 4 in each group). The 60% reduction in Cyp7a1 activity

observed for the 1,25(OH)2D3-treated rats correlated well with the reduction of protein (Fig.

3-12A) and increased mRNA levels of FXR and SHP.

3.4.3.3 Hepatic transporters

Relatively little change was observed for the sinusoidal and cholangiocyte uptake

and efflux transporters in the 1,25(OH)2D3 treated livers. The mRNA and protein

expressions for the sinusoidal transporters, Ntcp, Oatp1a1, Oatp1a4, and Oatp1b2, and Ostβ,

and the mRNA expression of the cholangiocyte uptake transporter, Asbt (Lazaridis et al.,

1997), were unaltered (Table 3-3 and Fig. 3-12B). The increase in Mrp3 and Mrp4 protein

68

was not significant in liver (Fig. 3-12B). Observable changes in the liver were confined to

mRNA of Ost and Mrp3, and the canalicular transporters, Bsep and Mdr1, especially at

the highest dose (Table 3-3). Moreover, induction of protein was observed for P-gp (Fig. 3-

12C, P < .05).

3.4.4 Effect of 1,25(OH)2D3 on Nuclear Receptors, Enzymes, Drug Transporters in

the Kidney

3.4.4.1 Renal nuclear receptors, NRs

Renal VDR mRNA was significantly induced approximately 2-fold at all doses of

1,25(OH)2D3 (Table 3-4), whereas the nuclear VDR protein was significantly induced by

60% at the highest dose (Fig. 3-13), whereas LRH-1 mRNA remained relatively unchanged

(Table 3-4). In contrast, the mRNA expressions of other nuclear receptors, FXR, SHP, and

the transcription factors, HNF-4α and HNF-1α, were reduced by 50 to 60% after treatment

with doses of 1.28 and 2.56 nmol/kg of 1,25(OH)2D3.

3.4.4.2 Renal cytochrome P450, Cyps

The mRNA of Cyp24, an enzyme known to respond to 1,25(OH)2D3 induction, was

20-fold higher at all doses of 1,25(OH)2D3 (Table 3-4), and Cyp24 protein was increased

significantly (4-fold) at the highest 1,25(OH)2D3 dose (Fig. 3-13). Interestingly, Cyp3a9

mRNA expression was significantly induced > 28-fold by 1,25(OH)2D3 at all doses (Table

3-4). Cyp3a2 mRNA was reduced (>95%; P < .05) at the highest dose whereas the decrease

in Cyp3a1 mRNA was not significant (Table 3-4). Total Cyp3a protein tended to be

increased, though the change was not significant (Fig. 3-13).

69

3.4.4.3 Renal transporters

Ostα mRNA was decreased by 60% at the highest dose whereas the decrease in Ostβ

mRNA was insignificant (Table 3-4). The mRNA of the renal transporters, Asbt (4-fold)

and P-gp (2-2.5 fold) were significantly increased (Table 3-4). Increased Asbt protein was

observed (Fig. 3-13), and this correlated with the increase in mRNA levels with

1,25(OH)2D3 treatment, though being significant only at the 1,25(OH)2D3 dose of 0.64

nmol/kg. In contrast, P-gp mRNA induction was associated with a 2- to 4-fold increase in

protein expression at the higher doses of 1,25(OH)2D3 (Fig. 3-13). However,

downregulation of Mrp4 mRNA expression was observed (Table 3-4), whereas that of

Mrp2 and Mrp3 was unchanged with treatment. Changes in Mrp2, Mrp3 and Mrp4 protein

in the kidney after 1,25(OH)2D3 treatment were minimal (Fig. 3-13).

70

Table 3-3 Changes in mRNA expression of rat hepatic nuclear receptors, enzymes, and transporters, expressed as fold expression

compared to vehicle treatment

1,25(OH)2D3 Dose (nmol/kg/day) Gene 0 0.64 1.28 2.56 FXR 1.00 ± 0.13 1.36 ± 0.38 1.17 ± 0.23 1.43 ± 0.28* SHP 1.00 ± 0.55 2.66 ± 0.55* 2.65 ± 0.64* 4.93 ± 3.18#

LXRα 1.00 ± 0.10 1.23 ± 0.24 1.23 ± 0.11* 1.71 ± 0.09* HNF-1α 1.00 ± 0.06 0.96 ± 0.13 0.92 ± 0.14 1.37 ± 0.34# HNF-4α 1.00 ± 0.12 1.15 ± 0.17 1.15 ± 0.20 1.37 ± 0.22*

Hepatic Nuclear

Receptors

LRH-1 1.00 ± 0.18 1.18 ± 0.23 1.41 ± 0.11* 1.63 ± 0.20* Cyp7a1 1.00 ± 0.05 0.96 ± 0.41 1.36 ± 0.98 1.54 ± 0.66 Cyp3a1 1.00 ± 0.44 0.74 ± 0.16 0.90 ± 0.54 0.71 ± 0.11

Hepatic Cytochrome

P450s Cyp3a9 1.00 ± 0.85 1.00 ± 0.61 2.02 ± 1.62 2.15 ± 1.12 Ntcp 1.00 ± 0.10 1.09 ± 0.15 1.19 ± 0.26 1.29 ± 0.28

Oatp1a1 1.00 ± 0.14 0.96 ± 0.07 0.96 ± 0.14 1.14 ± 0.07 Oatp1a4 1.00 ± 0.52 0.68 ± 0.15 0.72 ± 0.28 0.75 ± 0.37 Oatp1b2 1.00 ± 0.20 0.90 ± 0.15 0.95 ± 0.13 1.10 ± 0.17

Mrp3 1.00 ± 0.22 1.11 ± 0.32 1.18 ± 0.32 2.14 ± 0.81*

Hepatic Sinusoidal

Transporters

Mrp4 1.00 ± 0.09 0.98 ± 0.21 0.93 ± 0.47 1.27 ± 0.58 VDR 1.00 ± 0.11 1.34 ± 0.72 1.17 ± 0.29 1.75 ± 0.23*

Cyp3a2 1.00 ± 0.21 0.95 ± 0.19 1.61 ± 0.65 1.66 ± 0.36* Asbt 1.00 ± 0.26 0.78 ± 0.24 0.89 ± 0.38 0.68 ± 0.29 Ostα 1.00 ± 0.11 1.53 ± 0.75 1.34 ± 0.33 2.24 ± 0.97*

Cholangiocyte

Ostβ 1.00 ± 0.34 0.65 ± 0.13 0.56 ± 0.10 0.79 ± 0.33 Bsep 1.00 ± 0.07 1.04 ± 0.09 1.17 ± 0.23 1.36 ± 0.21* Mrp2 1.00 ± 0.19 1.14 ± 0.21 1.05 ± 0.18 0.94 ± 0.26

Hepatic Canalicular

Transporters Mdr1a 1.00 ± 0.27 1.98 ± 0.50* 1.78 ± 0.83 2.26 ± 0.84* * P < .05, compared to vehicle treatment (0 nmol 1,25(OH)2D3 /kg/day) using two-tailed Student’s t test # P < .05, compared to vehicle treatment (0 nmol 1,25(OH)2D3/kg/day) using Mann-Whitney U test

71

Hepatic Cytochrome P450 Enzymes

Cyp7a1 Cyp3a

Rel

ativ

e P

rote

in E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.400.641.282.56


* *

*

0

Hepatic Canalicular Transporters

Bsep P-gp Mrp2 Asbt

Rel

ativ

e P

rote

in E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.500.641.282.56


*

*

0

Efflux Uptake(Cholangiocyte)

1b21a4

EffluxUptake

0


Hepatic Sinusoidal Transporters

Ntcp Oatp Oatp. Oatp.. Mrp3 Mrp4

Rel

ativ

e P

rote

in E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

00.641.282.56

1a1

Figure 3-12 Dose-dependent effects of 1,25(OH)2D3 on protein changes in cytochrome P450 isozymes (A), and sinusoidal (B) and canalicular (C) transporters (n = 3 or 4 in each group) in rat liver. Gapdh, Cyp7a1, Ntcp, Oatp1a1, Oatp1a4, Oatp1b2, and Bsep bands were detected at 37, 50, 50, 80, 94, 80, and 160 kDa, their molecular weights, respectively. “*” indicates P < 0.05 compared to vehicle control using the two-tailed Student’s t test.

(A)

(B)

(C)

0 0.64 1.28 2.56


Cyp7a1

Cyp3a

Gapdh

56

50

37

MW

0 0.64 1.28 2.56


Cyp7a1

Cyp3a

Gapdh

56

50

37

MW

0 0.64 1.28 2.56


48

160

180

170P-gp

Mrp2

Bsep

Asbt

Gapdh 37

MW

0 0.64 1.28 2.56


48

160

180

170P-gp

Mrp2

Bsep

Asbt

Gapdh 37

MW

Ntcp

Oatp1a1

Oatp1a4

Oatp1b2

Mrp3

Mrp4

0 0.64 1.28 2.56


Gapdh

160

170

80

94

80

50

37

MW

Ntcp

Oatp1a1

Oatp1a4

Oatp1b2

Mrp3

Mrp4

0 0.64 1.28 2.56


Gapdh

160

170

80

94

80

50

37

MW

72

Table 3-4 Changes in mRNA expression of rat renal nuclear receptors, enzymes, and transporters, expressed as fold expression compared

to vehicle treatment

1,25(OH)2D3 Dose (nmol/kg/day) Gene 0 0.64 1.28 2.56 VDR 1.00 ± 0.25 2.30 ± 0.26* 1.82 ± 0.12* 1.72 ± 0.66* FXR 1.00 ± 0.20 0.69 ± 0.15 0.58 ± 0.08* 0.50 ± 0.16* SHP 1.00 ± 0.35 0.49 ± 0.14 0.52 ± 0.14* 0.36 ± 0.14*

HNF-1α 1.00 ± 0.25 0.56 ± 0.07* 0.47 ± 0.09* 0.37 ± 0.15* HNF-4α 1.00 ± 0.24 0.61 ± 0.10* 0.63 ± 0.08* 0.47 ± 0.13*

Renal Nuclear Receptors

LRH-1 1.00 ± 0.26 1.10 ± 0.21 1.09 ± 0.14 1.32 ± 0.22 Cyp24 1.00 ± 0.35 21.6 ± 2.43* 20.5 ± 1.97* 19.4 ± 7.91* Cyp3a1 1.00 ± 1.13 0.96 ± 1.27 0.18 ± 0.06 0.29 ± 0.34 Cyp3a2 1.00 ± 1.23 0.65 ± 0.99 0.06 ± 0.09 0.02 ± 0.03*

Renal Cytochrome

P450s Cyp3a9 1.00 ± 0.58 17.1 ± 24.12 21.0 ± 18.8 67.89 ± 53.5* Asbt 1.00 ± 0.24 3.71 ± 1.43* 3.87 ± 0.63* 5.24 ± 2.09* Ost 1.00 ± 0.46 0.75 ± 0.17 0.61 ± 0.14 0.40 ± 0.15* Ost 1.00 ± 0.46 0.54 ± 0.12 0.61 ± 0.05 0.81 ± 0.27

Mdr1a 1.00 ± 0.22 1.85 ± 0.38* 2.18 ± 0.35* 1.61 ± 0.24* Mrp2 1.00 ± 0.16 1.02 ± 0.12 1.26 ± 0.13 1.09 ± 0.19 Mrp3 1.00 ± 0.16 0.90 ± 0.29 1.03 ± 0.10 1.10 ± 0.45

Renal Apical Transporters

Mrp4 1.00 ± 0.27 0.52 ± 0.09* 0.53 ± 0.05* 0.54 ± 0.16* * P < .05, compared to vehicle treatment (0 nmol 1,25(OH)2D3 /kg/day) using two-tailed Student’s t test

73

Figure 3-13 Dose-dependent effects of 1,25(OH)2D3 on changes in (B) protein of renal nuclear receptor, cytochrome P450 isozymes and transporters (n = 3 or 4 in each group). Gapdh, VDR, Cyp24, Cyp3a, Asbt, P-gp, Mrp2, Mrp3, and Mrp4 bands were detected at 37, 52, 50, 56, 48, 170, 180, 170, and 160 kDa, their molecular weights, respectively. “*” indicates P < 0.05 compared to vehicle control using two-tailed Student’s t test.

MW

0 0.64 1.28 2.56


37

52VDR

Gapdh

MW

0 0.64 1.28 2.56


37

52VDR

Gapdh

Cyp24

Gapdh

Cyp3a

50

37

56

MW

0 0.64 1.28 2.56


Cyp24

Gapdh

Cyp3a

50

37

56

MW

0 0.64 1.28 2.56


VDR Cyp24 Cyp3a P-gp Mrp2 Mrp3 Mrp4Rel

ativ

e P

rote

in E

xpre

ssio

n in

Kid

ney

0

1

2

3

4

5

6

7

8

00.641.282.56


*

*

*

*

0

P-gp

Asbt

Mrp2

Mrp4

Gapdh

MW

0 0.64 1.28 2.56


Mrp3

170

48

180

160

37

170

P-gp

Asbt

Mrp2

Mrp4

Gapdh

MW

0 0.64 1.28 2.56


Mrp3

170

48

180

160

37

170

74

3.5 DISCUSSION

This study unequivocally demonstrated that, in addition to FXR, there is a direct

and indirect role for 1,25(OH)2D3-liganded VDR on the regulation of transporters and

enzymes associated with bile acid homeostasis in rats. The direct effects of 1,25(OH)2D3

activated VDR in rat intestine and kidney are tissue-specific and related to the presence of

VDR. VDR is much higher in the intestine than in the rat liver (Fig. 3-1A), wherein VDR

is localized in cholangiocytes and stellate cells and virtually absent in hepatocytes (Gascon-

Barré et al., 2003). Humans, however, display a slightly higher liver VDR level (Gascon-

Barré et al., 2003). Thus, no change in VDR-target genes was expected for liver and larger

changes are expected in small intestine and kidney (Table 3-2). Following the subcutaneous

injection of radiolabeled 1,25(OH)2D3, the liver receives only a minor (one third or one

quarter) exposure compared to the duodenum (Brown et al., 2004). In addition, VDR

expression in the intestine is a >1000-fold that of the liver (Sandgren et al., 1991).

Although Gascon-Barré et al. (2003) reported that VDR in biliary cells is about one-third of

that in the intestine, biliary cells represent only ~5% of the cells in a normal liver (Racanelli

and Rehermann, 2006). Hence, the role of VDR in the liver may be negligible compared to

the intestine due to the both low expression of VDR and exposure to 1,25(OH)2D3.

A correlation between VDR- and 1,25(OH)2D3-mediated induction of Cyp3a was

clearly observed in the different organs (Figs. 3-1 and 3-4; Table 3-3 and 3-4).

Upregulation of intestinal Cyp3a1 but not Cyp3a9 mRNA was observed, and the same

pattern was repeated in intestinal slices (Khan et al., 2009b). These results are in contrast

with reports of increased Cyp3a9 mRNA in rats treated with 1,25(OH)2D3 in vivo (Zierold

75

et al., 2006). Total Cyp3a protein induction, speculated to be Cyp3a1 due to the induction

of Cyp3a1 mRNA, and high levels of VDR were observed (Fig. 3-4), similar to the result

reported in rat intestinal slices incubated with 100 nM of 1,25(OH)2D3 (Khan et al., 2009b).

In liver, induction of each of the Cyp3a isozymes was VDR- and site-specific. We observed

induction of only Cyp3a2 mRNA expression (Table 3-3), reportedly present only in biliary

epithelial cells, where VDR is localized (Gascon-Barré et al., 2003). However, Cyp3a1 and

Cyp3a9 mRNA remained unchanged in the liver after 1,25(OH)2D3 treatment, and this can

be explained by the absence of VDR in hepatocytes. However, there may be two

explanations why Cyp3a proteins are not induced in liver, but are increased in intestine.

First, Brown et al. (2004) showed that liver receives lower 1,25(OH)2D3 exposure than the

intestine when radiolabeled 1,25(OH)2D3 was administrated subcutaneously to rats. Second,

VDR is present at very low levels in the liver (Gascon-Barré et al., 2003) and is absent in

rat hepatocytes. Both of these reasons explain why Cyp3a protein was not increased in liver

by 1,25(OH)2D3. Interestingly, Cyp3a9 mRNA in kidney was induced (Table 3-4) even

though renal Cyp3a1 and Cyp3a2 mRNAs were not altered by 1,25(OH)2D3, results that are

in contrast to observations on the induction of Cyp3a1 in intestine (Fig. 3-4) and Cyp3a2 in

liver (Table 3-3) in rat in vivo and in rat intestinal slices (Khan et al., 2009b). These

observations suggest that induction of Cyp3a9 isoform is renal-specific. At this juncture,

we were unable to quantify the intracellular 1,25(OH)2D3 concentration in tissues because

of the lack of a sensitive assay (Vieth et al., 1990). In sum, Cyp3a1 in small intestine,

Cyp3a2 in liver, and Cyp3a9 in kidney were induced by VDR in a tissue specific manner.

In rat intestine, the induction of Mrp proteins (Figs. 3-8, 3-9, and 3-10) in the

proximal segments could be due to non-genomic effects of 1,25(OH)2D3, as it was shown

76

to be linked to an active calcium absorption mechanism triggered by the VDR in the

duodenum and proximal jejunum (Marks et al., 2007). 1,25(OH)2D3 increases Ca2+ uptake

by the rat duodenum, an effect that may be linked to the cAMP-mediated activation of

plasma membrane Ca2+ channels (Massheimer et al., 1994). The increased cAMP could

result in elevated levels of Mrp2 (Roelofsen et al., 1998) and Mrp3 protein (Chandra et al.,

2005) in S1 and S2 segments, either by short term regulation or membrane vesicle

trafficking. Furthermore, there may be a role for cAMP on Mrp4 protein expression after

1,25(OH)2D3 treatment, because Mrp4 has been shown to transport cAMP and cGMP (van

Aubel et al., 2002). Similar observations were made in human Caco-2 cells; incubation with

100 nM of 1,25(OH)2D3 for > 3 days increased MRP4 protein without a change in mRNA,

likely due to the stabilization of MRP4 protein after 1,25(OH)2D3 treatment (Fan et al.,

2009).

In rat kidneys, there was induction of P-gp, which is localized in renal proximal

tubules (Huls et al., 2007), and Asbt localized in the renal cortex (Anakk et al., 2003),

(Table 3-4; Fig. 3-13). Recently, Saeki et al. (2008) and Chen et al. (2006) showed the

presence of a VDRE in the human MDR1 and Asbt genes, respectively. Thus, induction of

rat renal P-gp and Asbt (Fig. 3-13) is most likely via VDR transactivation. Previously, we

attributed that increased ileal Asbt with 1,25(OH)2D3 treatment (Chen et al., 2006).

Presently, we found that renal Asbt was also induced by VDR, and this could further

increase bile acid reabsorption. This would further increase plasma bile acid concentrations

leading to downstream FXR effects in the liver. Overall, renal VDR plays an important role

in the regulation of renal transporters that are VDR target genes.

77

Changes observed in transporters and enzymes in the intestine and liver after

1,25(OH)2D3 treatment that are related to the indirect effects of VDR in the rat in vivo are

summarized in Fig. 3-14. In the rat intestine, induction of Asbt (Fig. 3-6) by 1,25(OH)2D3-

liganded VDR (Chen et al., 2006) led to an increase in portal bile acid concentrations

(Table 3-2). Due to the lack of a negative feedback mechanism of FXR-SHP-LRH-1 on

Asbt, because of the absence of a LRH-1 cis acting element in the rat Asbt promoter (Chen

et al., 2003), increased Asbt protein is observed in response to 1,25(OH)2D3, together with

increased Ost-Ost, triggered increase in bile acid absorption from enterocytes, leading to

increased bile acid efflux into the portal blood (Table 3-2). In addition, increased bile acids

in enterocytes activate FXR targeted genes. Inagaki et al. (2005) reported FXR activation in

mice with GW4064 treatment (a FXR ligand) resulted in increased in the mRNA of its

targets, SHP and FGF15, and decreased Cyp7a1 in the mouse liver in vivo without changes

in FXR. Similarly, the present data showed that mRNA of the FXR-target genes, SHP,

Ost, Ost, and FGF15, were increased in the ileum.

78

Blood

Enterocyte

Lumen

Ntcp

Oatp*

Mrp4

Cholangiocyte

Portal Vein

Enterocyte

Unchanged

mRNA + protein

Inhibition

Asbt

Bile

HepatocyteCyp3a

Induction

FXRLRH-1

Mrp2

Protein

mRNA

Cyp7a1

VDR

FGFR4

Inductive pathway

Inhibitory pathway

Ostβ

FGF15

FGF15

Cyp3a2

HNF-4LXR

HNF-1

LRH-1

Mrp3

SHP

OstαOstβ

Bsep

VDR

Cyp3a

Asbt

P-gp

SHP

FXR

Ost

Blood

Enterocyte

Lumen

NtcpNtcp

Oatp*Oatp*

Mrp4Mrp4

Cholangiocyte

Portal Vein

Enterocyte

Unchanged

mRNA + protein

Inhibition

AsbtAsbt

Bile

HepatocyteCyp3a

Induction

FXRLRH-1

Mrp2Mrp2

Protein

mRNA

Cyp7a1Cyp7a1

VDR

FGFR4FGFR4

Inductive pathway

Inhibitory pathway

OstβOstβ

FGF15FGF15

FGF15FGF15

Cyp3a2

HNF-4LXR

HNF-1

LRH-1

Mrp3

SHP

OstαOstβ

Bsep

VDR

Cyp3a

Asbt

P-gp

SHP

FXR

Ost

Figure 3-14 A schematic diagram highlighting direct and indirect effects of 1,25(OH)2D3 on intestinal and hepatic nuclear receptors, drug transporters and enzymes. Cyp3a and Asbt protein were upregulated by VDR. As a result, absorption of bile acids into enterocytes was increased, which in turn, activated intestinal FXR and increased SHP, FGF15, Ostα and Ostβ. Intestinal FGF15 binds to FGFR4 in liver to inhibit liver Cyp7a1. In liver, FXR and SHP are activated by bile acids and resulted in upregulation of Bsep, Mrp3, and Ost mRNA, and downregulation of hepatic Cyp7a1 protein. “*” represents the Oatp isoforms, Oatp1a1, Oatp1a4, and Oatp1b2.

79

The increased bile acid present in the portal vein could elicit FXR-related changes.

Changes in liver after 1,25(OH)2D3 administration, other than Cyp3a2, were mostly FXR-

related events. The elevated hepatic FXR-SHP (Table 3-3) and intestinal FGF15 (Fig. 3-3)

levels would in turn downregulate Cyp7a1 in liver (Goodwin et al., 2000; Inagaki et al.,

2005; Song et al., 2009). Indeed, there was decreased Cyp7a1 protein (Fig. 3-12A) and

lessened microsomal Cyp7a1 activity (60%) in the liver after 1,25(OH)2D3 administration;

the lack of correlation with Cyp7a1 mRNA was, however, unexplained. Other factors might

be involved in stabilizing the mRNA expression, and more studies are needed to clarify this

mechanism. In other reports, a reduction (73%) in Cyp7a1 activity in rats has been

attributed to the bile acid, deoxycholic acid (Hylemon et al., 1989). In addition, Inagaki et

al. (2005) reported that FGF15 could downregulate Cyp7a1 in the liver through a

mechanism involving FGFR4 and the c-Jun N-terminal kinase (JNK)-dependent pathway

(Holt et al., 2003). In this study, we suggest that the synergy of increased FXR and SHP in

the liver (Table 3-3), due to elevated bile acids (Table 3-2) and the increase in FGF15 (Fig.

3-3) in the intestine, led to a decrease in Cyp7a1 protein (Fig. 3-12A) and reduction in

Cyp7A1 activity.

Furthermore, induced mRNA of Bsep and Ost, other FXR-target genes, after

1,25(OH)2D3 treatment were also observed (Table 3-3). Other effects of 1,25(OH)2D3 on

liver transporters were confined to Mrp3 and Mdr1a mRNA and P-gp protein (Table 3-3

and Fig. 3-13C). Elevated Mrp3 expression was also observed in rat liver slices incubated

with 1,25(OH)2D3 (unpublished data), and increased Mrp3 protein has been observed in the

mutant EHBR rats, which increases the basolateral efflux transport of taurocholic acid in

response to loss of Mrp2 function (Akita et al., 2001; Akita et al., 2002), suggesting

80

possible roles of 1,25(OH)2D3 and liver bile acids on the induction of Mrp3. Zöllner et al.

(2003) have also reported that hepatic Mrp3 levels in fxr(+/+) and fxr(-/-) mice are elevated

with cholic acid and ursodeoxycholic acid treatment, suggesting a FXR-independent

mechanism for Mrp3 induction. Martin et al. (2008) showed that chenodeoxycholic acid

treatment induced MDR1 mRNA and protein expression in HepG2 cells. More studies are

needed to examine whether the changes of these transporters are related to VDR or FXR

activation.

In summary, we showed that 1,25(OH)2D3 is capable of directly and indirectly

altering intestinal, hepatic, and renal transporters and enzymes in the rat in vivo. Tissue-

and enzyme-specific induction by VDR occurred due to the differential abundances of

VDR and the dose of 1,25(OH)2D3 administered. Direct VDR changes in the transporters

and enzymes were found in the rat intestine and kidney where higher levels of VDR exist.

FXR, SHP, Ost Bsep and Mrp3 mRNA levels were increased in the rat liver, suggesting

that these secondary FXR effects are elicited as a result of increased bile acid absorption by

Asbt. Repression of hepatic Cyp7a1 protein and activity was observed, likely the result of

secondary FXR effects in the liver as well as increased FGF15 in the intestine. Changes in

hepatic Mrp3 and Mdr1a mRNA and P-gp protein by 1,25(OH)2D3 were, however,

unexplained, but may be FXR-related. The changes found in the intestine, liver, and kidney

associated with 1,25(OH)2D3 treatment could affect drug absorption, oral bioavailability,

metabolism, and elimination. The consequences of the activation of VDR by 1,25(OH)2D3

or vitamin D analogues on first-pass elimination are paramount, especially with the

administration of the vitamin D analogues, an emergent class of therapeutics for the

treatment of cancer and other diseases (Trump et al., 2004; Brown and Slatopolsky, 2008).

81

This new information further opens up more queries. More experiments are needed to

examine possible regulatory mechanisms as well as examine changes in drug disposition.

3.6 ACKNOWLEDGMENTS

We thank Dr. Jianghong Fan of our laboratory for assistance in tissue collection and

Dr. Carolyn Cummins of the University of Toronto for invaluable discussions. Dr. Han-Joo

Maeng was supported by the Government of Canada Post-doctoral Research Fellowship

(PDRF). This work was supported by the Canadian Institutes for Health Research,

MOP89850.

3.7 STATEMENT OF SIGNIFICANCE OF CHAPTER 3

This chapter examined the role of the VDR on the regulation of transporters and

enzymes in the in vivo rat. The data showed that the VDR most likely played a direct role in

changes in transporters and enzymes in rat intestine and kidney. Activation of VDR in the

ileum triggered the induction of ileal Asbt, which led to an increase in bile acid absorption.

High concentration of bile acids in the enterocytes and liver activated intestinal and hepatic

FXR, which downregulated Cyp7a1, the cholesterol metabolizing enzyme. Due to changes

in transporters and enzymes in intestine, liver, and kidney, more studies are needed to be

performed to differentiate VDR and FXR effects. Some of these were addressed in

experiments conducted in conjunction with Dr. G.M.M. Groothuis in The Netherlands (see

APPENDICES A1, A2, and A3). Other transporters such as PepT1, Oat1, and Oat3 have

also been examined in the rat intestine and kidney (APPENDIX A4). Moreover the

functional studies of increased intestinal transporters: PepT1, Mrp2, Mrp4, but not P-gp

were confirmed in published, intestinal everted sac studies (Maeng et al., 2011) that appear

82

in APPENDIX A5. Moreover, doxercalciferol (HECTOROL®) and higher 1,25(OH)2D3

doses were examined in the rat, at a more protracted regimen (4 doses given every other

day for 8 days) to rats to compare these effects. The results are summarized in a published

paper (Chow et al., 2011b) (See APPENDIX A6).

In the study, I was involved in the treatment of 1,25(OH)2D3 to rats and tissue

harvesting, performed mRNA and protein extractions, analyzed mRNA and protein

expressions in the intestine, liver, and kidney as well as bile acid and ALT measurement.

Hanjoo Maeng contributed to microsomal preparation to examine rat Cyp7a1 microsomal

activities.

83

CHAPTER 4

4. 1,25-DIHYDROXYVITAMIN D3 UPREGULATES P-GLYCOPROTEIN

ACTIVITIES, EVIDENCED BY INCREASED RENAL AND BRAIN EFFLUX OF

DIGOXIN IN MICE IN VIVO

Edwin C.Y. Chow, Matthew R. Durk, Carolyn L. Cummins, and K. Sandy Pang

Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of

Toronto, Canada

Reprinted with permission of Journal of Pharmacology and Experimental Therapeutics. All rights reserved. J Pharmacol Exp Ther 2011; 337:846-859.

84

4.1 ABSTRACT

Farnesoid X receptor (FXR) effects, in addition to vitamin D receptor (VDR) effects,

were observed in rat liver after treatment with 1α,25-dihydroxyvitamin D3 [1,25(OH)2D3],

the natural ligand of VDR, due to increased bile acid absorption as a consequence of Asbt

induction. To investigate whether the increased Mdr1/P-gp expression in the rat liver and

kidney is due to VDR and not FXR, we examined changes in Mdr1/P-gp expression in

fxr(+/+) and fxr(-/-) mice after intraperitoneal dosing of vehicle vs. 1,25(OH)2D3 (0 or 2.5

μg/kg every other day for 8 days). Renal and brain levels of Mdr1 mRNA and P-gp protein

were significantly increased in both fxr(+/+) and fxr(-/-) mice treated with 1,25(OH)2D3,

confirming that Mdr1/P-gp induction occurred independently of the FXR. Functional

increases in P-gp were evident in 1,25(OH)2D3-treated fxr(+/+) mice given intravenous

bolus doses of the P-gp probe, [3H]digoxin (0.1 mg/kg). Decreased blood (24%) and brain

(29%) exposure, estimated as AUCs, due to increased renal (74%) and total body (34%)

clearances of digoxin were observed in treated mice. These events were predicted by

physiologically-based pharmacokinetic (PBPK) modeling that showed increased renal

secretory intrinsic clearances (3.45-fold) and brain efflux intrinsic clearances (1.47-fold) in

the 1,25(OH)2D3-treated mouse, trends that correlated well with increases in P-gp protein

expression in tissues. The clearance changes were less apparent due to high degree of renal

reabsorption of digoxin. Nonetheless, the observations suggest an important role of the

VDR in the regulation of P-gp in the renal and brain disposition of P-gp substrates.

85

4.2 INTRODUCTION

P-Glycoprotein (P-gp), the gene product of the multidrug resistance protein 1

(MDR1 or ABCB1), is a 170-kDa membrane transporter and member of the adenosine

triphosphate (ATP)-binding cassette (ABC) superfamily (Juliano and Ling, 1976). P-gp

functions as an ATP-powered drug efflux pump that interacts with numerous large,

nonpolar, and weakly amphipathic compounds and cations of no apparent structural

similarity. P-gp is highly expressed in many major organs and tissues in the body, including

intestine, liver, brain, kidney, colon, testes and placenta (Cordon-Cardo et al., 1990). For

this reason, P-gp plays a critical role in drug absorption, distribution, and elimination and is

recognized as an important target for drug-drug interactions (Yu, 1999).

Over the past few decades, multiple nuclear receptors and transcription factors have

been found to regulate MDR1/P-gp expression (Reschly and Krasowski, 2006). These

include the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR),

commonly referred to as xenobiotic-sensing nuclear receptors. Transactivation of the

mouse Mdr1 gene by the humanized PXR was observed to result in altered drug disposition

in transgenic mice (Bauer et al., 2006). The rodent Mdr1 or human MDR1 gene is also

regulated by the farnesoid X receptor (FXR) (Landrier et al., 2006; Martin et al., 2008) and

the FXR ligand, chenodeoxycholic acid (CDCA), increased MDR1 mRNA in HepG2 cells

(Martin et al., 2008). The vitamin D receptor (VDR) displays similar homology with PXR

and CAR (Reschly and Krasowski, 2006), and is another nuclear receptor that

transactivates MDR1. 1,25-Dihydroxyvitamin D3 [1,25(OH)2D3], the natural, active

ligand of VDR (Tanaka et al., 1973), upregulates MDR1/P-gp expression in human colon

86

carcinoma cell lines, such as the Caco-2, LS180 and LS174T cells (Aiba et al., 2005; Fan et

al., 2009; Tachibana et al., 2009), and elevated P-gp in human airway epithelium-derived

Caclu-3 cells (Patel et al., 2002). These results are consistent with the existence of a

vitamin D response element (VDRE) in the MDR1 gene (Saeki et al., 2008).

In rats treated with 1,25(OH)2D3 in vivo, VDR led to increases in both Mdr1a

mRNA and P-gp protein in liver and kidney (Chow et al., 2009; Chow et al., 2010). Due to

low levels of VDR in rat liver (Gascon-Barré et al., 2003), induction of Mdr1a was

suspected to be a result of indirect FXR effects elicited by induction of the apical sodium-

dependent bile acid transporter (Asbt) in the rat intestine, culminating in increased

absorption of bile acids into the portal blood (Chen et al., 2006) rather than from direct

VDR effects. Upon entering the liver, bile acids, ligands of FXR, elicit hepatic FXR effects

(Chow et al., 2009). Inasmuch as MDR1/P-gp may also be induced by bile acids (Martin et

al., 2008), the increase in hepatic P-gp could be the consequence of both direct VDR effects

and/or indirect FXR effects upon 1,25(OH)2D3 treatment to the in vivo rats.

To determine whether regulation of Mdr1/P-gp was via the direct action of the VDR

or indirectly via the FXR, we carried out the present study to examine Mdr1/P-gp changes

in fxr(-/-) mice and compared the changes in gene expressions with those for the wild-type

fxr(+/+) mice after vehicle and 1,25(OH)2D3 treatment. FXR effects become obviated in

fxr(-/-) knockout mice, despite that combined VDR and FXR effects would persist in

fxr(+/+) wild-type mice in vivo. A protracted dosing regimen of 50 ng (2.5 µg/kg) of

1,25(OH)2D3 by intraperitoneal injection every other day for 8 days was chosen to lessen

hypercalcemia (Chow et al., 2011b). Changes in protein and mRNA expression were first

determined to rule out the contribution of FXR in the upregulation of Mdr1/P-gp in both

87

fxr(+/+) and fxr(-/-) mice. We further investigated the fate of an intravenous administration

of tritiated [3H]digoxin, a P-gp probe, that is eliminated only via excretion in mice, to

demonstrate changes in digoxin disposition due to elevated P-gp after 1,25(OH)2D3

treatment. In vivo tissue levels of [3H]digoxin, which undergoes enterohepatic recirculation

and renal tubular reabsorption, in treated and untreated fxr(+/+) mice were fit to a

physiologically-based pharmacokinetic (PBPK) model to appraise the role of the VDR in

altering P-gp function. Special attention was given to P-gp levels in brain, the site of action

of analgesics, antiepileptics, anticancer, and antiretroviral drugs, and in the heart, the site of

action of digoxin.

4.3 METHODS

4.3.1 Materials

1,25(OH)2D3 was purchased in powder form from Sigma-Aldrich Canada

(Mississauga, ON). The primary antibodies for Western blotting were obtained from

various sources: anti-P-gp (C219) and anti-Gapdh (6C5) and anti-Lamin B (Cat# ab45848)

from Abcam, Cambridge, MA; villin (C-19) from Santa Cruz Biotechnology (Santa Cruz,

CA); anti-VDR (MA1-710) from Thermo Fisher Scientific Inc., Rockford, IL. cDNA

synthesis and real-time PCR reagents were obtained from Applied Biosystems (Foster City,

CA). [3H]Digoxin (specific activity, 40 mCi/μmol) was purchased from PerkinElmer Life

and Analytical Sciences (Boston, MA) and purified by HPLC to > 99% radiochemical

purity (Liu et al., 2006b). All other consumable reagents, including unlabeled digoxin, were

obtained from Sigma-Aldrich Canada (Mississauga, ON) and Fisher Scientific

(Mississauga, ON).

88

4.3.2 Induction Studies with 1,25(OH)2D3 in fxr(+/+) and fxr(-/-) Mice In Vivo

Both male and female fxr(-/-) mice were kind gifts from Dr. Frank J. Gonzalez

(National Institutes of Health, Bethesda, MD). The fxr(-/-) mice contained only the last

exon of the FXR ligand binding domain and all the 3'-untranslated region of the FXR gene

(Sinal et al., 2000). The C57BL/6 pure strain male fxr(-/-) mice were genotyped using the

following fxr primers: Forward 1 (wild-type allele) 5'-

TCTCTTTAAGTGATGACGGGAATCT-3'; Forward 2 (Null allele) 5'-

GCTCTAAGGAGAGTCACTTGTGCA-3'; Reverse 5'-

GCATGCTCTGTTCATAAACGCCAT-3', as described by Sinal et al. (2000). Male wild-

type [fxr(+/+)] and knockout [fxr(-/-)] mice (8 – 12 weeks), bred in the animal facility of

the University of Toronto (ON, Canada), were given water and food ad libitum and

maintained on a 12:12-h light and dark cycle in accordance to approved protocols. Mice

were injected 0 or 2.5 µg/kg of 1,25(OH)2D3 in sterile corn oil intraperitoneally (i.p.) every

other day for 8 days. The concentration of 1,25(OH)2D3 in anhydrous ethanol was

determined spectrophotometrically at 265 nm (UV-1700, Shimadzu Scientific Instruments,

MD), and the 1,25(OH)2D3 solution was diluted in sterile corn oil (Sigma-Aldrich, ON) for

injection (Chow et al., 2009). The alternate- day regimen was chosen due to the lessened

hypercalcemia observed in comparison to those given doses on consecutive days (Chow et

al., 2011b).

On the 9th day, mice were anesthetized with an i.p. injection of ketamine and

xylazine (150 and 10 mg/kg, respectively). After flushing the blood from the lower vena

cava with 10 ml of ice-cold saline, the intestine, liver, brain, and kidneys were removed and

placed on ice. The ileal segment, taken as 6 cm proximal to the ileocecal junction and

89

known to consist of the highest abundance of P-gp (Stephens et al., 2001; Liu et al., 2006b),

was used for protein and mRNA analyses. The ileum was flushed with physiologic saline

containing 1 mM phenylmethylsulfonyl fluoride (PMSF) to rid of feces, everted and placed

into the same saline solution containing PMSF before being scraped with a tissue-scraper

for the collection of enterocytes (Chow et al., 2009). The liver, brain, kidneys and heart

were weighed and cut into small pieces. The scraped enterocytes and tissue pieces were

snap-frozen with liquid nitrogen, and stored at -80°C until further analyses.

4.3.3 Preparation of subcellular fractions

Frozen mucosal scrapings (50-100 mg of tissue) were homogenized with 1 ml of

Tris-HCl (0.1 M, pH 7.4) buffer containing 1% protease inhibitor cocktail (Sigma-Aldrich,

ON) and sonicated, as described by Chow et el. (2009). After centrifugation at 1,000 g for

10 min at 4°C, the resulting supernatant was spun again at 21,000 g for 1 h at 4°C to yield a

pellet or crude membrane fraction. The pellet was placed in a resuspension buffer (50 mM

mannitol, 20 mM HEPES, 20 mM Trizma base, pH 7.4), which was premixed with 1%

protease inhibitor cocktail (Sigma-Aldrich, ON). The liver, brain, and kidney tissue

samples were homogenized (1:5 w/v) in a buffer (250 mM sucrose, 10 mM HEPES, and 10

mM Tris-HCl, pH 7.4), which was premixed with 1% protease inhibitor cocktail (Sigma-

Aldrich, ON). The homogenate was centrifuged at 3,000 g for 10 min at 4°C, and the

resulting supernatant was spun again at 33,000 g for 60 min at 4°C. The crude membrane

pellet was placed in the resuspension buffer. A unified procedure was used for preparation

of the crude nuclear fraction. All tissues were homogenized in an identical fashion with the

same homogenizing buffer (250 mM sucrose, 10 mM HEPES, and 10 mM Tris-HCl, pH

7.4) containing 1% protease inhibitor cocktail, and the homogenate was spun at 3,000 g

90

wherein the resultant pellet was resuspended in a nuclear buffer [60 mM KCl, 15 mM NaCl,

5 mM MgCl2•6H2O, 0.1 mM EGTA, 300 mM sucrose, 0.5 mM DTT, 0.1 mM PMSF, 300

mM sucrose, and 15 mM Trizma HCl pH 7.4] containing 1% protease inhibitor cocktail.

Protein concentration was measured by the Lowry method (Lowry et al., 1951).


For determination of the changes in VDR and P-gp protein levels among tissues, 20

to 80 µg was used; linearity for the relative intensity was shown to exist for the different

amounts of tissue used. The sample was loaded and separated by 7.5% and 10% SDS-

polyacrylamide gels, respectively, for VDR and P-gp analyses and transferred onto

nitrocellulose membranes (GE Healthcare, Chalfont St. Giles, Bukinghamshire, UK), as

described by Chow et al. (2009). The membrane was blocked with 5% (w/v) skim milk in

Tris-buffered saline (pH 7.4) with 0.1% Tween 20 (TBS-T) (Sigma-Aldrich, ON), and

washed three times with TBS-T before incubating with the primary antibody solution (2%

skim milk) overnight at 4°C. Thereafter, the membrane was washed three times with TBS-

T and incubated with a secondary antibody (2% skim milk) at room temperature for 2 h.

The membrane was washed three times, and then incubated with chemiluminescence

reagents from GE Healthcare for visualization of the band intensity, quantified by scanning

densitometry (NIH Image software; http://rsb.info.nih.gov/nih-image/). Protein loading

error was corrected by normalizing the target protein band against the protein band of the

house-keeping gene: villin for intestinal samples, Lamin B for the comparison of VDR

among tissues, and Gapdh for the same tissue type.

91

4.3.5 Quantitative Real-Time Polymerase Chain Reaction (qPCR)

The detailed procedure of RNA extraction has been described previously (Chow et

al., 2009). For total RNA isolation, scraped enterocytes and other organ tissues were

homogenized with TRIzol (50-100 mg/ml) solution and extracted with the TRIzol

extraction method (Sigma-Aldrich, ON) according to the manufacturer’s protocol, with

modifications. RNA purity of each sample was checked by 260 nm/280 nm and 260

nm/230 nm absorbance ratios (≥1.7). Exactly 1.5 µg of total RNA was converted to cDNA.

Real-time quantitative polymerase chain reaction (qPCR) was performed with the SYBR

Green detection system (Applied Biosystems 7500 Real-Time PCR System, Streetsville,

ON). Information on the primer sequence is summarized in Table 4-1, and the primer

specificity was checked by BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/).

Critical threshold cycle (CT) values of the target genes were collected using ABI Sequence

Detection software version 1.4. The target gene mRNA data was normalized to the

housing-keeping gene: villin for intestinal samples and cyclophillin for other tissue samples.

The difference in CT values (∆CT) between target and house-keeping genes was compared

to the corresponding ∆CT of the vehicle control (∆∆CT) and expressed as fold expression, 2-

(∆∆CT), for relative mRNA quantification.

Table 4-1 Mouse primer sets for quantitative Real-Time PCR

Gene Bank

Number Forward (5’→ 3’ Sequence) Reverse (5’→ 3’ Sequence)

Mdr1a NM_011076 TACGACCCCATGGCTGGATC GGTAGCGAGTCGATGAACTG

VDR NM_009504 GAGGTGTCTGAAGCCTGGAG ACCTGCTTTCCTGGGTAGGT

Villin NM_009509 TCCTGGCTATCCACAAGACC CTCTCGTTGCCTTGAACCTC

Cyclophillin X58990 GGAGATGGCACAGGAGGAA GCCCGTAGTGCTTCAGCTT

92

4.3.6 Pharmacokinetic Study of [3H]Digoxin in Vehicle or 1,25(OH)2D3 Treated Mice

The digoxin study was performed with fxr(+/+) mice only (same as C57BL/6 pure)

treated with vehicle (corn oil) or 2.5 μg/kg (or 50 ng/mouse) of 1,25(OH)2D3 given

intraperitoneally (i.p.) every other day for 8 days. On the 9th day, each mouse received a

bolus injection of 0.1 mg/kg digoxin and ~1.6 million dpm of [3H]digoxin in ~ 100 μl

filtered saline solution containing 1.5% propylene glycerol via the tail vein and was placed

inside a glass beaker atop a piece of suspended aluminum wire mesh for separate collection

of feces and urine. Three to five mice were rendered unconscious in a carbon dioxide

chamber and used for blood collection by cardiac puncture via a 1 ml syringe, which was

pre-rinsed with heparin (1000 IU/ml). The lower vena cava was perfused with ice-cold

saline to remove blood from tissues, and thereafter, the liver, kidney, heart, brain, and small

intestine were removed rapidly, weighed, snap-frozen in liquid nitrogen and stored at -80°C

for future analyses. The feces above the wire mesh were collected and pooled together with

flushed luminal contents of the small intestine and colon with ice-cold saline into pre-tared

15 ml polyethylene tubes. The urine from the collection beaker was pooled, together with

water rinses (twice with 1 ml of water).

4.3.7 [3H]Digoxin Analyses

Blood samples (0.25 ml) were deproteinized upon addition of methanol 1:4 (v/v).

The sample was mixed for 1 min and centrifuged at 14,000 g for 10 min at 4°C, and 0.9 ml

of the supernatant was removed for liquid scintillation counting. Varying known counts of

[3H]digoxin were added to blank blood (same volume as samples) and used as standards;

they were processed under identical conditions for construction of a calibration curve for

93

the determination of total radioactivity of [3H]digoxin in blood samples. Similarly, the

liver, kidney, heart, brain, and small intestine tissue were homogenized 1:3 (w/v) in saline

solution, and 0.25 ml (tissue) or 1.2 ml (brain) of the homogenate was deproteinized with

MeOH, 1:4 (v/v), while removing 1.0 to 4.8 ml for liquid scintillation counting. Blank

tissue homogenate samples, spiked with the appropriate aliquots of dpm's for construction

of calibration curves for each tissue, were processed according to the same deproteinization

procedure. Counts in the fecal mixtures were estimated to denote the extents of biliary and

luminal excretion; the contents were homogenized, and the radioactivity was extracted with

ethyl acetate, 1:4 (v/v) after mixing (vortex) vigorously for 5 min and spun at 14,000 g for

10 min at 4°C. An aliquot (0.95 ml) of the upper layer was removed for liquid scintillation

counting. Again, standards of known dpm's in fecal material were processed in an identical

manner and used for the construction of the calibration curve. The total radioactivity in

urine samples was determined directly by liquid scintillation counting.

The HPLC assay of Liu et al. (2006b) was used to separate digoxin from its di- and

mono-digitosoxides and the aglycone. The dpm's in the deproteinized samples from blood,

urine, feces, and tissue were separated by HPLC to resolve [3H]digoxin from its metabolite

(Liu et al., 2006b). The supernatant was evaporated under nitrogen gas and then

reconstituted with 100 μl methanol. The reconstituted residue was centrifuged and 75 μl of

the supernatant was injected into the HPLC Shimadzu system as described by Liu et al.

(2006b). Separation was achieved by a C18 reverse-phase column (Altech Associates,

Deerfield, IL; 4.6 × 250 mm, 10 μm particle size) and a binary gradient consisting of water

and acetonitrile, with an initial condition of 18% acetonitrile maintained at a flow rate of 1

ml/min, then increased to acetonitrile to 28% (Liu et al., 2006b). The eluted fractions were

94

collected at 1 min intervals and counted, and fractions of digoxin and its metabolites

recovered in the sample were multiplied by the total count of the sample to arrive at

individual dpm of digoxin and the metabolites. Results from HPLC revealed that, on

average, unchanged [3H]digoxin represented about 98% of the total radioactivity for all

blood and tissue samples (data not shown). A previous report also showed that the

metabolic clearance of digoxin in mice was only about 3% of total clearance (Kawahara et

al., 1999). Thus, the total radioactivity of the sample was taken to represent unchanged

[3H]digoxin.

4.3.8 Modeling and Fitting

4.3.8.1 Whole body physiologically-based pharmacokinetic modeling (PBPK)

The concept of intestinal segregated-flow was incorporated in the PBPK or

physiologically-based pharmacokinetic model (Li et al., 2002a; Liu et al., 2006b). In this

model, a minor portion of the intestinal flow (5-30%) perfuses the enterocyte region

whereas the majority of flow perfuses the serosal region (remaining flow, >70%) (Cong et

al., 2000). The model consists of tissue compartments that describe digoxin concentrations

in the blood (CB), heart (Cheart), kidney (CK), liver (CL), enterocyte (Cen) and serosal (Cs)

tissues of the small intestine, other tissues (Cother), brain tissue (CBr) and blood of the brain

(CBr,B) (Fig. 4-1). The volume and tissue to blood partition coefficient (tissue

concentration/blood concentration) of each tissue compartment, denoted as V and KTB

respectively, are further qualified with the appropriate subscript for that tissue. The

tissue/blood partition coefficient (KTB) of digoxin for the small intestine, liver, kidney, and

heart are obtained experimentally from the tissue/blood ratios towards the end of the study

95

(close to 600 min). We recognize that the tissue/blood concentration ratio would

underestimate the true partitioning ratio within eliminating organs (Khor et al., 1991; Chiba

et al., 1998). For the intestine, KTB,I or CI/CB,I (intestine tissue/blood leaving intestine) is

assumed to be identical for both the enterocyte and serosal tissue. This is an

oversimplication since for KTB,I would not equal Cen/Cenb (ratio of the enterocyte tissue

concentration relative to that in blood leaving the enterocyte) in view of the known, luminal

secretion by the P-gp. The estimate of KTB,I should be a better estimated by Cs/Csb (ratio of

the serosal tissue concentration relative to that in blood leaving the serosal tissue due to

lack of elimination), because the serosa represents the non-eliminating tissue of the

intestine. The distortion of KTB,I by luminal secretion should be low because the flow to the

enterocyte region was low, rendering a flow-weighted average concentration in intestine

that would be quite close to the true estimate, especially when luminal secretion is absent.

The intrinsic secretory clearances for kidney, liver, small intestine and for brain

efflux that are representative of P-gp activities are denoted as CLint,sec,K, CLint,sec,H, CLint,sec,I,

and BrefCL , respectively; Br

inCL represents the digoxin uptake intrinsic clearance into the

brain tissue. Biliary secretion (CLint,sec,H) followed by reabsorption (rate constant, ka) allow

for the enterohepatic circulation (EHC) of digoxin. For kidney, the filtrated and secreted

digoxin is prone to reabsorption, and the net excretion is modified the fraction reabsorbed

(FR) within the renal tubule, as described by Levy (1980). The roles of urinary pH, the pKa

of digoxin, and the urinary flow rate on digoxin reabsorption are not considered, and the

extent of reabsorption is assumed to be the same for both the control and 1,25(OH)2D3-

treated mice. The differential equations that relate to mass transfer across these

organs/tissues are summarized in 4.6 APPENDIX.

96

4.3.8.2 Fitting

Fitting of the PBPK model to data from the vehicle control and 1,25(OH)2D3-treated

fxr(+/+) mice was performed with the program, Scientist® (Micromath Version 2.0, St.

Louis, MO). Appropriate weighting schemes (unity, 1/observation, and 1/observation2)

were used. Some parameters were fixed in the fitting procedure; these included the blood

and tissue volumes (V) and organ flow rates (Q), unbound fraction of digoxin (fP and fB),

and blood/plasma concentration ratio (B/P). The tissue/blood partition coefficient (KTB) of

digoxin for the small intestine, liver, kidney, and heart were obtained experimentally from

the tissue/blood ratios towards the end of the study (close to 600 min).

The first strategy was to estimate the parameters first with the control data. The

blood, urine, feces and tissue data for the small intestine, liver, kidney, brain and heart in

control mice were used in the fitting to obtain the tissue/blood partition coefficient of the

lumped tissues KTB,other, ka, BrinCL , FR, the fractional intestinal flow entering the enterocyte

region (fQ), and the apparent intrinsic clearances. Because the unbound fraction of digoxin

in the intestine, liver, kidney, and brain (fI, fL, fK, and fBr) are unknown, the fitted intrinsic

secretory clearances (CLint,sec) and efflux clearance ( BrefCL ) were expressed as the product of

tissue unbound fraction in tissue and intrinsic secretory clearance (for example, the

apparent renal intrinsic secretory clearance, CL'int,sec,K is expressed as fKCLint,sec,K). With

the assumption that fQ, KTB,other, ka, BrinCL , and FR were identical between control and

treated mice, these estimates obtained the first fit were used to estimate the apparent

intrinsic clearances of the treated mice in a subsequent fit. The second strategy was to use

both sets of control and treated data in the same (or forced) fit to arrive at parameter

97

estimates. In the fit, fQ, KTB,other, ka, BrinCL , and FR were again considered as common and

unchanged parameters for both control and treated mice, and the apparent intrinsic

secretory clearances of the small intestine, liver, and kidney, and efflux clearances of the

brain (fBrBrefCL ) were allowed to alter due to 1,25(OH)2D3 treatment. The weighting of two

or 1/observation2 yielded the highest model selection criterion and lowest coefficient of

variation (standard deviation/ parameter value).

4.3.9 Statistical Analysis

Protein and mRNA data are expressed as mean ± standard deviation. The two-tailed

Student's t test was used to compare differences between the vehicle control and treatment

groups. For mRNA and protein analyses, data for the vehicle-treated sample from the

fxr(+/+) mouse was set as the control (value set as unity) and used for comparison with

those of other control and treatment samples. A P value of less than 0.05 was viewed as

significant.

4.4 RESULTS

4.4.1 VDR and Mdr1a/P-gp mRNA and protein expression in the ileum, liver,

kidney and brain of fxr(+/+) and fxr(-/-) mice

4.4.1.1 Distribution of VDR protein expression among tissues

With anticipation that the abundance of VDR would vary among tissues, samples

containing 50 µg of total crude nuclear protein were analyzed to examine the distribution of

VDR protein in the nuclear fractions in ileum, liver, kidney and brain of fxr(+/+) and fxr(-/-)

mice (data not shown). Linearity was shown to exist within the protein concentration range.

However, larger variations in Gapdh were found in comparison to those for Lamin B

98

among different tissues after loading of the same amount of tissue protein (data not shown).

Thus, VDR protein intensities among different tissues were normalized to Lamin B. VDR

protein expression for the ileum and kidney in both fxr(+/+) and fxr(-/-) mice was high and

similar; whereas VDR protein expression was significantly lower in the liver (29-35% of

ileum control) and even lower for the brain (13-27% of ileum control) of both fxr(+/+) and

fxr(-/-) mice. These results generally showed a lack of difference in VDR protein

expression between the fxr(+/+) and fxr(-/-) mice.

Basal levels of VDR mRNA in the ileum, kidney and brain were similar in both

fxr(+/+) and fxr(-/-) mice, whereas hepatic VDR mRNA in fxr(-/-) mice was three times

higher that of fxr(+/+) mice (Fig. 4-2A). Upon 1,25(OH)2D3 treatment, a significant

increase in VDR mRNA and protein (~3-fold) was observed for the kidney with

1,25(OH)2D3 treatment for both the fxr(+/+) and fxr(-/-) mice (Figs. 4-2), though there was

a slightly lower VDR protein in the brain of the 1,25(OH)2D3-treated fxr(-/-) mouse

compared to that of control fxr(-/-) mouse (Fig 4-2B). The reason for the latter was

unknown.

4.4.1.2 Effects of 1,25(OH)2D3 on Mdr1 mRNA and P-gp protein expression in

both fxr(+/+) and fxr(-/-) mice

Levels of Mdr1 mRNA and P-gp protein expression in ileum and liver of both the fxr(+/+)

and fxr(-/-) mice remained unaltered with 1,25(OH)2D3 treatment (Fig. 4-3). In contrast,

treatment of 1,25(OH)2D3 led to increased Mdr1 mRNA and P-gp protein expression in

kidney and brain of both fxr(+/+) and fxr(-/-) mice (Fig. 4-3), though the natural abundance

of Mdr1 mRNA in brain of fxr(-/-) mouse was considerably lower than that of the wild-type

counterpart, the fxr(+/+) mouse (P < .05) (Fig. 4-3A).

99

Figure 4-1 Whole body PBPK modeling with enterohepatic circulation and renal reabsoprtion of [3H]digoxin. Whole body PBPK model with blood and tissue (brain tissue, brain blood, heart, kidney, liver, small intestine, and other tissue) compartments. KTB, Q, and V represent the tissue to blood partition coefficient, blood flow to organ, and tissue volume, respectively;

fQ is the fractional intestinal blood flow to the enterocyte region. BrinCL and Br

efCL are the

intrinsic influx and efflux clearances into and out of brain, respectively. Other tissues: other tissue, brain, kidney, liver, and small intestine, are denoted by other, Br, K, L, and I; CLint,sec,K, CLint,sec,L, and CLint,sec,I are the intrinsic secretory clearances for the kidney, liver, and small intestine, respectively; ka is absorption rate constant in the intestine. See the 4.6 Appendix and Tables 4-3 and 4-4 for details.

Brain Tissue

Other Tissues

Kidney

Liver

Small Intestine

Intestinal lumen

HeartCheart, Vheart, KTB,heart

CBr, VBr

Cother, Vother, KTB,other

CK, VK, KTB,K

CL, VL, KTB,L

Cs, (1-fQ)VI, KTB,I

Alumen

Aurine

QBr

Qother

QK

QHA

(1-fQ)QPV

fQQPV

QPV

CLint,sec,K

CLint,sec,H

Qheart

CLef CLinBr Br

Dose

GFR

QHV

Enterocyte

Serosal

Cen, fQVI, KTB,I

CLint,sec,I ka

Brain Blood

CB, VBBlood

CBr,B, VBr,B

Serosal blood

Mucosal blood

Brain Tissue

Other Tissues

Kidney

Liver

Small Intestine

Intestinal lumen

HeartCheart, Vheart, KTB,heart

CBr, VBr

Cother, Vother, KTB,other

CK, VK, KTB,K

CL, VL, KTB,L

Cs, (1-fQ)VI, KTB,I

Alumen

Aurine

QBr

Qother

QK

QHA

(1-fQ)QPV

fQQPV

QPV

CLint,sec,K

CLint,sec,H

Qheart

CLef CLinBr Br

Dose

GFR

QHV

Enterocyte

Serosal

Cen, fQVI, KTB,I

CLint,sec,I ka

Brain Blood

CB, VBBlood

CBr,B, VBr,B

Serosal blood

Mucosal blood

100

X Data

a b

Rel

ativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

Vehicle control1,25(OH)2D3

0

Ileum

fxr (+/+) fxr (-/-)

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


*

0

Brain

fxr (+/+) fxr (-/-)

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0


**

0

Kidney

X Data

a b

Rel

ativ

e V

DR

mR

NA

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0


†

+ / + - / -0

Liver

X Data

a b

Re

lativ

e V

DR

mR

NA

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0


* *

0

Kidney

fxr (+/+) fxr (-/-)

Re

lativ

e V

DR

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Brain

X Data

a b

Rel

ativ

e V

DR

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5


0

Ileum

X Data

a b

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0


Liver

0

Re

lativ

e V

DR

mR

NA

Exp

ress

ion

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

Ileum

Liver

Kidney

Brain

fxr(+/+) fxr(-/-)

0 2.5 0 2.5

1,25(OH)2D3 (μg/kg)

X Data

a b

Rel

ativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5


0

Ileum

fxr (+/+) fxr (-/-)

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


*

0

Brain

fxr (+/+) fxr (-/-)

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0


**

0

Kidney

X Data

a b

Rel

ativ

e V

DR

mR

NA

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0


†

+ / + - / -0

Liver

X Data

a b

Re

lativ

e V

DR

mR

NA

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0


* *

0

Kidney

fxr (+/+) fxr (-/-)

Re

lativ

e V

DR

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Brain

X Data

a b

Rel

ativ

e V

DR

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5


0

Ileum

X Data

a b

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0


Liver

0

Re

lativ

e V

DR

mR

NA

Exp

ress

ion

Re

lativ

e V

DR

Pro

tein

Exp

ress

ion

Ileum

Liver

Kidney

Brain

fxr(+/+) fxr(-/-)

0 2.5 0 2.5

1,25(OH)2D3 (μg/kg)

Figure 4-2 Effects of 1,25(OH)2D3 on VDR (A) mRNA and (B) protein expression in ileum, liver, kidney, and brain. The VDR protein band was shown at 50 kDa. The “*” denotes P < 0.05 compared to vehicle control using the two-tailed Student’s t test. Fifty µg of crude nuclear protein was loaded in each lane. Western blot bands of ileum, liver, kidney, and brain (from left to right): lane 1, vehicle control of fxr(+/+) mouse; lane 2, 2.5 µg/kg 1,25(OH)2D3 treated fxr(+/+) mouse; lane 3, vehicle control of fxr(-/-) mouse; lane 4, 2.5 µg/kg 1,25(OH)2D3 treated fxr(-/-) mouse.

(A) (B)

101

X Data

a b

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Ileum

fxr (+/+) fxr (-/-)

Re

lativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Liver

X Data

a bRe

lativ

e M

dr1

a m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Liver

fxr (+/+) fxr (-/-)

Rel

ativ

e M

dr1

a m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

*

*†

Brain

fxr (+/+) fxr (-/-)

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

8.0


*

*Kidney

0

X Data

a bRel

ativ

e M

dr1a

mR

NA

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

8.0


*

*

0

Kidney

X Data

a bRe

lativ

e M

dr1

a m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Ileum

Ileum

Liver

Kidney

Brain

fxr(+/+) fxr(-/-)

0 2.5 0 2.5

1,25(OH)2D3 (μg/kg)

fxr (+/+) fxr (-/-)

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0Vehicle control1,25(OH)2D3

0

**

Brain

Rel

ativ

e M

dr1

mR

NA

Exp

ress

ion

Re

lativ

e P

-gp

Pro

tein

Exp

ress

ion

X Data

a b

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Ileum

fxr (+/+) fxr (-/-)

Re

lativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Liver

X Data

a bRe

lativ

e M

dr1

a m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Liver

fxr (+/+) fxr (-/-)

Rel

ativ

e M

dr1

a m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

*

*†

Brain

fxr (+/+) fxr (-/-)

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

8.0


*

*Kidney

0

X Data

a bRel

ativ

e M

dr1a

mR

NA

Exp

ress

ion

0.0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

8.0


*

*

0

Kidney

X Data

a bRe

lativ

e M

dr1

a m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Ileum

Ileum

Liver

Kidney

Brain

fxr(+/+) fxr(-/-)

0 2.5 0 2.5

1,25(OH)2D3 (μg/kg)

fxr (+/+) fxr (-/-)

Rel

ativ

e P

-gp

Pro

tein

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0

2.5


0

**

Brain

Rel

ativ

e M

dr1

mR

NA

Exp

ress

ion

Re

lativ

e P

-gp

Pro

tein

Exp

ress

ion

Figure 4-3 Effects of 1,25(OH)2D3 on Mdr1 (A) mRNA and (B) P-gp protein in brain, kidney, liver, and ileum. P-gp protein band was shown at 170 kDa. “*” indicates P < 0.05 compared to vehicle control, whereas “†” indicates P < 0.05 compared to the level of vehicle-control of fxr(+/+) mice using the two-tailed Student’s t test. Twenty µg of crude membrane protein for ileum, liver, and kidney was loaded in each lane; 80 µg of crude membrane protein was used for brain P-gp. Western blot bands of ileum, liver, kidney, and brain (from left to right): lane 1, vehicle control of fxr(+/+) mouse; lane 2, 2.5 µg/kg 1,25(OH)2D3 treated fxr(+/+) mouse; lane 3, vehicle control of fxr(-/-) mouse; lane 4, 2.5 µg/kg 1,25(OH)2D3 treated fxr(-/-) mouse.

(A) (B)

102

4.4.2 Effects of 1,25(OH)2D3 Treatment on the Pharmacokinetics of [3H]Digoxin in

fxr(+/+) Mice

4.4.2.1 Blood decay profiles and excretion of [3H]digoxin after intravenous

administration in fxr(+/+) mice

Fig. 4-4 shows the blood concentration-time profiles and cumulative amounts

recovered in urine and fecal matter vs. time after a single intravenous dose (0.1 mg/kg) of

[3H]digoxin. A biexponential decay of [3H]digoxin was noted in the blood concentration

(normalized to dose) vs. time profile (Fig. 4-4A). The concentration of [3H]digoxin was

significantly lower in the 1,25(OH)2D3-treated group only at 360 min (6 h). The individual

data points were averaged, and the mean blood values were used to calculate the area under

the curve AUC(0∞) by the trapezoidal rule and extrapolation of the last concentration over

the terminal half life () (Table 4-2). This AUC(0→∞) value for digoxin in 1,25(OH)2D3-

treatment mice was only 76% that of control mice. The apparent total body and renal

clearances were increased by 34% and 74%, respectively, and the terminal half life,

decreased by 30% in the mice treated with 1,25(OH)2D3 (Table 4-2). The Vdarea (CLtotal/)

for both the control and treatment group remained relatively unchanged.

The cumulative amounts of [3H]digoxin excreted in urine at 600 min and feces were

comparable (Fig. 4-4B and 4-4C). Amounts in urine in 1,25(OH)2D3-treated mice were

higher than those in control mice at almost every sampling time subsequent to 30 min (P

<.05), except at 360 min (Fig. 4-4B), and were significantly higher (42.6 ± 9.5 vs. 27.0 ±

5.6 %dose) at 600 min. The cumulative fecal amounts of [3H]digoxin in the 1,25(OH)2D3-

treated group were increased only slightly compared to those of control mice (Fig. 4-4C).

The apparent renal (Fig. 4-5A) clearance, estimated as the slope upon plotting the

103

cumulative amount of [3H]digoxin excreted into urine vs. blood AUC of 1,25(OH)2D3-

treated mice (0.074 ml/min) was 74% higher than that of the control mice (0.0426 ml/min).

Our control values were slightly lower than those estimated by others for renal clearance

(0.069 ml/min) (Kawahara et al., 1999) and total clearance (0.083 ml/min) of digoxin

(Griffiths et al., 1984). The filtration clearance, calculated as fPGFR [where fp is 0.78

(Davies and Morris, 1993; Kawahara et al., 1999)] was 0.22 ml/min, a value much higher

in relation to the observed renal clearance (0.0426 ml/min), suggesting that reabsorption

played a significant role in the net renal clearance of digoxin in mice.

The fecal (sum of net intestinal and biliary) clearance (0.0969 ml/min), estimated as

the slope upon plotting the cumulative amount of [3H]digoxin recovered from feces vs. the

blood AUC, was higher than the renal clearance of digoxin (Table 4-2). 1,25(OH)2D3-

treatment increased the fecal clearance by 30% over the control group (0.0742 ml/min) (Fig.

4-5B). Reabsorption of the biliary and intestinal excreted digoxin by the intestine

(enterohepatic recirculation) must have occurred. This possibility was commented on by

Kawahara et al. (1999), and this could have affected the estimate of the fecal secretary

clearances, which deviated from the slopes in Fig. 4-5B.

104

Time (min)

0 100 200 300 400 500 600

Ccu

mul

ativ

e A

mou

nt o

f [3

H]D

igox

in

in U

rine

(% d

ose)

0

10

20

30

40

50

60Vehicle control1,25(OH)2D3

*

*

**

Time (min)

0 100 200 300 400 500 600

Blo

od C

once

ntra

tion

of [

3H

]Dig

oxin

(%

dos

e /

ml)

0.1

0.2

0.5

1.0

2.0

5.0


*

Time (min)

0 100 200 300 400 500 600

Cum

ulat

ive

Am

ount

of

[3H

]Dig

oxin

in

Fec

es (

% d

ose)

0

10

20

30

40

50


*

*

Time (min)

0 100 200 300 400 500 600

Ccu

mul

ativ

e A

mou

nt o

f [3

H]D

igox

in

in U

rine

(% d

ose)

0

10

20

30

40

50


*

*

**

Time (min)

0 100 200 300 400 500 600

Blo

od C

once

ntra

tion

of [

3H

]Dig

oxin

(%

dos

e /

ml)

0.1

0.2

0.5

1.0

2.0

5.0


*

Time (min)

0 100 200 300 400 500 600

Cum

ulat

ive

Am

ount

of

[3H

]Dig

oxin

in

Fec

es (

% d

ose)

0

10

20

30

40

50


*

*

Blood AUC (% dose / ml * min)

0 100 200 300 400 500 600 700

Cum

ulat

ive

Am

ount

of

[3 H]D

igox

in

in U

rine

(% d

ose)

0

10

20

30

40

50

60Vehicle control1,25(OH)2D3 y = 0.0740x

R2 = 0.9338

y = 0.0426xR2 = 0.921


0 100 200 300 400 500 600 700

Cum

ulat

ive

Am

ount

of [

3 H]D

igox

in

in F

eces

(%

dos

e)

0

10

20

30

40

50


y = 0.0969xR2 = 0.4724

y = 0.0742xR2 = 0.6512


0 100 200 300 400 500 600 700

Cum

ulat

ive

Am

ount

of [

3 H]D

igox

in

in U

rine

(% d

ose)

0

10

20

30

40

50

60Vehicle control1,25(OH)2D3 y = 0.0740x

R2 = 0.9338

y = 0.0426xR2 = 0.921


0 100 200 300 400 500 600 700

Cum

ulat

ive

Am

ount

of [

3 H]D

igox

in

in F

eces

(%

dos

e)

0

10

20

30

40

50


y = 0.0969xR2 = 0.4724

y = 0.0742xR2 = 0.6512

Figure 4-4 Plots of [3H]digoxin (A) blood concentration, and cumulative amounts in (B) urine and (C) feces vs. time. The “*” indicates P < 0.05 compared to vehicle control using the two-tailed Student’s t test. The solid and dashed lines represent the fitted lines for control and the 1,25(OH)2D3 treated groups, respectively, upon force-fitting of the data to the PBPK model.

Figure 4-5 Plot of the amount [3H]digoxin excreted to (A) urine and (B) feces vs. the blood AUC(0→t). The slope represents the apparent renal (A) and biliary (B) clearances. The solid line represents control group whereas the dashed line represents 1,25(OH)2D3 treated group.

(A) (B)

(A) (B) (C)

105

Table 4-2 Noncompartmental estimates of digoxin parameters in tissue and blood of vehicle- and 1,25(OH)2D3-treated wild-type mice

Vehicle control 1,25(OH)2D3 Treated/Control

Blood AUC(0→∞) (% dose·min/ml) a 871 661 0.76

Apparent total body clearance, CLtotal (ml/min) b 0.105 0.140 1.34

Filtration clearance, fPGFR (ml/min) c 0.218 0.218 1.00

Apparent renal clearance, CLR (ml/min) d 0.0426 0.0740 1.74

Apparent fecal (biliary) clearance, CLfeces (ml/min) e 0.0742 0.0969 1.30

t1/2β (h) f 7.63 5.32 0.70

Volume of distribution Vdarea (ml) g 69.0 64.3 0.93

Small intestine AUC(0→600 min) (% dose·min/g) h 3733 3091 0.83

Liver AUC(0→600 min) (% dose·min/g) h 1508 1507 1.00

Kidney AUC(0→600 min) (% dose·min/g) h 708 677 0.96

Brain AUC(0→600 min) (% dose·min/g) h 68.5 48.9 0.71

Heart AUC(0→600 min) (% dose·min/g) h 785 712 0.91 a all data points were averaged to provide the mean, and the value was used for calculation; the blood AUC(0→∞) was estimated by addition of AUC(0→600 min) to

AUCextrapolated to infinity or (C(600 min)/ ), where is the terminal decay constant b calculated as dose/AUC(0→∞) c average of literatures values for fp (0.78) and GFR (0.28 ml/min) from (Davies and Morris, 1993; Kawahara et al., 1999) d renal clearance, slope in Fig. 4-5A e fecal clearance, slope in Fig. 4-5B f 0.693/β whereby was obtained upon regression of the three last data points of the averaged blood concentration g calculated as CLtotal/ h all data points were averaged to provide the mean, and the value was used for calculation; tissue AUC(0→600 min) was calculated by the trapezoidal rule

106

4.4.3 Tissue Distribution

4.4.3.1 Estimation of area under the curves (AUCs)

The amounts of [3H]digoxin, normalized to per gram (g) tissue in the small intestine,

liver, kidney, brain, and heart tissues were plotted against time (Fig. 4-6). Levels of digoxin

in the small intestine, liver, kidney and heart were generally similar, except for the brain. In

both control and treated groups, [3H]digoxin levels in the small intestine, liver, kidney, and

heart displayed instantaneous accumulation within the first few minutes, followed by a

rapid decay by 10 min, then gradually decayed thereafter (Figs. 4-6A, 4-6B, 4-6C, and 4-

6E). However, the peaks occurred slightly later (~ 100 min) in the brain. In brain, levels of

[3H]digoxin in the treatment group were markedly lower than those of controls (Fig. 4-6D).

When the areas under the curve (AUCs) in the small intestine, liver, kidney, brain, heart,

and blood, derived from observations on the amounts per g of tissue, were estimated by the

trapezoidal rule (Table 4-2), an apparently lower AUC(0-600 min) (23%) was found for the

brain in the treatment group. The AUC(0-600 min)s for the small intestine, liver, kidney, and

heart remained relatively unchanged for both groups (Table 4-2).

4.4.3.2 Tissue to blood AUC vs. time profile

The tissue partitioning coefficient of digoxin was estimated as the ratio of AUC(0→t)

of tissue normalized to that of blood AUC(0→t) (Fig. 4-7). In control mice, digoxin

tissue/blood AUC ratios of 6.0, 2.5, 1.12, and 1.3 were reached at 600 min for the small

intestine, liver, kidney, and heart, respectively (Figs. 4-7A, 4-7B, 4-7C, and 4-7E), and

treatment with 1,25(OH)2D3 exerted only minimal effects on the tissue/blood AUC ratio. In

the brain, a gradual rise in AUC ratio over time was observed for both treatment and

107

control groups (Fig. 4-7D). The ratio was consistently lower than unity in the brain, and

was reduced with 1,25(OH)2D3-treatment. A plateau level was not reached for the brain to

blood AUC ratio at 600 min (Fig. 4-7D).

4.4.4 Whole Body PBPK Modeling

For both types of fits, the blood, urine, feces, small intestine, liver, kidney, brain,

and heart data were fit to the whole PBPK model (Fig. 4-1) with literature values of tissue

volumes and blood flows (Table 4-3) and the observed tissue partition coefficients (KTBs)

(from Fig. 4-7). For the first of the sequential fits, fQ, KTB,other, BrinCL , ka, and FR were 0.185

± 0.082, 2.50 ± 0.17, 0.00303 ± 0.000491 ml/min, 0.00293 ± 0.00076 min-1, and 0.830 ±

1.39, respectively, for the vehicle control group, and these values were assigned to estimate

the apparent intrinsic clearances for the 1,25(OH)2D3 treatment group. The composite fits

revealed a higher [3H]digoxin elimination from blood due to an increased apparent renal

intrinsic clearance fKCLint,sec,K (from 0.0323 ± 2.12 to 0.188 ± 0.027 ml/min) and a greater

efflux from brain tissue, BrBr eff CL (from 0.00228 ± 0.00482 to 0.00329 ± 0.00409 ml/min)

for the 1,25(OH)2D3-treatment group (Table 4-4). The apparent renal secretory intrinsic

clearance (fKCLint,sec,K) after 1,25(OH)2D3-treatment was 3.65-fold that of control, a value

that correlated well to the level of P-gp induction [2.65-fold for fxr(+/+) mice] and less so

to the change in apparent renal clearance (1.74-fold) (Fig. 4-5A) due to the presence of

filtration and the high degree of reabsorption of digoxin. The parameter estimated for

intestinal (fICLint,sec,I) and hepatic (fHCLint,sec,H) secretions via P-gp were similar between

the control and treatment groups (0.0227 ± 0.0085 vs. 0.0225 ± 0.0050 ml/min for the

intestine and 0.0157 ± 0.00125 vs. 0.0152 ± 0.0086 ml/min for the liver; Table 4-4). These

108

estimates, even when summed (0.0384 to 0.0377 ml/min), were low in comparison to the

fecal clearances (0.074 and 0.097 ml/min) estimated from the slopes of Fig. 4-5B,

suggesting that the unbound fractions fI and fH must be very low. The estimates suggest that

P-gp activities for both intestinal and biliary excretion were relatively constant (Table 4-4).

Moreover, the fitted results showed that the weighting of 1/observation2 yielded the highest

model selection criterion (MSC) (Table 4-4), and lowest coefficient of variation (standard

deviation/parameter value).

Estimates from the simultaneous (force) fit were generally similar to those obtained

from the sequential fits (Table 4-4). The common parameters, fQ, KTB,other, BrinCL , ka, and

FR, were estimated to be 0.158 ± 0.347, 2.42 ± 0.82, 0.000301 ± 0.000389 ml/min, 0.00216

± 0.00162 min-1, and 0.858 ± 2.53, respectively (Table 4-4). Increased apparent renal

intrinsic clearance fKCLint,sec,K (from 0.074 ± 5.34 to 0.255 ± 0.029 ml/min) and greater

efflux from the brain tissue, BrBr eff CL (from 0.00230 ± 0.00422 to 0.00337 ± 0.00363

ml/min) were observed for the 1,25(OH)2D3-treatment group (Table 4-4). The apparent

renal secretory intrinsic clearance (fKCLint,sec,K) after 1,25(OH)2D3-treatment was 3.45-fold

that of control, a value that correlated well to the level of P-gp induction (2.65-fold; Table

4-5) but less so to the change in renal clearance (1.74-fold) (Fig. 4-5A). These changes

were not exact matches due to the presence of filtration and a high degree of reabsorption

of digoxin. Simulations performed using the FR as 0.857 and fQ as 0.158 and parameters

obtained with the simultaneous fit showed that the blood and kidney and brain

concentrations were generally insensitive to a doubling in fKCLint,sec,K (varied from 0.074

ml/min to ½, 2, 3, and 5x) (Fig. 4-8). In contrast, for drugs whose FR approaches 0,

109

changes in fKCLint,sec,K would significantly affect tissue levels and renal excretion

(simulation not shown). The ratio for brain efflux was 1.47x higher for the 1,25(OH)2D3-

treatment group, a value similar to that for Western blotting (1.8x, Table 4-5). Values of the

apparent fICLint,sec,I and fHCLint,set,H were of similar magnitude (0.0168 to 0.0189 ml/min;

Table 4-4) and were unchanged with 1,25(OH)2D3 treatment, as also found from Western

blotting (Table 4-5). Again their sum was much less than the apparent fecal clearances

(0.074 and 0.097 ml/min), supporting the view that fI and fH must be very small. Overall,

the fitted results showed that the weighting of 1/observation2 yielded the highest model

selection criterion (MSC) (Table 4-4), and lowest coefficient of variation (standard

deviation/parameter value).

In both types of fits, values of fQ (Table 4-4) were similar (0.185 and 0.158) to those

found for the rat intestinal preparation (Cong et al., 2000; Liu et al., 2006b) that is less than

20% of the total flow, favoring the concept of segregated flow to the enterocyte (Cong et al.,

2000). Though the fitted fKCLint,sec,K for the force fit was almost twice that for the

sequential fits, the change due to 1,25(OH)2D3, denoted as the ratio of the apparent

intrinsic clearances, was similar (Table 4-4). In comparison, the force fit yielded higher

coefficient of variations but a higher MSC (3.58), showing that this strategy was superior

over that of the sequential fits. Moreover, when the traditional PBPK intestine model (Cong

et al., 2000) was used, a slightly inferior fit with higher coefficients of variation, lower

MSC, and higher sum of squared residuals were observed (data not shown).

110

Time (min)

0 100 200 300 400 500 600

Am

oun

t of [

3 H]

Dig

oxin

in B

rain

(%

dose

/ g

of ti

ssu

e)

0.01

0.02

0.04

0.06

0.09

0.12

0.16


**

Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3 H]

Dig

oxin

in K

idne

y (%

dose

/ g

of t

issu

e)

0.1

0.2

0.5

1

2

5

10


Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3 H]

Dig

oxin

in L

iver

(%

dose

/ g

of

tissu

e)

0.1

0.5

1

2

5

1015


Time (min)

0 100 200 300 400 500 600Am

ount

of

[3 H] D

igox

in in

Sm

all I

ntes

tine

(%do

se /

g o

f tis

sue)

1

2

5

10

20


*

Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3H

] D

igox

in in

Hea

rt

(%do

se /

g of

tis

sue)

0.1

0.5

1

2

5

1015

Vechile control1,25(OH)2D3

Time (min)

0 100 200 300 400 500 600

Am

ount

of [

3 H]

Dig

oxin

in B

rain

(%

dose

/ g

of ti

ssue

)

0.01

0.02

0.04

0.06

0.09

0.12

0.16


**

Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3 H]

Dig

oxin

in K

idne

y (%

dose

/ g

of t

issu

e)

0.1

0.2

0.5

1

2

5

10


Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3 H]

Dig

oxin

in L

iver

(%

dose

/ g

of

tissu

e)

0.1

0.5

1

2

5

1015


Time (min)

0 100 200 300 400 500 600Am

ount

of

[3 H] D

igox

in in

Sm

all I

ntes

tine

(%do

se /

g o

f tis

sue)

1

2

5

10

20


*

Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3H

] D

igox

in in

Hea

rt

(%do

se /

g of

tis

sue)

0.1

0.5

1

2

5

1015

Vechile control1,25(OH)2D3

Figure 4-6 Plots of amount [3H]digoxin in (A) small intestine, (B) liver, (C) kidney, (D) brain, and (E) heart. The solid and dashed lines represent the fitted lines for the control and the 1,25(OH)2D3 treated groups, respectively, upon force-fitting of the data to the PBPK model.

(A) (B) (C)

(D) (E)

111

Time (min)

0 100 200 300 400 500 600

Sm

all I

ntes

tine

/ B

lood

AU

C r

atio

0.0

2.0

4.0

6.0

8.0


0

Time (min)

0 100 200 300 400 500 600

Live

r /

Blo

od A

UC

rat

io

0.0

0.5

1.0

1.5

2.0

2.5

3.0


0

Time (min)

0 100 200 300 400 500 600

Kid

ney

/ Blo

od A

UC

rat

io

0.0

0.5

1.0

1.5


0

Time (min)

0 100 200 300 400 500 600

Bra

in /

Blo

od A

UC

rat

io

0.00

0.05

0.10

0.15


0

Time (min)

0 100 200 300 400 500 600

Hea

rt /

Blo

od A

UC

rat

io

0.0

0.4

0.8

1.2

1.6


0

Figure 4-7 Tissue to blood AUC ratio of [3H]digoxin over time profile for the (A) small intestine, (B) liver, (C) kidney, (D) brain and (E) heart. For each data point, the average value of tissue AUC of vehicle or treatment group is normalized to the average value of blood AUC of the same group. The ratios are plotted against time. The tissue to blood partition coefficients of the small intestine, liver, kidney, and heart was estimated at the plateau phases of the plot.

(A) (B) (C)

(D) (E)

112

Time (min)

0 100 200 300 400 500 600

Am

ount

of [

3H

] D

igox

in in

Kid

ney

(%do

se /

g o

f tis

sue)

0.1

0.5

1

2

5

10FR = 0.858

5X3X2X1X

1/2X0

fKCLint,sec,K (0.074 ml / min)

Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3H

] D

igox

in in

Bra

in

(%do

se /

g o

f tis

sue)

0.01

0.02

0.04

0.06

0.08

0.10.120.140.16 FR = 0.858

5X3X2X1X

1/2X0


Time (min)

0 100 200 300 400 500 600C

cum

ulat

ive

Am

ount

of [

3 H]D

igox

in

in U

rine

(%

dos

e)0

10

20

30

40

50FR = 0.858

5X3X2X1X

1/2X0


Time (min)

0 100 200 300 400 500 600

Blo

od

Co

ncen

tra

tion

of

[3H

]Dig

oxin

(%

dos

e /

ml)

0.1

0.05

0.1

0.2

0.5

1

2

5

10

5X3X2X1X

1/2X0

FR = 0.858 fKCLint,sec,K (0.074 ml / min)

Time (min)

0 100 200 300 400 500 600

Am

ount

of [

3H

] D

igox

in in

Kid

ney

(%do

se /

g o

f tis

sue)

0.1

0.5

1

2

5

10FR = 0.858

5X3X2X1X

1/2X0


Time (min)

0 100 200 300 400 500 600

Am

ount

of

[3H

] D

igox

in in

Bra

in

(%do

se /

g o

f tis

sue)

0.01

0.02

0.04

0.06

0.08

0.10.120.140.16 FR = 0.858

5X3X2X1X

1/2X0


Time (min)

0 100 200 300 400 500 600C

cum

ula

tive

Am

ount

of

[3 H]D

igox

in

in U

rine

(% d

ose

)0

10

20

30

40

50FR = 0.858

5X3X2X1X

1/2X0


Time (min)

0 100 200 300 400 500 600

Blo

od

Co

ncen

tra

tion

of

[3H

]Dig

oxin

(%

dos

e /

ml)

0.1

0.05

0.1

0.2

0.5

1

2

5

10

5X3X2X1X

1/2X0

FR = 0.858 fKCLint,sec,K (0.074 ml / min)

Figure 4-8 Simulation of [3H]digoxin concentrations vs. time for (A) blood, (B) kidney and (C) brain, and amounts vs. time in urine (D). The solid circles represent the observed, average [3H]digoxin blood, kidney, brain and urine data from the fxr(+/+) vehicle control mouse. The solid line represents the predictions according to force-fitting of data from both the control and 1,25(OH)2D3-treated mice. The dotted lines represented simulations using fxr(+/+) vehicle control parameters from Table 3 and 4 with varying values of CL′int,sec,K, from 0 to multiples (shown as numbers) of 0.074 ml/min (control mice). Note the relative insensitivity of the (A) blood, (B) kidney and (C) brain, and amounts vs. time in urine (D) even when CL′int,sec,K was doubled.

(A) (B)

(C) (D)

113

Table 4-3 Assigned parameters for PBPK modeling of [3H]digoxin in fxr(+/+) mice which

were treated i.p. with vehicle (0) or 2.5 μg/kg of 1,25(OH)2D3 every other day for 8 days

Assigned Parameters Values

Qbrian (ml/min) a 0.089 QK (ml/min) a 1.3

QHA (ml/min) a 0.35

Qheart (ml/min) a 0.28

QPV (ml/min) a 1.5

Qother (ml/min) a 4.48

GFR (ml/min) a 0.28

VB (ml) a 1.7

Vheart (ml) a 0.095

VBr, B (ml) a 0.025

VBr(ml) a 0.226

VK (ml) a 0.34

VL (ml) a 1.3

VI (ml) a 1.5

Vother (ml) a 13.0

B/P a 0.898

fP a 0.78

fB = fP /(B/P) 0.87

KTB,K b 1.12

KTB,L b 2.5

KTB,I b 6.0

KTB,heart b 1.3

a average of literature values from Davies and Morris (1993) and Kawahara et al. (1999) b observed value from Fig. 4-7

114

Table 4-4 Fitted parameters (±SD) for [3H]digoxin in fxr(+/+) mice treated i.p. with vehicle (0) or 2.5 μg/kg of 1,25(OH)2D3 every other

day for 8 days based on the PBPK model shown in Fig. 4-1

Sequential Fits Force Fit of Control and 1,25(OH)2D3 Data Fitted

Parameters Vehicle Control 1,25(OH)2D3 Ratio Vehicle Control 1,25(OH)2D3 Ratio

fQ 0.185 ± 0.082 Same as control 0.158 ± 0.347

KTB,other 2.50 ± 0.17 Same as control 1 2.42 ± 0.82 1

ka (min-1) 0.00293 ± 0.00076 Same as control 1 0.00216 ± 0.00162 1

FR 0.830 ± 1.39 Same as control 1 0.858 ± 2.53 1 BrinCL (ml/min) 0.000303 ± 0.000491 Same as control 1 0.000301 ± 0.000389 1

BrBr eff CL (ml/min) 0.00228 ± 0.00482 0.00329 ± 0.00409 1.44 0.00230 ± 0.00422 0.00337 ± 0.00363 1.47

CL′int,sec,K or fKCLint,sec,K (ml/min) 0.0323± 2.12 0.188 ± 0.027 3.65 0.074 ± 5.34 0.255 ± 0.029 3.45

CL′int,sec,I or fICLint,sec,I (ml/min) 0.0227 ± 0.0085 0.0225 ± 0.0050 0.991 0.0175 ± 0.0377 0.0168 ± 0.0380 0.96

CL′int,sec,H or fHCLint,sec,H (ml/min) 0.0157 ± 0.0125 0.0152 ± 0.0086 0.968 0.0189 ± 0.0688 0.0189 ± 0.0621 1.00 Model selection criterion, MSC with weighting of 1/observation2

2.99 3.23 3.58

Residual sum of square 1.68 1.51 226

115

Table 4-5 Correlation between fold-changes in protein expression of P-gp (from Western blotting in Fig. 4-3) and ratio of the

estimated apparent efflux intrinsic clearances of P-gp (from PBPK modeling) between the 1,25(OH)2D3- and vehicle-treated mice

Fold Change in P-gp Protein Expression [1,25(OH)2D3/Vehicle Control]

P-gp Apparent Efflux CLint's in fxr(+/+) Mice

[1,25(OH)2D3/Vehicle Control]

Tissue P-gp

fxr(+/+) fxr(-/-) Ratio

Ileum Efflux 0.84 0.95 0.96

Liver Efflux 1.12 1.17 1

Kidney Efflux 2.65 5.90 3.45

Brain Efflux 1.80 2.45 1.47

116

4.5 DISCUSSION

In this study, we have employed both wild-type fxr(+/+) and knock-out fxr(-/-)

mice to discern whether regulation of Mdr1a/P-gp observed in the rat after 1,25(OH)2D3

dosing was due to the direct actions of the VDR or through indirect actions by the FXR

(Chow et al., 2009; Chow et al., 2010). We appraised whether the VDR played a direct role

in the upregulation of the Mdr1 gene in mice. We found that there are different responses

between rats (Chow et al., 2010) and mice, due to species differences that could be the

result of different regulatory responses from nuclear receptors. First, Asbt induction with

1,25(OH)2D3, though observable in the rat, is deemed nonexistent in the mouse due to the

presence of LRH-1 cis-acting element on the mouse Asbt promoter in the intestine that

exerts a negative feedback on Asbt upon FXR activation (Chen et al., 2003; Chen et al.,

2006). For this reason, FXR effects are less in the mouse than the rat, and both Asbt mRNA

and protein expression and portal bile acid concentrations were unchanged in mice after

1,25(OH)2D3 administration (data not shown). By contrast, low levels of VDR present in

the rat liver (Gascon-Barré et al., 2003; Chow et al., 2009) are unlikely to forge direct links

between transactivation of the Mdr1 gene by the VDR. Rather, FXR effects are suspected

to be operative, especially in rat liver due to the low VDR levels and increased portal bile

acid concentrations (Chow et al., 2009; Chow et al., 2011b). Secondly, protein levels of

VDR in mouse liver are relatively higher than that in rat liver (Chow et al., 2010) in

comparison to the ileum, and, upon activation, VDR could potentially be exerting a greater

direct effect on Mdr1/P-gp expression in mouse liver than the rat. These perceived

differences aptly explain the difference in responses to 1,25(OH)2D3 induced changes in

Mdr1/P-gp expression in mice and rats. There was no induction of ileal Mdr1/P-gp in the

117

present study, and a slight but insignificant increase in Mdr1 mRNA was observed in livers

treated with 1,25(OH)2D3 in fxr(+/+) but not fxr(-/-) mice (Fig. 4-3); therefore, the

involvement of FXR in the regulation of hepatic Mdr1 in rats cannot be ruled out. Our

previous investigation had shown that intraperitoneal administration of 1,25(OH)2D3 to rats

did not elevate P-gp in intestine (Chow et al., 2010), in spite that P-gp was increased in the

liver (Chow et al., 2009). The lack of induction of intestinal Mdr1 in both the mouse and

rat despite the abundance of VDR could be due to low levels of 1,25(OH)2D3 reaching the

intestine, or the amount of 1,25(OH)2D3 needed for activation (Chow et al., 2009).

Of significance is that activation of VDR increased the Mdr1 and P-gp expression in

the kidneys and brains of both the fxr(+/+) and fxr(-/-) mice (Fig. 4-3), and the mechanism

of induction is independent of FXR. The induction of renal Mdr1/P-gp in 1,25(OH)2D3

treated mice led to increases in renal and total body clearances and lowered blood AUC(0→∞)

of digoxin, and these shortened the elimination half life (Table 4-2). The upregulation of P-

gp expression in kidneys is thus expected to exert a significant impact on the disposition of

digoxin, a P-gp substrate that is primarily renally excreted. However, the lower sensitivity

of the renal clearance to changes in efflux P-gp activity appears to be due to the high

fraction of digoxin reabsorbed (Fig. 4-8; Table 4-5). For other renally excreted compound

that are less reabsorbed, P-gp induction is expect to play a larger role in increasing the renal

clearance. Increased in brain P-gp levels by 1,25(OH)2D3 also led to lower accumulation in

the brain (Fig. 4-6D; Table 4-2) and lower brain/blood partitioning (Fig. 4-7D) of digoxin,

despite that VDR mRNA and protein expression in the murine brain was low. There was a

clear decrease in the brain/blood AUC ratio of the 1,25(OH)2D3-treated group vs. the

118

control group between 60 to 600 min, and the decrease in ratio was the greatest at 600 min

(29% decrease).

The induction by 1,25(OH)2D3 on the upregulation of the Mdr1 gene via the VDR is

explained using PBPK modeling, which predicts the changes in digoxin disposition in

various tissues as a result of increased P-gp activity in kidney and brain following

1,25(OH)2D3 treatment of mice. The PBPK model accurately predicted the data pertaining

to digoxin disposition in blood, urine, feces, brain, liver, kidney, heart, and small intestine

(Figs. 4-4 and 4-6) and provided an accurate description of the insignificant P-gp activity in

the intestine and the less than expected effect on renal secretion due to high extent of

digoxin reabsorption by the kidney (Fig. 4-8; Tables 4-4 and 4-5). By contrast, the renal

clearances of digoxin in humans (125 ml/min) and rats (1.25 ml/min) (Harrison and Gibaldi,

1977b; Harrison and Gibaldi, 1977a) were slightly larger than, or comparable to, their

corresponding filtration clearances [90 ml/min in humans and 0.80 ml/min in rats estimated

from the literature (Steiness, 1974; Evans et al., 1990; Davies and Morris, 1993)],

suggesting that secretion in these species plays a major role in renal excretion. These

observations point to species differences in renal excretion, and that higher reabsorption of

digoxin occurs in murine than human kidneys.

This study demonstrates that 1,25(OH)2D3 treatment increased P-gp levels in both

the brain and kidney of mice. This observation leads one to consider whether treatment

with 1,25(OH)2D3 or the vitamin D analogs and a P-gp substrate drug would lead to

increased renal clearance of the drug. The upregulation of brain MDR1/P-gp by

1,25(OH)2D3 would have a significant impact on drug disposition, cell homeostasis, and

altered pharmacological and toxicological outcomes. Indeed, high doses of 1,25(OH)2D3

119

and vitamin D analogs have been used as a therapeutic class of drugs for treatment of

hyperparathyroidism, kidney diseases, and cancer (Masuda and Jones, 2006). These

treatments may change the expressions of transporters and enzyme and thus alter drug

disposition (Chow et al., 2009; Chow et al., 2010; Chow et al., 2011b). Drug-Drug

interactions (DDIs) involving P-gp in brain may be beneficial or detrimental. For example,

vitamin D analogs given concomitantly with P-gp substrates targeting the brain will

increase drug efflux from the tissue, rendering the drug ineffective. When 1,25(OH)2D3 is

used in combination with anticancer agents such as paclitaxel, a known P-gp substrate, to

treat cancer (Masuda and Jones, 2006), lower therapeutic effects may result in the brain. P-

gp substrates targeting the brain include the antiretrovirals, such as atazanavir, ritonavir,

and saquinavir for HIV treatment, antipsychotics such as risperidone (Kim, 2002a; Zastre et

al., 2009), antiepileptic drugs such as topiramate (Luna-Tortos et al., 2009), or CNS drugs

like morphine (Groenendaal et al., 2007), are all likely to be affected. In contrast, increased

P-gp activity may decrease brain concentrations of drugs such as oseltamivir (Tamiflu), a

drug used for influenza treatment, which is a P-gp substrate (Morimoto et al., 2008).

Upregulation of P-gp may decrease brain concentrations of oseltamivir in this case.

In summary, the VDR can upregulate P-gp expression in kidney and brain of mice

independently of FXR. Unequivocally, the induction of Mdr1/P-gp in rats and mice by the

VDR has been translated to observations in human cell lines, and the intestinal P-gp may be

further involved in DDIs. VDR activation of MDR1 mRNA and P-gp had been observed in

human colonic cell lines (Aiba et al., 2005; Fan et al., 2009; Tachibana et al., 2009), a

notion consistent with the existence of VDREs in MDR1 (Saeki et al., 2008). As a result, it

120

is highly likely that 1,25(OH)2D3 treatment in combination with some other drugs would

cause significant DDIs.

4.6 APPENDIX

In the equations below, B/P is the blood to plasma partition coefficient; V is the

volume of the tissue; C is the concentration; Alumen and Aurine are the amounts of

[3H]digoxin excreted in feces and urine compartment, respectively; Q is the blood flow rate;

QHA and QPV are the blood flow rate of hepatic artery and portal blood; QHV is the sum of

QHA and QPV; KTB is the tissue to blood ratio, assessed as the AUC tissue/blood ratio; fB,

fP, fBr, fK, fL, and fI, are the unbound fractions in blood, plasma, brain, kidney, liver, and

intestine, respectively; fQ is the proportion of intestinal blood flow perfusing the enterocyte

region in the small intestine (Liu et al., 2006b); BrinCL and Br

efCL are the intrinsic influx and

efflux in the brain; ka is the absorption rate constant of the intestine; GFR is the glomerular

filtration rate; FR is the fraction reabsorbed in the kidney. The mass balance equations are

listed below.

In the blood (B) compartment:

B K L other heartB Br Br,B K HV other heart Br K HV other heart B

TB,K TB,L TB,other TB,heart

dC C C C CV = Q C +Q +Q +Q +Q - (Q +Q +Q +Q +Q )C

dt K K K K

In the brain tissue (Br) compartment:

Br BrBrBr B Br,B in Br Br ef

dCV = f C CL -f C CL

dt

In the brain blood compartment:

Br,B Br BrBr,B Br B Br,B B in Br,B Br ef Br

dCV = Q (C - C ) - f CL C + f CL C

dt

(A1)

(A2)

(A3)

121

In the heart compartment:

heart heartheart heart B

TB,heart

dC CV = Q (C - )

dt K

In other tissue compartments:

other otherother other B

TB,other

dC CV = Q (C - )

dt K

In the kidney compartment:

K K P BK K B K K int,sec,K

TB,K

dC C f GFRCV = Q (C - ) - + f C CL 1 FR

dt K (B/P)

In the above equation, the arterial unbound plasma concentration equals fPCB/(B/P). The

filtered and excreted components are reabsorbed according to the fraction reabsorbed, FR.

In the liver compartment, with segregated flows returning from the intestine:

L en s LL HA B PV Q Q HV L L int,sec,L

TB,I TB,I TB,L

dC C C CV = Q C + Q [f +(1-f ) ] - Q - f C CL

dt K K K

where QHV is the sum of QHA and QPV.

In the intestinal compartments of the small intestine:

Enterocyte region:

en enQ I Q PV B I en int,sec,I a lumen

TB,I

dC Cf V = f Q (C - ) - f C CL + k A

dt K

Serosal region:

s sQ I Q PV B

TB,I

dC C(1-f )V = (1- f )Q (C - )

dt K

In the fecal compartment:

lumenI en int,sec,I L L int,sec,H a lumen

dA = f C CL + f C CL - k A

dt

(A4)

(A5)

(A6)

(A7)

(A8)

(A9)

(A10)

122

4.7 ACKNOWLEDGMENTS

This work was supported by the Canadian Institutes for Health Research CIHR,

Grant [Grant MOP89850]. Edwin C.Y. Chow was supported by the University of Toronto

Open Fellowship and the National Sciences and Engineering Research Council of Canada

Alexander Graham Bell Canada Graduate Scholarship (NSERC-CGS), and Matthew R.

Durk was supported by the Canadian Institutes of Health Research (CIHR) Strategic

Training Grant in Biological Therapeutics.


In this chapter, regulation of P-gp by either VDR or FXR was discriminated by the

use of the fxr(-/-) mouse model. The study shows that the induction of P-gp in kidney and

brain is independent of the presence of FXR, and the event was triggered by VDR

activation in those tissues. The increase in P-gp levels in the mouse kidney and brain

resulted in pharmacokinetic changes of digoxin, a P-gp substrate, in vivo. The change in P-

gp in the rat liver (Chapter 3) was, however, likely due to FXR. The change in plasma,

urine, feces and tissue concentrations in 1,25(OH)2D3-treated mice was interpreted using a

physiologically-based pharmacokinetic (PBPK) model showing that the intrinsic efflux

clearances in the kidney and brain were increased corresponding to VDR protein changes.

This study suggests that VDR activation can cause significant DDIs when vitamin D

analogs are taken in combination with other drugs.

In this study, I was involved in the treatment of 1,25(OH)2D3 to mice, the

determination of [3H]digoxin, and tissue harvesting, performed mRNA and protein

extractions, analyzed mRNA and protein expressions in the intestine, liver, and kidney,

123

tissue extraction of digoxin and its analyses. I was responsible for the PBPK modeling and

the design of the differential equations and data fitting. Matthew Durk examined mRNA

and protein expressions in the brain; he assisted in tissue harvesting and the tissue

extraction of digoxin. Dr. Cummins commented on the experimental design and gave

suggestions to the paper.

124

CHAPTER FIVE

5. INHIBITION OF THE SMALL HETERODIMER PARTNER (SHP) BY 1,25-

DIHYDROXYVITAMIN D3-LIGANDED VITAMIN D RECEPTOR (VDR) REMOVED

THE REPRESSION ON CYTOCHROME 7-HYDROXYLASE (CYP7A1) AND

INDUCED CHOLESTEROL LOWERING

Edwin C.Y. Chow1, Lilia Magomedova1, Rucha Patel1, Matthew R. Durk1, Han-Joo

Maeng1,4, Holly Quach1, Kamdi Irondi1, Sayeepriyadarshini P. Anakk 3, Reinhold Vieth2,

David D. Moore3, Carolyn L. Cummins1, and K. Sandy Pang1

1Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, and

2Department of Nutritional Sciences, University of Toronto, Canada

3Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas, USA 4College of Pharmacy, Inje University, 607 Obang-dong, Gimhae, Gyeongnam 621-749, South Korea

125

5.1 ABSTRACT

CYP7A1, the rate-limiting enzyme in cholesterol metabolism, is repressed by the

FXR-SHP-LRH1 cascade in liver and by intestinal FGF15/FGF19. Treatment with the

VDR ligand, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3; 2.5 µg/kg i.p. q2d for 8 days] to

fxr(-/-) and fxr(+/+) mice on a normal or 3 week Western diet resulted in higher Cyp7a1

mRNA/protein expression and microsomal activity over those of vehicle controls, and these

were accompanied by reduced SHP in liver without changes in intestinal mFGF15 mRNA

expression. The same was observed in mouse primary hepatocytes treated 9 h with 100 nM

1,25(OH)2D3. Significant reduction in plasma and liver cholesterol concentrations occurred

in all mice except for the fxr(+/+) mice on the normal diet. In 1,25(OH)2D3-treated shp(-/-)

mice prefed with the Western diet, changes in Cyp7a1 were absent, and only plasma

cholesterol was slightly reduced. Upon 1,25(OH)2D3 treatment, intestinal FGF15 was

elevated and reduced in fxr(-/-)and shp(-/-) mice, respectively, prefed with Western diet.

The luciferase assay and truncation analysis revealed inhibitory effects of VDR on mSHP

and hSHP promoters, and EMSA showed direct binding of VDR to the hSHP promoter.

The composite results implicate a role of the VDR in cholesterol lowering via inhibition of

SHP, by removing the repressive effect on Cyp7a1; VDR further increases FGF15 directly

but antagonizes intestinal FXR to reduce FGF15, opposing effects that yield a net FGF15

decrease for increasing Cyp7a1 activity with 1,25(OH)2D3 treatment.

5.2 INTRODUCTION

Cholesterol is an important component of cell membrane structure and is a

precursor of various steroids, including corticosteroids, vitamin D, steroid hormones, and

126

bile acids. However, excess cholesterol in blood can lead to atherosclerosis and coronary

and cerebrovascular diseases. The therapeutic agents that are available to treat high

cholesterol levels include the HMG-CoA reductase inhibitors, niacin, hypolipidemic drugs

that act by blocking the breakdown of fat in adipose tissue (Brooks et al., 2010), and

ezetimibe, which inhibits the Niemann-Pick C1-like 1 transporter in the intestinal

absorption of cholesterol (Jia et al., 2010). Cholesteryl ester transfer protein (CETP)

inhibitors that raise the high-density lipoprotein cholesterol (HDL-C) also pose as a new

form of therapy (Masson, 2009). These inhibitors and bile-acid sequestrants reduce

cholesterol synthesis in the liver or the amount of dietary cholesterol that is absorbed in the

intestine. However, many of these drugs have serious side effects (Alsheikh-Ali et al., 2007;

Radcliffe and Campbell, 2008).

The regulation of cholesterol metabolism in the liver is paramount in the

understanding of cholesterol homeostasis. In mammals, excess cholesterol follows a series

of metabolic pathways to form bile acids, whereas a small portion of cholesterol forms

steroid hormones (Boggaram et al., 1984; Rezen et al., 2010). Cytochrome P450 7A1

(CYP7A1) catalyzes the first and rate-limiting enzyme reaction in the classical, neutral

pathway, whereas the alternate pathway is catalyzed by CYP27A1 (Russell and Setchell,

1992; Javitt, 1994). The promoter of the CYP7A1 gene contains a hexameric repeat of

nucleotide sequence (AGGTCA) or the bile acids response element (BARE) that is highly

conserved among species (Chiang, 2003). The pathways are tightly regulated at the

transcriptional level by bile acids (Stravitz et al., 1993; Agellon and Cheema, 1997; Gupta

et al., 2001) and other signaling molecules (Staudinger et al., 2001; Drover and Agellon,

2004; Ma et al., 2011). CYP7A1 is under negative feedback regulation by the farnesoid X

127

receptor (FXR; NR1H4), which can be activated by bile acids such as chenodeoxycholic

acid (CDCA) to increase transcription of the short heterodimer partner (SHP, NR0B2)

(Chiang, 2003). SHP then prevents the binding of other transcriptional factors, liver-related

homologue-1 (LRH-1 or fetoprotein transcription factor, FTF, NR5A2), a competence

factor that binds as a monomer to the response element in the CYP7A1 promoter for its

expression (Chiang and Stroup, 1994; Crestani et al., 1998; Chiang et al., 2000; Goodwin et

al., 2000), and hepatocyte nuclear factor 4α (HNF-4αNR2A1), which is also important for

the upregulation of CYP7A1 (Chiang, 2002; Abrahamsson et al., 2005). In addition

CYP7A1 expression is stimulated by the murine liver X receptor αLXRα,R, an

oxysterol-activated transcriptional factor; SHP also can interact with LXRα by repressing

its transcriptional activity (Brendel et al., 2002; Schoonjans and Auwerx, 2002) in the

modulation of cholesterol absorption, transport and elimination in rodents (Goodwin et al.,

2003). In the intestine, the bile-acid-FXR activation leads to induction of the fibroblast

growth factor (FGF15 in rodents; FGF19 in humans), a hormonal signaling molecule that

represses hepatic CYP7A1 via the hepatic fibroblast growth factor receptor 4 (FGFR4)

which in turn decreases CYP7A1 through activation of the liver c-Jun signaling pathway

(Inagaki et al., 2005).

The VDR (vitamin D receptor, NR1I1) has been examined with respect to its role in

bile acid and cholesterol homeostasis (Thummel et al., 2001; Makishima et al., 2002; Chen

et al., 2006; Chow et al., 2009; Han and Chiang, 2009; Nishida et al., 2009; Han et al., 2010;

Schmidt et al., 2010). Upon metabolism of vitamin D by the liver and kidney sequentially

to form the active hormone ligand, 1α,25-dihydroxyvitamin D3 [1,25(OH)2D3] (Jones et al.,

1998), 1,25(OH)2D3 and various vitamin D analogues are found to bind to the VDR to

128

activate the transcription of VDR target genes (Echchgadda et al., 2004; McCarthy et al.,

2005; Zierold et al., 2006; Fan et al., 2009; Khan et al., 2009b; Chow et al., 2010; Chow et

al., 2011b). However, there appear to be multiple pathways in which the VDR exerts its

influence on the transcription of genes encoding the CYP7A1 pathway (Wagner et al.,

2010). 1,25(OH)2D3-Liganded VDR has been reported to inhibit/antagonize the CDCA-

dependent transactivation of FXR (Honjo et al., 2006), blunt the LXRα-mediated induction

of Cyp7a1 mRNA in rat hepatoma cells (Jiang et al., 2006), and repress the transcriptional

activity of PPAR (Sakuma et al., 2003). Others have proposed inhibitory mechanisms on

CYP7A1 transcription in human hepatocytes and HepG2 cells, attributing these to ligand-

activated VDR blocking HNF-4 activation of CYP7A1 gene (Han and Chiang, 2009; Han

et al., 2010). Schmidt et al. (2010) reported on the inhibition of Cyp7a1 mRNA in mice 4 h

following a single, high dose of 1,25(OH)2D3, attributing the observed induction of FGF15

and SHP to Cyp7a1 mRNA levels without correlating to Cyp7a1 protein or cholesterol

lowering. By contrast, upregulation of Cyp7a1 mRNA was observed with treatment of 1α-

hydroxyvitamin D3, a prodrug of 1,25(OH)2D3 in mice (Nishida et al., 2009; Ogura et al.,

2009), and doxercalciferol was reported to decrease the accumulation of triglycerides and

cholesterol in murine kidney (Wang et al., 2011a). Thus, the role of the VDR in the

regulation of CYP7A1 appears to be unclear.

In this study, we examined the role of the VDR on changes in liver SHP and

intestinal FGF15 in wild-type and fxr(-/-) mice after treatment with 1,25(OH)2D3. After

noting that VDR elevated Cyp7a1 mRNA and protein expression and microsomal function

after 1,25(OH)2D3 treatment that was accompanied by repression of liver SHP, we fed wild-

type, and fxr(-/-) and shp(-/-) mice a high fat/high cholesterol diet followed by 1,25(OH)2D3

129

treatment and examined the molecular mechanism of the role of the VDR on the alteration

of SHP and by examining the binding of VDR to VDREs in SHP by EMSA.

5.3 METHODS

5.3.1 Materials

1,25(OH)2D3 powder was purchased from Sigma-Aldrich Canada (Mississauga, ON,

Canada). Anti-CYP7A1 (N-17) was purchased from Santa Cruz Biotechnology (Santa Cruz,

CA); and anti-GAPDH (6C5), from Abcam, Cambridge, MA. The fxr(-/-) and shp(-/-) mice

were obtained from Dr. F. J. Gonzalez (National Institutes of Health, Bethesda) (Sinal et al.,

2000) and Dr. David D. Moore (Baylor College of Medicine in Texas Medical Center),

respectively, and C57BL/6 mice was the control counterpart. Animals were given water

and food ad libitum and maintained under a 12:12-h light and dark cycle in accordance to

animal protocols approved by the University of Toronto (ON, Canada).

5.3.2 Plasmids

Expression vectors for pCMX, pCMX-hRXRa, pCMX-mLRH, pGEM, pCMX-β-

galactosidase, hSHP(569)-luc, hSHP(371)-luc were kind gifts from Dr. David J.

Mangelsdorf (University of Texas Southwestern Medical Center). The mSHP(2kb)-luc was

a kind gift of Dr. Li Wang (University of Utah). pEF-mVDR was a gift from Dr. Rommel

G. Tirona (University of Western Ontario, Canada). Human SHP promoter deletion

constructs were generated by PCR amplification. The PCR fragments were ligated into the

HindIII and BglII sites of the luciferase reporter pGL3 (Promega) to generate hSHP(238)-

luc and hSHP(138)-luc.

130

5.3.3 1,25(OH)2D3 Treatment of Mice

1,25(OH)2D3 powder were dissolved in anhydrous ethanol, and the concentration

was spectrophotometrically measured at 265 nm (UV-1700, Shimadzu Scientific

Instruments, MD) before dissolving in sterile corn oil. For examination of the effects of

1,25(OH)2D3 in the presence and absence of FXR, male fxr(-/-) and fxr(+/+) mice (8 to 12

weeks; n = 5 - 10) were given intraperitoneal (i.p.) doses of 0 or 2.5 µg/kg 1,25(OH)2D3

dissolved in sterile corn oil (5 μl/g) every other day for 8 days. The alternate day regimen

was chosen due to the lessened hypercalcemia observed in comparison to those given lower

doses in consecutive days (Chow et al., 2011b). On the 9th day, mice were anesthetized with

ketamine and xylazine by i.p. injection. Systemic and portal blood were taken and spun

down at 605 g for 10 min to obtain plasma. Mice were flushed with ice-cold saline from the

vena cava, and the intestine, liver, brain, and kidneys were harvested. The ileum was taken

at a length of 6 cm anterior to the cecum. The ileal segment was flushed with saline

solution containing 1 mM phenylmethylsulfonyl fluoride (PMSF), everted and scraped with

a tissue-scraper for the collection of enterocytes (Chow et al., 2009). All enterocytes and

tissue samples were snapped frozen in liquid nitrogen.

The effects of 1,25(OH)2D3 on plasma and liver cholesterol concentrations, VDR

target genes and other nuclear receptors were examined in C57BL/6 or fxr(+/+), fxr(-/-)

and shp(-/-) mice (about 6-8 weeks old; n = 6) that were fed a high fat (42%)/high

cholesterol (0.2%) or Western diet (Harlan Teklad , #88137) for a total of 3 weeks. Mice in

each vehicle- and treatment group, respectively, were given 0 or 2.5 µg/kg 1,25(OH)2D3

dissolved in sterile corn oil (5 μl/g) every other day for 8 days at the beginning of the 3rd

week of a high fat/cholesterol diet pretreatment period. On the 9th day after the first

131

1,25(OH)2D3 treatment, blood and tissue samples were harvested using the procedures

described earlier.

5.3.4 Preparation of Subcellular Tissue Fractions

To obtain liver microsomes for Western blot analyses, liver tissues were

homogenized in the microsome homogenizing buffer followed by sequential centrifugation

(Chow et al., 2009). The resulting microsomes were suspended in the same microsome

homogenizing buffer containing 1% protease inhibitor cocktail. For metabolism studies, the

liver tissues were homogenized with similar procedure but without protease inhibitor in the

homogenizing buffer. Protein concentration was determined by the Lowry method (Lowry

et al., 1951).

5.3.5 Immunostaining

For identification of VDR in murine livers, 25 ml of ice-cold PBS was used to

perfuse the mouse via the portal vein, followed by 50 ml of 4% paraformaldehyde prior to

postfixation of the liver in 4% paraformaldehyde at 4°C overnight. Livers were embedded

in paraffin and 7 µm sections were prepared. Following dewaxing, sections were incubated

in 2N hydrochloric acid at 37°C for 30 min and pre-blocked with 5% goat serum in PBS

containing 0.1% Tween-20, and incubated with a primary anti-VDR antibody (1:50 v/v)

overnight. The pre-block sections were rinsed thrice with 5% goat serum and incubated

with the secondary goat anti-rat HRP antibody for 2 h at room temperature, then stained

using a metal-enhanced DAB kit (Thermo Scientific, Rockford, IL). Following washing,

sections were imaged using a Nikon E1000R fluorescence microscope.

132

5.3.6 Real-Time PCR (qPCR)

The TRIzol extraction method was used to isolate total RNA from enterocytes and

liver tissues (Chow et al., 2009). All RNA purities were checked, and 1.5 µg of total RNA

was used for the synthesis of cDNA prior to qPCR with SYBR Green detection. Primer

specificity (Table 5-1) was checked by BLAST analyses

(http://www.ncbi.nlm.nih.gov/BLAST/). The critical threshold cycle (CT) values of target

genes were collected using the ABI Sequence Detection software 1.4 and normalized to

cyclophillin for liver samples and to villin for ileum.


Protein levels of mCyp7a1 were examined by Western blotting. About 50 µg of

total protein was separated by 10% SDS-polyacrylamide gels and transferred onto

nitrocellulose membranes (Chow et al., 2009). After blocking with 5% (w/v) skim milk in

Tris-buffered saline (pH 7.4) with 0.1% Tween 20 (TBS-T) and washing with TBS-T, the

membrane was incubated with the primary antibody solution (2% skim milk) overnight at

4°C, then washed with TBS-T and incubated with a secondary antibody (2% skim milk) for

2 h, followed by washes and probed with chemiluminescence reagents for visualization and

quantification of the band intensity by scanning densitometry (NIH Image software;

http://rsb.info.nih.gov/nih-image/). Protein loading error was corrected by normalizing the

Cyp7a1 protein band against the protein band of Gapdh.

5.3.8 Cyp7a1 Activity in Microsomes

The method of Hylemon et al. (1989) was used to assay for Cyp7a1 activity in 2 mg

of liver microsomal protein upon incubation with exogenously added cholesterol and a

133

NADPH generating system (Chow et al., 2009). The reaction was stopped with addition of

ice-cold 20% sodium cholate. The reaction mixture was added the internal standard 7-

hydroxycholesterol (7-HCO), incubated with cholesterol oxidase to convert the formed

metabolite, 7α-hydroxycholesterol, to 7α-hydroxy-4-cholesten-3-one (7α-HCO), then

stopped with ice-cold methanol. The sample was extracted with hexane followed by several

centrifugation steps (Chow et al., 2009). The pooled extract was evaporated and

reconstituted in the mobile phase (acetonitrile:methanol 70:30 v/v) and injected into the

HPLC. Separation was achieved with an Altex 10 m C-18 reverse phase column (4.6

mm x 250mm) at flow rates varying from 0.7 to 2 ml/min, with detection at 240 nm. The

areas of 7α-HCO, obtained from the converted 7-hydroxycholesterol standards (from 0.05

to 2.5 nmole), were normalized to the 7-HCO areas for construction of the calibration

curve, which was used to estimate the metabolic activities of Cyp7a1.

5.3.9 Blood Analyses

Total bile acid (portal) and cholesterol (systemic) concentrations were determined

using the Total Bile Acids Assay (Diazyme, Cat#DZ042A-K) and Cholesterol (Wako

Diagnostics, Cat#439-17501) Kits, and enzyme (ALT) leakage in systemic plasma with the

ALT kit (BioQuant, Cat#BQ004A-CR).

5.3.10 Liver Cholesterol

Lipids were extracted from liver homogenized tissue (about 0.2 g) in chloroform:

methanol (2:1, v/v) in a modified assay based on published methods (Folch et al., 1957;

Cho, 1983), and the bottom organic phase was harvested after centrifugation. The bottom

phase was then collected consecutively after each centrifugation from extracts washed

134

once in 50 mM NaCl and twice in 0.36 M CaCl2/methanol. The collected organic phase

was brought up to 5 ml with chloroform. In separate tubes in duplicate, 10 μl of chloroform:

Triton X-100 (1:1, v/v) was added, followed by addition of 100 μl aliquot of the extract or

standards, and then were subsequently air dried overnight. Colorimetric enzymatic assays

were performed using commercial reagents following manufacture protocols (Infinity,

Thermo Scientific, Cat#TR13421).

5.3.11 Mouse Primary Hepatocyte Isolation

Mouse primary hepatocytes were isolated by collagenase perfusion and purified by

centrifugation (Horton et al., 1999). Freshly prepared hepatocytes were seeded (density of

0.5x106 cells per well) onto type I collagen coated 6-well plates in attachment media

(William’s E media, 10% charcoal stripped FBS, 1× penicillin/streptomycin and 10 nM

insulin). Media was changed 3 h after plating, and experiments were performed on the

following day. Ligands were added to cells in M199 media without FBS, and cells were

harvested 9 h after treatment for RNA extraction.

5.3.12 Cell Culture and Transfection Assays

HEK293 cells were maintained in Dulbecco’s modified Eagle’s medium

supplemented with 10% fetal bovine serum. Transfection assays were performed in media

containing 10%-charcoal-stripped FBS using calcium phosphate in a 96-well plate. The

following amount of plasmid DNA was used: 50 ng of reporter, 20 ng of pCMX-β-

galactosidase, 15 ng of receptor, 15 ng pCMX-mLRH, and an appropriate amount of the

pGEM filler plasmid for a total of 150 ng/well. Ligands were added at 6–8 h post-

transfection in media containing 10% dextran-charcoal-stripped FBS. Cells were harvested

135

14–16 h later and assayed for luciferase and β-galactosidase activity. Luciferase values

were normalized for transfection efficiency using β-galactosidase and expressed as RLU of

triplicate assays (mean ± SD).

5.3.13 Preparation of Nuclear Protein Extracts

HEK293 cells were maintained in Dulbecco’s modified Eagle’s medium

supplemented with 10% fetal bovine serum. Cells were transfected with 150 ng of mVDR,

mRXR or CMX plasmid DNA using calcium phosphate in a 10 mm plate. At 30 h post-

transfection, nuclear protein extracts were prepared using the NE-PER reagent (Pierce,

Rockford, IL).

5.3.14 Electrophoretic Mobility Shift Assay (EMSA)

The following oligonucleotides (along with their complementary sequence) were

purchased from Sigma Aldrich: rOC-VDRE(+), 5′-

GCACTGGGTGAATGAGGACATTAC-3′, hSHP(-549)-VDRE (+), 5′-

GGCAAAGTCCTCCCAGCCCCCAGGG-3′, hSHP(-283)-VDRE (+), 5′-

GTTAATGACCTTGTTTATCCACTTG-3′, hSHP(-250)-VDRE (+), 5′-

GATAAGGGGCAGCTGAGTGAGCGGC-3′, hSHP(-169)-VDRE (+), 5′-

CGTGGGGTTCCCAATGCCCCCTCCC-3’. The oligos were biotinylated using the biotin

3′ end DNA labeling kit from Pierce, following the manufacturer’s instructions. The

oligonucleotides were mixed at equimolar concentrations, denatured by heating to 95 °C for

5 min, and allowed to anneal by slow cooling at room temperature. DNA binding reactions

were established using 2.5 µl of NE-PER nuclear extracts in 1X binding buffer (10 mM

Tris, 50 mM KCl, 1 mM DTT, 1 mM EDTA, 5 % glycerol, 1 µg BSA and 1 µg of poly(dI-

136

dC); pH 7.5). After a 20 min pre-incubation, 50 fmol of biotinylated DNA probe was added

to each reaction and incubated for an additional 30 min on ice. Reactions were loaded onto

a 6% polyacrylamide gel, transferred to Biodyne B membrane (Pierce) and crosslinked.

Detection was carried out using the LightShift Chemiluminescent EMSA Kit (Pierce)

according to the manufacturer’s instructions.

5.3.15 Statistics

For comparison of results between two groups, the unpaired Student’s t-test was

performed. A P value of less than 0.05 was set as the level of significance. For mRNA and

protein analyses of fxr(+/+) and fxr(-/-) mice, the fxr(+/+) vehicle-treated sample was set

as the control (value set as unity), and was used for comparison against both fxr(+/+) and

fxr(-/-) treatment groups.

5.4 RESULTS

5.4.1 VDR Protein in Mouse Liver

VDR protein in livers of fxr(+/+) and fxr(+/+) mice were 71% and 65%,

respectively, values lower than that of ileal VDR. There was no significant difference of

VDR in the kidney protein compared to that for the ileum in both mouse types (Fig. 5-1A).

Immunostaining analysis revealed that the VDR was present in the nucleus of mouse liver

hepatocytes (Fig. 5-1B).

137

Table 5-1 Mouse Primer Sequences

Gene Bank


FXR NM_009108 CGGAACAGAAACCTTGTTTCG TTGCCACATAAATATTCATTGAGATT

SHP NM_011850 CAGCGCTGCCTGGAGTCT AGGATCGTGCCCTTCAGGTA

LRH-1 NM_001159769 CCCTGCTGGACTACACGGTTT CGGGTAGCCGAAGAAGTAGCT

LXRα NM_013839 GGATAGGGTTGGAGTCAGCA GGAGCGCCTGTTACACTGTT

HNF-4α NM_008261 CCAAGAGGTCCATGGTGTTTAAG GTGCCGAGGGACGATGTAGT

FGF15 NM_008003 ACGGGCTGATTCGCTACTC TGTAGCCTAAACAGTCCATTTCCT

Cyp7a1 NM_007824 AGCAACTAAACAACCTGCCAGTACTA GTCCGGATATTCAAGGATGCA

Asbt NM_011388 GATAGATGGCGACATGGACCTC CAATCGTTCCCGAGTCAACC



138

5.4.2 1,25(OH)2D3 Increases Hepatic Cyp7a1, Decreases Hepatic SHP and Lowers

Cholesterol In Vivo

The fxr(-/-) mice chosen for this study were used to investigate the direct effects of

1,25(OH)2D3 in vivo in the absence of FXR. Basal levels of plasma bile acid and cholesterol

were much higher in control fxr(-/-) mice compared to those for fxr(+/+) mice (P < .05),

whereas that of tissue cholesterol was only marginally higher (Fig. 5-2A). Upon treatment

with 1,25(OH)2D3, both plasma and liver cholesterol levels were significantly reduced in

fxr(-/-) but not in fxr(+/+) mice. The fxr(-/-) mice also showed higher hepatic basal Cyp7a1

mRNA and protein expression and higher microsomal activity than fxr(+/+) mice, and

correspondingly, higher plasma concentrations of bile acids (Fig. 5-2B). Remarkably,

1,25(OH)2D3 treatment resulted in upregulation of hepatic Cyp7a1 mRNA and protein

expression and microsomal activity in both fxr(-/-) and fxr(+/+) mice. The mRNA

expression of hepatic SHP, normally under control of FXR, was significantly decreased in

both fxr(+/+) and fxr(-/-) treated mice (Fig. 5-3A). No significant change was observed for

other genes or nuclear receptors regulating Cyp7a1 in liver and intestine (Figs. 5-3A and 5-

3B).

5.4.3 Correlation Between Cyp7a1 and SHP But Not FGF15

When a correlation was determined for the data for Cyp7a1 vs. SHP and FGF15 (Fig.

5-4), an inverse and significant correlation was found between Cyp7a1 mRNA, protein, or

activity vs. the corresponding mRNA levels of SHP and not FGF15 for each control/treated

fxr(+/+) and fxr(-/-) mouse. These results suggest that the VDR is able to repress SHP

directly and independently of FXR in removing the inhibition on Cyp7A1.

139

1 2 3 4 5 6 (-) (+)

fxr(+/+) fxr(-/-)

1 2 3 4 5 6 (-) (+)

fxr(+/+) fxr(-/-)

(A) (B)

Ileum Liver Kidney

Rel

ativ

e V

DR

Pro

tein

Dis

trib

uion

0.0

0.5

1.0

1.5

2.0

2.5

fxr (+/+)fxr (-/-)

*

0

#

Figure 5-1 Tissue distribution and localization of VDR. (A) VDR protein expression in ileum (lane 1 and 4), liver (lane 2 and 5) and kidney (land 3 and 6) of male fxr(+/+) (lane 1,2, and 3) and fxr(-/-) (lane 4, 5 and 6) mice. (-) and (+) represent negative and positive control of VDR. TheVDR protein band was detected at 50 kDa. The symbols * and # denote significant differences (P < .05) between the ileum of its respective species, respectively. Data represent the mean ± SEM (n = 3-4). (B) Localization of VDR in hepatocytes of C57BL/6 mice. The VDR, as shown by the arrows, was localized within the nuclei of hepatocytes.

140

fxr(+/+) fxr(-/-)

Cho

lest

erol

Con

cent

ratio

n (m

g/dl

)

0

50

100

150

200

250


Plasma

fxr(+/+) fxr(-/-)Ser

um B

ile A

cids

Con

cent

ratio

n (

M)

0

20

40

60

80

100

120


Portal Serum

fxr(+/+) fxr(-/-)

Tis

sue

Cho

lest

erol

(m

g/g)

0

2

4

6

8

10


Liver

†

††† **

P = 0.053*

fxr(+/+) fxr(-/-)

Rel

ativ

e C

yp7a

1 m

RN

A E

xpre

ssio

n

0

2

4

6

8

10

12


Liver

fxr(+/+) fxr(-/-)

Rel

ativ

e C

yp7a

1 P

rote

in E

xpre

ssio

n

0

2

4

6

8

10

12


Liver

fxr(+/+) fxr(-/-)

Hep

atic

Cyp

7a1

Act

ivity

(nm

ol /

h /

mg

mic

roso

me

prot

ein)

0.0

0.5

1.0

1.5


0

Liver

*

*†

***

*

†

**

**†††

(A)

Figure 5-2 Effect of 1,25(OH)2D3 treatment on (A) serum bile acids and plasma and liver cholesterol and (B) Cyp7a1 mRNA and protein expressions and activity in fxr(+/+) and fxr(-/-) mice. Plasma and tissue cholesterol were reduced after 1,25(OH)2D3 treatment (2.5 µg/kg or 6 nmol/kg 1,25(OH)2D3 every other day for 8 days ip), whereas these remained unchanged for fxr(+/+) mice. Higher basal expression of Cyp7a1 mRNA, protein, and catalytic activity existed in fxr(-/-) mice compared to fxr(+/+) mice due to absence of FXR; the expression of Cyp7a1 mRNA, protein, and catalytic activity were all increased after 1,25(OH)2D3 treatment. The symbols † and * denote significant differences between the two controls, and between the treated vs. vehicle control within the fxr(+/+) and fxr(-/-) mice, respectively. Data represent the mean ± SEM (n = 4-5).

(B)

(A)

141

Figure 5-3 Changes in (A) hepatic FXR, SHP, LRH-1, LXR, and HNF-4 and (B) ileal FXR, SHP, LRH-1, FGF15, and Asbt mRNA expressions in both fxr(+/+) and fxr(-/-) mice. The symbols † and * denote significant differences between the two controls, and between the treated vs. vehicle control within the wild-type or null mice, respectively. Data represent the mean ± SEM (n = 4-5).

fxr(+/+) fxr(-/-)

Rel

ativ

e F

XR

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Liver

fxr(+/+) fxr(-/-)

Rel

ativ

e LR

H-1

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Liver

fxr(+/+) fxr(-/-)

Rel

ativ

e LX

R

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Liver

fxr(+/+) fxr(-/-)

Rel

ativ

e H

NF

-4

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Liver

fxr(+/+) fxr(-/-)

Rel

ativ

e S

HP

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5


0

Liver

†††

***

**

fxr(+/+) fxr(-/-)

Rel

ativ

e LR

H-1

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Ileum

fxr(+/+) fxr(-/-)

Rel

ativ

e F

GF

15 m

RN

A E

xpre

ssio

n

0.0

0.5

1.0

1.5

2.0


0

Ileum

fxr(+/+) fxr(-/-)

Rel

ativ

e F

XR

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Ileum

fxr(+/+) fxr(-/-)

Rel

ativ

e S

HP

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5


0

Ileum

fxr(+/+) fxr(-/-)

Rel

ativ

e A

sbt

mR

NA

Exp

ress

ion

0.0

0.5

1.0

1.5

2.0


0

Ileum

*†

††

*

142

.4.4 1,25(OH)2D3 Lowers Cholesterol in C57BL/6 or fxr(+/+), fxr(-/-), and shp(-/-)

Mice Fed a High Fat/High Cholesterol Diet

A high fat/high cholesterol diet (Western diet) was given to male C57BL/6, fxr(-/-),

and shp(-/-) mice for 3 weeks to elevate plasma and liver cholesterol and mimic the

hypercholesterolemia condition (Fig. 5-5). The Western diet failed to increase portal bile

acid or hepatic Cyp7a1 mRNA and protein levels in all genotypes. The Western diet

significantly increased SHP mRNA expressions in the intestine and liver and intestinal

FGF15 level in mice (Fig. 5-6). 1,25(OH)2D3 treatment to these high cholesterol fed mice

decreased plasma (27%) and liver (31%) cholesterol concentrations and increased the

expression of Cyp7a1 mRNA and protein (Fig. 5-5). A significant decrease in liver SHP

mRNA expression and a decrease trend in intestinal SHP and FGF15 levels were observed

with 1,25(OH)2D3 treatment to the Western diet fed mice.

For fxr(-/-) mice, a 33% decrease in plasma cholesterol was observed in 1,25(OH)2D3

treated fxr(-/-) mice prefed a Western diet, and an increase in Cyp7a1 mRNA and protein

expression (Fig. 5-5). However, the Western diet did not increase the basal level of SHP

mRNA expression in the intestine and liver, nor the intestinal FGF15 mRNA. There was

also a significant decrease in liver SHP mRNA expression in the Western diet fed fxr(-/-)

1,25(OH)2D3- treated mice, but increased intestinal SHP and FGF15 levels were observed,

unlike results for the wild-type mice (Fig. 5-6).

Similar to wild-type mice, 1,25(OH)2D3 treated shp(-/-) mice prefed a Western diet

showed a 33% decrease in plasma cholesterol (Fig. 5-5A), though no change in Cyp7a1

mRNA and protein expressions (Fig. 5-5B). The Western diet increased the basal level of

143

intestinal FGF15 mRNA (Fig. 5-6). Interestingly, 1,25(OH)2D3 administrated to the Western

diet fed shp(-/-) mice decreased intestinal FGF15.

Small changes in LRH-1, LXRα, FXR, and VDR in the ileum and liver were

observed in all genotypes with 1,25(OH)2D3 treatment (Fig. 5-6). The composite results

suggest that the VDR is capable of reducing cholesterol via repression of SHP and/or

FGF15 to induce the level of Cyp7a1.

5.4.5 1,25(OH)2D3 Increases Cyp7a1 mRNA and Inhibits SHP Levels in Mouse

Primary Hepatocytes

For examination of the direct VDR effect in mouse liver, we isolated and incubated

mouse primary hepatocytes with 1,25(OH)2D3 for 9 h. The mRNA expression of Cyp24, a

VDR target gene, was induced 19-fold with 1,25(OH)2D3. 1,25(OH)2D3 also significantly

downregulated SHP mRNA expression (35%) and increased Cyp7a1 by 3-fold (Fig. 5-7).

5.4.6 VDR Activation Strongly Represses Mouse and Human SHP Promoter

Activity

To establish whether modulation of SHP occurred directly at the level of the SHP

promoter, we performed promoter reporter assays with the mouse (-2 kb) and human (-0.5

kb) SHP proximal promoters. As previously reported (Honjo et al., 2006), the FXR ligand,

CDCA, significantly increased SHP promoter activity when the hFXR was added (Figs. 5-

8A and 5-8B). Furthermore, the basal transcriptional activity of the SHP promoter was

dramatically increased with the co-transfection of the known competence factor LRH-1 (Lu

et al., 2000). In contrast, addition of 1,25(OH)2D3 strongly repressed the SHP promoter.

The repression of the mouse SHP promoter required the addition of VDR and was more

144

prominent in the presence of LRH-1 (Fig. 5-8A). In contrast, repression of the hSHP

promoter by VDR was significant even in the absence of LRH-1, and was independent of

FXR activation by CDCA (Fig. 5-8B). Notably for mouse and human SHP promoters, the

effects of 1,25(OH)2D3 dominated, and repression of the SHP-luc activity was observed

when both FXR and VDR ligands were given together (Figs. 5-8A and 5-8B).

5.4.6.1 Binding to the VDREs of SHP

Sequence analysis of the human SHP promoter revealed the presence of four

putative VDREs (direct-repeat 3 sequences) located within the first 550 bp of the proximal

promoter. To identify the region on the human SHP promoter involved in repression by

VDR, promoter truncations were generated and assayed for the 1,25(OH)2D3-mediated

repression (Fig. 5-8C). The ability of 1,25(OH)2D3 to repress the hSHP(-258)-luciferase

reporter was significantly dampened compared to that of hSHP(-569)-luc, and repression

was abolished in the shortest construct tested hSHP(-138)-luc.

We then examined whether any of these sequences could compete with the known

interaction of VDR/RXR with the vitamin-D receptor response element from the rat

osteocalcin gene (rOC-VDRE). As expected, the protein-DNA complex formed with

labelled rOC-VDRE was dependent on the presence of both VDR and RXR proteins, and

was not observed when a 500-fold excess of unlabeled rOC-VDRE oligonucleotide was

included (Fig. 5-8D). The four potential VDREs that were identified in the proximal human

SHP promoter (-549,-283,-250,-169), only excess unlabeled hSHP-VDRE(-283) oligo

abolished binding of the protein complex to the rOC-VDRE (Fig. 8D) whereas hSHP (-

169) oligos partially competed off the VDR/RXR binding to the rOC-VDRE. Consistent

145

with the truncation mutant analyses, these data suggest that the hSHP (-283) and hSHP (-

169) VDRE sites may be important for the 1,25(OH)2D3 mediated-repression of the human

SHP promoter.

5.4.6.2 EMSA

To test for the direct binding of the VDR/RXR complex to these putative VDREs,

EMSA experiments were carried out with biotinylated oligonucleotides of the hSHP sites at

-283 and -169. A visible protein-DNA complex was formed with hSHP(-283)-VDRE,

consistent with direct binding of VDR/RXR to this site (Fig. 5-8E). Addition of 1000-fold

excess of unlabeled hSHP(-283)-VDRE competitor abolished this interaction. No binding

was observed for the putative site at -169 (data not shown). Taken together, we propose that

the 1,25(OH)2D3 mediated suppression of SHP gene expression occurs through binding of

VDR to a DR3 response element of the SHP gene promoter.

146

Relative FGF-15 mRNA Expression

0.0 0.5 1.0 1.5Rel

ativ

e C

yp7a

1 P

rote

in E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0 Vehicle control1,25(OH)2D3

y = -0.14x + 0.61R2 = 0.05

00


0.0 0.5 1.0 1.5

Rel

ativ

e C

yp7

a1 m

RN

A E

xpre

ssio

n

0.0

1.0

2.0

3.0

4.0

5.0


y = -0.02x + 2.73R2 = 0

00

Relative SHP mRNA Expression

0.0 0.5 1.0 1.5

Live

r C

yp7a

1 A

ctiv

ity

(nm

ol /

h /

mg

mic

roso

me

prot

ein)

0.0

0.2

0.4

0.6


y = -0.40x + 0.67R2 = 0.76

00


0.0 0.5 1.0 1.5

Rel

ativ

e C

yp7

a1 m

RN

A E

xpre

ssio

n

0.0

1.0

2.0

3.0

4.0

5.0


y = -4.32x + 6.16R2 = 0.87

00


0.0 0.5 1.0 1.5Rel

ativ

e C

yp7

a1 P

rote

in E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0


y = -0.80x + 1.13R2 = 0.84

00


0.0 0.5 1.0 1.5

Liv

er

Cyp

7a1

Act

ivity

(n

mo

l / h

/ m

g m

icro

som

e p

rote

in)

0.0

0.2

0.4

0.6


y = 0.023x + 0.35R2 = 0.01

00

P = 0.0024

P = 0.0035

P = 0.0097

P = 0.988

P = 0.599

P = 0.861


0.0 0.5 1.0 1.5Rel

ativ

e C

yp7a

1 P

rote

in E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0 Vehicle control1,25(OH)2D3

y = -0.14x + 0.61R2 = 0.05

00


0.0 0.5 1.0 1.5

Rel

ativ

e C

yp7

a1 m

RN

A E

xpre

ssio

n

0.0

1.0

2.0

3.0

4.0

5.0


y = -0.02x + 2.73R2 = 0

00


0.0 0.5 1.0 1.5

Liv

er

Cyp

7a1

Act

ivity

(n

mo

l / h

/ m

g m

icro

som

e p

rote

in)

0.0

0.2

0.4

0.6


y = -0.40x + 0.67R2 = 0.76

00


0.0 0.5 1.0 1.5

Rel

ativ

e C

yp7

a1 m

RN

A E

xpre

ssio

n

0.0

1.0

2.0

3.0

4.0

5.0


y = -4.32x + 6.16R2 = 0.87

00


0.0 0.5 1.0 1.5Rel

ativ

e C

yp7

a1 P

rote

in E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0


y = -0.80x + 1.13R2 = 0.84

00


0.0 0.5 1.0 1.5

Liv

er

Cyp

7a1

Act

ivity

(n

mo

l / h

/ m

g m

icro

som

e p

rote

in)

0.0

0.2

0.4

0.6


y = 0.023x + 0.35R2 = 0.01

00

P = 0.0024

P = 0.0035

P = 0.0097

P = 0.988

P = 0.599

P = 0.861

(A) (B)

Figure 5-4 Correlation between murine Cyp7a1 mRNA, protein, and catalytic activity vs. SHP mRNA (A, left column) and FGF-15 mRNA (B, right column) in fxr(+/+) mice that were treated with 1,25(OH)2D3. Note the significant correlation between Cyp7a1 parameters and SHP mRNA and not FGF-15 mRNA. Data represent the mean ± SEM (n = 4-5).

147

Figure 5-5 Effects of 1,25(OH)2D3 treatment on (A) serum bile acids and plasma and liver cholesterol as well as (B) Cyp7a1 mRNA and protein expressions in wild-type, fxr(-/-) and shp(-/-) mice prefed with a high fat/high cholesterol diet (n = 4-6) for 3 weeks. After commencing treatment of 1,25(OH)2D3 at 2.5 µg/kg or 6 nmol/kg ip every other day for 8 days at the beginning of the 3rd week and harvesting on the 9th day of treatment, decreased plasma and liver cholesterol levels and increased Cyp7a1 mRNA and protein expressions were observed. The symbols † and * denote significant differences between the two controls, and between the treated vs. vehicle control, respectively. Data represent the mean ± SEM (n = 4-6).

(A) (B)

Wild Type shp(-/-)

Tis

sue

Con

cent

ratio

n (m

g/dl

)

0

5

10

15

20

25

30 Normal Diet ControlHigh Cholesterol Diet ControlHigh Cholesterol Diet 1,25(OH)2D3

Liver

shp(-/-)

Wild Type fxr(-/-) shp(-/-)Ser

um B

ile A

cids

Con

cent

ratio

n (

M)

0

50

100

150


Portal Serum

fxr(-/-) shp(-/-) Wild Type fxr(-/-) shp (-/-)

Rel

ativ

e C

yp7a

1 m

RN

A E

xpre

ssio

n

0

2

4

6

8Normal Diet ControlHigh Cholesterol Diet ControlHigh Cholesterol Diet 1,25(OH)2D3

0fxr(-/-) shp(-/-)

Liver

***†††

P = 0.05

Wild Type fxr(-/-) shp(-/-)

Cho

lest

erol

Con

cent

ratio

n (m

g/dl

)

0

100

200

300


Plasma

fxr(-/-) shp(-/-)

**†††

**†††

*†


Cho

lest

erol

Con

cent

ratio

n (m

g/dl

)

0

100

200

300


Plasma

fxr(-/-) shp(-/-)

**†††

**†††

*†


Rel

ativ

e C

yp7a

1 P

rote

in E

xpre

ssio

n

0

2

4

6


0fxr(-/-) shp(-/-)

Liver

P = 0.056 *

**

148

(A)

FXR SHP VDR LXR LRH-1 HNF-4

Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


0

Wild Type Liver

FXR SHP VDR LRH-1 FGF15 Asbt

Rel

ativ

e m

RN

A E

xpre

ssio

n

0

10

20

30


0

Wild Type Ileum


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


0

shp(-/-) Liver

††

††

*


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


0

fxr(-/-) Liver


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

10

20

30


0

fxr(-/-) Ileum


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

10

20

30

40

Normal Diet ControlHigh Cholesterol Diet ControlHigh Cholesterol Diet 1,25(OH)2D3

0

shp(-/-) Ileum

†† †

††

*

*

***

††**

† *††

**** **

††**

†††

*

(B)

Figure 5-6 Changes in (A) hepatic FXR, SHP, LRH-1, LXR, and HNF-4 and (B) ileal FXR, SHP, LRH-1, FGF15, and Asbt mRNA expressions in wild-type, fxr(-/-) and shp(-/-) mice prefed with a high fat/high cholesterol diet (n = 4-6) for 3 weeks. The symbols † and * denote significant differences between the two controls, and between the treated vs. vehicle control, respectively. Data represent the mean ± SEM (n = 4-6).

149

FXR SHP VDR LXR LRH-1 HNF-4 Cyp7a1 Cyp24

Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

2030


0

*

*

*

Figure 5-7 Gene expression changes in mouse primary hepatocytes treated with 100 nM 1,25(OH)2D3. Hepatocytes were treated with vehicle (Veh or vehicle, 0.1% EtOH) or 100 nM 1,25(OH)2D3 for 9 h in culture. Cells were harvested for RNA and gene expression analyzed by qPCR. The “*” denotes significant difference (P < .05) between treated vs. vehicle control. Data represent the mean ± SD (n=3).

150

Figure 5-8 1,25(OH)2D3 suppresses SHP expression via direct binding to a DR3 VDRE located within the proximal SHP promoter. (A and B), Reporter analysis of the mSHP and hSHP promoters. HEK293 cells were transiently transfected with either mSHP (-2 kb)-luciferase reporter (A) or hSHP (-569 bp)-luciferase reporter (B), in the presence or absence of mLRH-1, hFXR, hRXR and mVDR. After 6-8 h, cells were treated with vehicle (EtOH), 50 μM CDCA, 0.5 nM 1,25(OH)2D3 or 50 μM CDCA + 0.5 nM 1,25(OH)2D3. Data represent the mean ± SD (n=3). (C) Deletion analysis of the hSHP promoter. HEK293 cells were transiently transfected with the indicated hSHP promoter luciferase constructs in the presence of mLRH-1, hRXR and mVDR. Data represent the mean ± SD (n=3) for cells were treated with vehicle (EtOH) or 0.5 nM 1,25(OH)2D3. The boxes represent potential VDREs. (D and E) show the specificity of VDR/RXR binding to the hSHP VDRE by EMSA in HEK293 nuclear extracts. (D) VDR/RXR heterodimers were incubated with 40 nM rOC-VDRE biotin labelled probe. Where indicated, an unlabeled oligonucleotide competitor was also added to the binding reactions at a concentration equal to 500-fold that of the probe, except for lane 3, where the competitor concentration was 100-fold that of the probe. (E) VDR and RXR nuclear extracts (alone or in combination) were incubated with 40 nM of biotin-labelled rOC-VDRE or hSHP(-283)-VDRE. Where indicated, the matching unlabeled oligonucleotide competitor was also added to the binding reactions at a concentration equal to 1000-fold that of the probe.

151

5.5 DISCUSSION

This study has unequivocally demonstrated that 1,25(OH)2D3 induced hepatic

Cyp7a1 in mice. Among the mechanisms examined, it was found that decreased hepatic

SHP and a second, though minor, mechanism involving intestinal FGF15 might have

resulted in the lowering of both plasma and liver cholesterol. Although various studies,

including the present data (Fig. 5-1), have shown that the VDR is relatively low in liver

compared to other major VDR organs such as the kidney and intestine (Gascon-Barré et al.,

2003; Chow et al., 2010), VDR is clearly identified to exist in mouse hepatocytes to elicit

the direct inhibitory action on SHP, which leads to the derepression of Cyp7a1. The

presence of VDR in mouse hepatocytes responded to 1,25(OH)2D3 treatment resulted in

reduction of SHP in the induction of Cyp7a1 and lowering of cholesterol, strongly suggests

a role of the VDR in hypercholesterolemia.

Species differences has attributed to the different 1,25(OH)2D3 responses observed

in the regulation of rodent Cyp7a1 and human CYP7A1. In mouse and human, the presence

of LRH-1 in the ASBT promoter was found to regulate ASBT levels in the ileum (Chen et

al., 2003). Increased bile acid concentrations in the enterocytes triggered a negative

feedback mechanism where the induction of SHP by FXR inhibited the binding of LRH-1

to the Asbt gene and negatively regulated ASBT. However, absence of the cis-acting

element in LRH-1 in the rat Asbt promoter nullified the negative feedback inhibition of

Asbt. Hence, earlier rat studies have shown that 1,25(OH)2D3 treatment led to induced Asbt

in rat ileum and increased bile acid absorption that further triggered secondary FXR effects

in the liver to downregulate Cyp7a1 (Chow et al., 2009). In contrast, 1,25(OH)2D3

administration to mice did not result in significant increases in bile acids nor elicit

152

secondary FXR effects in the liver, and repression of SHP and inductive Cyp7a1 effects

were observed in both wild-type and fxr(-/-) mice (Figs. 5-2 and 5-3). Similar studies found

that 1(OH)D3, a vitamin D analog, when given to mice, increased Cyp7a1 mRNA level and

decreased SHP mRNA expression in liver (Nishida et al., 2009; Ogura et al., 2009).

Our observations differed from those of Schmidt et al. (2010) who administered

high doses of 50 and 75 µg/kg of 1,25(OH)2D3 (20 to 30-fold higher than our study) to

mice and found opposite changes, that is increased FGF15 mRNA at 4 h. The discrepancy

could be explained by the fact that our study was performed under steady-state, with low

doses of 1,25(OH)2D3 given on a protracted schedule, a regimen that may have eliminated

large changes and overt toxicity. The regulation of Cyp7a1 and FGF15 in mice after

1,25(OH)2D3 administration could undoubtedly be affected by the dose and dosing intervals.

We substantiate our present findings on Cyp7a1 induction by the VDR by showing that the

induction in Cyp7a1 paralleled those for 1,25(OH)2D3 concentrations in the mouse liver

(Chapter 6; Fig. 6-4).

A dual inhibitory mechanism can be inferred for cholesterol lowering due to the

VDR: (i) the inhibition of hepatic SHP and (ii) inhibition of intestinal FGF15 by the VDR

(Fig. 5-2B, 5-3A, 5-6A and 5-6B). Our studies show that activated VDR decreases liver

SHP in vivo (Figs. 5-2 and 5-5) and in mouse hepatocytes (Fig. 5-7), and was bound to

mouse and human SHP promoters to decrease SHP activity directly (Fig. 5-8). However,

Chiang’s group reported that VDR activation inhibited human CYP7A1 by genomic effects

due to interaction with HNF-4α and the CYP7A1 promoter, and by non-genomic effects

through the activation of the ERK pathway (Han and Chiang, 2009; Han et al., 2010).

Studies have also shown that VDR activation could either inhibit or activate the ERK

153

pathway (Wu et al., 2007; Han et al., 2010). Certainly, data from in vitro systems need to

be carefully examined and properly interpreted. It could be argued that in vitro data and

assays regarding SHP should be interpreted with caution because SHP has a short half life

(<30 min) due to rapid proteasomal degradation and it is plausible that activation of the

ERK pathway could reduce this degradation process (Miao et al., 2009). In contrast, we

have provided strong evidence in mice in vivo and in primary mouse hepatocytes (Figs. 5-2

to 5-7) that VDR induces Cyp7a1 via SHP repression. There exists further evidence that

CYP7A1 mRNA and protein levels are increased in human hepatocytes incubated with 100

nM 1,25(OH)2D3 between 12 to 24 h (unpublished data, Fan and Pang). Our in vitro data

further reveal direct binding of VDR/RXR to the hSHP promoter (Figs. 5-8D and 5-8E),

and confirmed inhibitory effects of VDR activation towards mSHP and hSHP activities

(Figs. 5-8A and 5-8B). The inhibition of VDR on SHP was reversed by the removal of the

VDREs in hSHP promoter (Fig. 5-8C).

In addition to the direct inhibition of hepatic SHP expression by VDR, VDR may

also play a role in intestinal FGF15 expression. In the absence of FXR, 1,25(OH)2D3

treatment to fxr(-/-) mice prefed with the Western diet markedly increased intestinal FGF15

expression (Fig. 5-6A), a finding similar to observations of Schmidt et al. (2010). However,

the trend was opposite to those observed for the wild-type and shp(-/-) mice fed the

Western diet that were treated with 1,25(OH)2D3 (Fig. 5-6A). We reconciled the difference

in observation along the lines of Honjo et al. (2006), who had previously observed VDR

activation in the inhibition FXR and downregulation of SHP. There could exist opposing

effects from VDR on intestinal FGF15, since VDR is able to positively upregulate

intestinal FGF15 as well as inhibit intestinal FXR, which normally upregulates FGF15. In

154

animal models where the intestinal FXR level is high, the VDR inhibitory effect on FXR

may predominate over the VDR stimulatory effect on FGF15, causing a net decrease of

FGF15, since the present data showed that the inhibitory role of the VDR towards FXR and

SHP lowering in liver is the major mechanism of Cyp7a1 induction. Moreover, for mice

prefed the Western diet, there may be an increase in the bile acid pool size (Hartman et al.,

2009; Katona et al., 2009), as evidenced by the increase in mRNA of intestinal SHP and

FGF15 and hepatic SHP, all FXR-target genes (Fig. 5-6).

Vitamin D and its analogs have been shown to exert beneficial effects in liver. For

an example, a study has suggested that administration of 1,25(OH)2D3 to diabetic rats

caused hyperglycaemia evoked oxidative stress to increase LDL-cholesterol and liver injury

(increase in ALT) (Hamden et al., 2009), and was able to reduce cholesterol, triglycerides,

and ALT (Hamden et al., 2009). Makishima’s group showed that vitamin D analogues can

increase Cyp7a1 and reduce inflammatory factors in mice (Nishida et al., 2009; Ogura et al.,

2009). Recently, doxercalciferol, a vitamin D analogue, has been found to decrease the

accumulation of triglycerides and cholesterol in kidney (Wang et al., 2011a). Additionally,

basal levels of serum cholesterol are higher in VDR knockout mice than in wild-type mice,

suggesting a role of VDR in cholesterol homeostasis (Wang et al., 2009). Clinically, a

combination of atorvastatin and vitamin D supplement exerts a synergetic effect in

lowering cholesterol in patients (Schwartz, 2009), and there may be a role of the VDR in

hypercholesterolemia.

We showed in the present study that VDR unequivocally upregulated Cyp7a1 levels

in the murine liver via repression of hepatic SHP directly, and decreased intestinal FGF15

via FXR antagonism, rendering the lowering of plasma and liver cholesterol in vivo. We

155

further showed that 1,25(OH)2D3 lowered cholesterol in a mouse model only when high

concentration of cholesterol in plasma and liver were present. Several important messages

can be deduced from our observations: (a) species differences exist between the rat and

mouse, as shown in our work on 1,25(OH)2D3 treatment with the rat in vivo, evoking FXR

rather than VDR effects in rat liver (Chow et al., 2009); (b) it must be recognized that

results established in vitro may not reflect events in vivo; and (c) multiple mechanisms can

prevail concomitantly and exert synergistic or opposing actions, and these pathways tend to

be concentration-, time-, and dose-dependent, organ and route specific, and ligand- or

solvent-dependent. Different results may be observed due to dose, vehicle, frequency,

route of administration, and time of sampling.

5.6 ACKNOWLEDGMENTS


Grant [Grant MOP89850]. Edwin C.Y. Chow was supported by the University of Toronto

Open Fellowship and the National Sciences and Engineering Research Council of Canada

Alexander Graham Bell Canada Graduate Scholarship (NSERC-CGS), and Matthew R.

Durk was supported by the Canadian Institutes of Health Research (CIHR) Strategic

Training Grant in Biological Therapeutics. We like to thank Monica Patel from Dr. Carolyn

L. Cummins laboratory for providing assistance in the cholesterol measurements in the

liver.


Cytochrome 7-hydroxylase or CYP7A1 is the rate limiting enzyme in cholesterol

metabolism in liver. The enzyme is known to be under regulation of the nuclear receptor

156

farnesoid X receptor (FXR) that negatively regulates CYP7A1 via the induction of the

small heterodimer partner (SHP), which acts by attenuating the stimulatory effects of other

nuclear receptors and transcription factors, such as the hepatocyte nuclear factor (HNF-4)

and liver receptor homolog (LRH-1) in liver, and by intestinal FXR through induction of

fibroblast growth factor 15 (FGF15), a hormonal signaling molecule that travels through

the portal blood to negatively regulate Cyp7a1 in liver. In this chapter, we demonstrate that

activation of the VDR in liver inhibited the expression of hepatic SHP to remove the

inhibition on Cyp7a1. The inhibition results in increased cholesterol metabolism and

decrease in plasma and liver cholesterol in a high cholesterol mouse model. We showed the

lack of involvement of FXR in SHP repression but the involvement of SHP with use of

both FXR and SHP knockout mouse models. The luciferase assay, truncation analysis,

binding assay and EMSA of mouse and human SHP promoters revealed that direct binding

inhibited their activities, suggesting that VDR directly binds and inhibits SHP

transcriptional activity. These results suggest a potential role of VDR in cholesterol

lowering by repression of SHP, removing the inhibition of SHP on Cyp7a1, increasing

Cyp7a1 protein and activities in vivo. Furthermore, examination of cholesterol related gene

changes in the liver and intestine showed a decrease in intestinal ABCA1 transporter in

1,25(OH)2D3 treated mice prefed with a Western diet, which maybe another factor for the

decrease in plasma cholesterol. (See APPENDIX F2 to F4). Primer sequences of these

genes for qPCR are listed in Appendix T1. Western blotting conditions for Cyp7a1 protein

and other related proteins are listed in APPENDIX T2. Changes in body weights of each

treatment experiment, food intake, plasma calcium, phosphate and alanine transaminase

(ALT) and liver triglyceride are listed in APPENDIX T3-T9.

157

In this study, I was responsible for the investigation and analyses of all data from in

vivo studies using wild-type, fxr(-/-) and shp(-/-) mice with or without the Western diet,

including 1,25(OH)2D3 treatment to mice, tissue harvesting, mRNA and protein analyses,

bile acids, cholesterol and ALT measurement. Lilia Magomedova examined the molecular

mechanism of VDR on SHP: luciferase assay, truncation analysis, binding assay and

EMSA. Rucha Patel investigated the direct effect of VDR on primary mouse hepatocytes.

Matthew R. Durk performed immunostaining of VDR protein in mouse liver. Han-Joo

Maeng examined the microsomal activity of mouse Cyp7a1. Holly Quach ran the in vivo

treatment of 1,25(OH)2D3 on fxr(-/-) pretreated with the Western diet.

158

CHAPTER 6

6. CORRELATION BETWEEN TISSUE 1,25-DIHYDROXYVITAMIN D3

LEVELS AND GENE CHANGES: A TEMPORAL STUDY

Edwin C.Y. Chow1, Reinhold Vieth2, and K. Sandy Pang1

1Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, and the

2Department of Nutritional Sciences, University of Toronto, Canada

159

6.1 ABSTRACT

Activation of the vitamin D receptor (VDR) has been found to regulate transporters

and enzymes in many organs, including the multidrug resistance protein 1 or P-glycoprotein

(Mdr1/P-gp) in kidney and Cyp7a1, the cholesterol metabolizing enzyme in mouse liver in

vivo. However, plasma and tissue levels of 1,25(OH)2D3 as well as changes in expression of

target genes and nuclear receptors are largely unknown. A temporal study of 1,25(OH)2D3

and calcium concentrations in plasma and tissues (ileum, liver, kidney, and brain) as well as

mRNA expression of target genes and nuclear receptors was conducted in wild-type mice

after treatment of 2.5 µg/kg of 1,25(OH)2D3 i.p. every other day for 8 days. Blood (to

provide plasma) and tissues were harvested at various time points during the treatment

period for the determination of gene changes by qPCR; levels of calcium were measured by

ICP-AES and 1,25(OH)2D3 by EIA (enzyme immunoassay). The pharmacokinetics of

1,25(OH)2D3 was altered with time after 1,25(OH)2D3 because of induction of Cyp24, a

catabolic enzyme for 1,25(OH)2D3 metabolism in tissues, especially in kidney. However,

1,25(OH)2D3 concentrations in tissues were much higher than basal levels during the 8-day

treatment period. Induction of hepatic Cyp7a1 and renal Mdr1 mRNA correlated with

1,25(OH)2D3 concentrations and Cyp24 mRNA changes in the tissues, showing that the

induction of hepatic Cyp7a1 and Mdr1 was the result of VDR activation.

6.2 INTRODUCTION

The vitamin D receptor (VDR) has been found to be distributed in a wide range of

tissues and is now known to be one of the major players in the regulation of transporters and

enzymes. The active form of vitamin D3, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], is the

160

natural ligand for the VDR (Jones et al., 1998). When activated, the VDR becomes a

transcription factor and is translocated into the nucleus where it heterodimerizes with the

retinoid X receptor (RXRα) to form a complex that binds to the DNA response element to

initiate transcription. Activation of the VDR has been associated with changes in numerous

enzymes and transporters that include cytochrome P450 (human CYP3A4 and rodent

Cyp3a1, Cyp3a9, and Cyp24), sulfotransferase (SULT2A1), the multidrug resistance protein

1 or P-glycoprotein (MDR1/P-gp) (Chapter 4), and the multidrug resistance associated

proteins (MRP2/Mrp2, Mrp3, MRP4/Mrp4) both in vitro and in vivo (Thummel et al., 2001;

Echchgadda et al., 2004; Chow et al., 2009; Fan et al., 2009; Chow et al., 2010). These

changes have serious implications on cholesterol and bile acid homeostasis (Chapter 5) as

well as amyloid-beta (Aβ) peptides transport (Durk et al., 2011b) in the brain.

Studies have revealed that the VDR is important in bile acid and cholesterol

homeostasis (Makishima et al., 2002) (see Chapter 5). 1,25(OH)2D3 administration to rats

resulted in increased apical sodium dependent bile acids transporter (Asbt) in the ileum that

increased portal bile acid concentrations and activated the farnesoid X receptor (FXR),

resulting in secondary effects in intestine and liver (Chen et al., 2006; Chow et al., 2009).

This resulted in a downregulation of Cyp7a1, the rate limiting enzyme for cholesterol

metabolism, and a decrease in bile acid synthesis. However, in mice and humans, higher

amounts of VDR are present in the liver compared to the rat, suggesting species variations

of VDR in liver (Gascon-Barré et al., 2003). Nishida et al. (2009) reported that 1-

hydroxyvitamin D3 treatment to mice resulted in increased expression of Cyp7a1 as well as

Mrp2, Mrp3, and Mrp4 in kidney for increase bile acid elimination from the liver (Nishida et

al., 2009). In a previous study (Chapter 5), we demonstrated that repeated dosing of

161

1,25(OH)2D3 to mice prefed a Western diet resulted in decreased plasma and liver

cholesterol concentrations and an increase in Cyp7a1 expression due to repression, of the

VDR on the hepatic short heterodimer partner (SHP), and an indirect repression of intestinal

fibroblast growth factor 15 (FGF15), both being negative regulators of Cyp7a1 (Chapter 5).

The study suggests that the VDR plays a role in cholesterol metabolism in the liver.

Our laboratory showed that the VDR directly regulates P-gp independently of the

FXR in vivo, resulting in 3.45- and 1.47-fold increases in intrinsic secretary clearances of

digoxin in kidney and brain, respectively (Chow et al., 2011a). Increased brain P-gp protein

expression was associated with a decrease in accumulation of brain digoxin, a P-gp substrate,

in vivo (Chow et al., 2011a). Moreover, the increased brain P-gp activity may play a role in

the prevention of Alzheimer’s disease due to enhanced secretion of -amyloid peptides (Aβ)

(Durk et al., 2011a; Durk et al., 2011b), substrates of the P-gp (Lam et al., 2001).

Although the present findings suggest important roles of the VDR on cholesterol

metabolism in liver and increased P-gp efflux in brain, there is no data existing to show the

tissue levels of 1,25(OH)2D3 and how these relate to changes in gene expression. The plasma

concentrations of 1,25(OH)2D3 are reported to be detectable at the pM range (Dusso et al.,

2005). Clinically, the 25-hydroxyvitamin D3, and not the 1,25(OH)2D3 concentration in

plasma is used as a biomarker to reflect vitamin D status, because the conversion of 25-

hydroxyvitamin D3 to 1,25(OH)2D3 is the rate limiting step (Wang et al., 2008b). However,

the concentration of 25-hydroxyvitamin D3 does not reflect the concentration of

1,25(OH)2D3 in plasma nor in tissue. In order to implicate pharmacological effects of

1,25(OH)2D3, there is a need to quantify 1,25(OH)2D3 levels in tissues. Therefore, a

162

temporal study of 1,25(OH)2D3 concentrations in mice were determined to relate the tissue

concentrations of 1,25(OH)2D3 on the changes in VDR target gene/nuclear receptor mRNA

expression. In addition, we examined calcium ions and levels of Cyp24, a target gene of the

VDR and the catabolic enzyme that degrades 1,25(OH)2D3, after 1,25(OH)2D3 treatment.

The pharmacokinetic changes of exogenously administered 1,25(OH)2D3 in mice given

multiple doses was studied.

6.3 METHODS

6.3.1 Materials

The 1,25(OH)2D3 powder was purchased from Sigma-Aldrich Canada (Mississauga,

ON, Canada). Anti-Cyp24 antibody (H-87) was purchased from Santa Cruz Biotechnology

(Santa Cruz, CA), and anti-Gapdh (6C5), from Abcam (Cambridge, MA). All other reagents

were purchased from Sigma-Aldrich Canada (Mississauga, ON, Canada) and Fisher

Scientific (Mississauga, ON, Canada).

6.3.2 Pharmacokinetic Study of 1,25(OH)2D3 in Mice

Anhydrous ethanol was used to dissolve the 1,25(OH)2D3 powder, and the

concentration was quantified at 265 nm spectrophotometrically (UV-1700, Shimadzu

Scientific Instruments, MD) before the final preparation of the 1,25(OH)2D3 in sterile corn

oil. An in vivo pharmacokinetic study of 1,25(OH)2D3 was conducted in 8-week ago mice.

1,25(OH)2D3, dissolved in sterile corn oil, was given intraperitoneally (i.p.) to male,

C57BL/6 mice at either a dose of 0 or 2.5 µg/kg (5 μl/g) on Days 1, 3, 5, and 7 at 9 a.m. in

the morning. Thereafter, one mouse was sacrificed for blood (plasma) and tissue

measurements for the 1,25(OH)2D3 treatment group at various sampling time points at 0, 0.5,

163

1, 3, 6, 9, 12, 24, 48, 96, 192, and 360 h after the injected dose on Day 1, and at 0, 0.5, 1, 3,

6, 9, 12, 24, and 48 h after the injected doses on Days 3, 5, and 7. For the control group,

sampling was conducted at 0, 3, 6, and 12 h on Day 1, and 0 h on Days 3, 5, 7, 9, and 15.

Each mouse was rendered unconscious in a carbon dioxide chamber, and blood was

collected by cardiac puncture into a heparin-coated (1000 IU/ml) 1-ml syringe-23G 3/4”

needle set. Plasma was obtained by centrifugation of blood at 3000 rpm for 10 min. The

mouse was perfused with ice-cold saline through the lower vena cava. The liver, kidney,

brain, and mucosal scraping from ileal enterocytes were harvested (Chow et al., 2009),

weighed, cut into small pieces, snap- frozen in liquid nitrogen, and stored at -80°C for future

analyses.

6.3.3 Plasma Calcium and Phosphorus Analysis

Quantification of calcium and phosphorus in plasma were determined by inductively

coupled plasma atomic emission spectroscopy (ICP-AES) (Optima 3000 DV, Perkin Elmer).

These plasma samples were diluted 350-fold with 1% nitric acid before each measurement.

Calcium was quantified at 317.9 nm and 315.9 nm, whereas phosphorus at 213.6 nm and

214.9 nm.

6.3.4 Tissue 1,25(OH)2D3 Extraction and 1,25(OH)2D3 Enzyme-immunoassay (EIA)

for Plasma and Tissue Samples

The tissue extraction procedure for lipids was similar to Bligh and Dyer (1959), with

modifications. Weighed brain, liver, kidney and scraped enterocyte samples were diluted

with double distilled water (w/v) to 1 ml. The sample was homogenized with 3.75 ml of a

mixture of methylene chloride and methanol (1:2 v/v). The homogenates were added to 1.25

ml of methylene chloride, vortexed for 1 min, and then 1.25 ml of double distilled water was

164

added and mixed for another min before centrifugation at 3000 rpm for 20 min at room

temperature. The extracted solution (bottom phase) was collected by a glass syringe-metal

needle set. The extraction procedure was repeated upon addition of 1.25 ml of methylene

chloride, vortexed for 1 min and recentrifuged at 3000 rpm for 20 min at room temperature.

The recovered bottom phase was harvested and added to that from the previous extraction.

The pooled extract was dried under nitrogen gas and reconstituted in 0.3 ml of charcoal-

stripped human serum.

The concentration of 1,25(OH)2D3 in mouse plasma or tissue sample, reconstituted in

stripped human serum, was determined using an enzyme-immunoassay (EIA) kit (Cat#AC-

62F1 from Immunodiagnostics Systems (IDS) Inc., Scottsdale, AZ, USA) following the

manufacture’s protocol. Plasma and tissue samples were diluted with charcoal stripped

human serum before assay.

6.3.5 Pharmacokinetic Analysis: Plasma Concentration-Time Profile

A rapid absorption phase followed by an apparent, first-order decay was observed

(Fig. 6.1). The elimination rate constant (k) in plasma after each dose of 1,25(OH)2D3 was

estimated from the slope of the log-linear phase, from between 1 to 12 h or 3 to 12 h time-

points, and the elimination half life (t1/2) was calculated as 0.693/k. The plasma area under

the curve (AUC(0-48)) between 0 to 48 h was estimated by the trapezoidal rule, assuming that

the initial time point being the same as the basal level of 1,25(OH)2D3 of the control mouse.

6.3.6 Preparation of Subcellular Protein Fractions of Kidneys

For preparation of the crude membrane fraction for the assay of Cyp24, about 0.1 g

of kidney tissue was homogenized in the crude membrane homogenizing buffer (250 mM

165

sucrose, 10 mM HEPES, and 10 mM Trizma base, pH 7.4) containing 1% protease inhibitor

cocktail (Chow et al., 2011a). The resultant homogenate was centrifuged at 3,000 g for 10

min at 4°C. The pellet was resuspended in a buffer [60 mM KCl, 15 mM NaCl, 5 mM

MgCl2•6H2O, 0.1 mM EGTA, 300 mM sucrose, 0.5 mM DTT, 0.1 mM PMSF, 300 mM

sucrose, and 15 mM Trizma HCl pH 7.4] containing 1% protease inhibitor cocktail for

Western blotting of Cyp24 protein expression. The protein concentrations of the samples

were assayed by the Lowry method (Lowry et al., 1951) using bovine serum albumin as the

standard. Samples were then stored at -80°C until Western-blot analyses.


Total protein samples (50 µg) were separated by 10% SDS-polyacrylamide gels at

100 V. After separation, proteins were transferred onto a nitrocellulose membrane

(Amersham Biosciences, Piscataway, NJ), which was subsequently blocked with 5% (w/v)

skim milk in Tris-buffered saline (pH 7.4) and 0.1% Tween 20 (TBS-T) (Sigma-Aldrich,

ON) for 1 h at room temperature, and then washed once with 0.1% TBS-T, followed by

incubation with primary antibody solution in 2% skim milk in 0.1% TBS-T overnight at 4°C.

The membrane was washed with 0.1% TBS-T on the next day and then incubated with

secondary antibody in 2% skim milk in 0.1% TBS-T for 2 h at room temperature, and again

washed with 0.1% TBS-T. Bands were visualized using chemiluminescence reagents

(Amersham Biosciences, Piscataway, NJ) and quantified by scanning densitometry (NIH

Image software; http://rsb.info.nih.gov/nih-image/). The band intensity of the target protein

was normalized against that of Gapdh to correct for loading errors.

166

6.3.8 Quantitative Real-Time Polymerase Chain Reaction (real-time PCR or qPCR)

Similar to the procedure described previously (Chow et al., 2011a), total RNA from

scraped enterocytes, liver and kidney tissues were extracted with the TRIzol extraction

method (Sigma-Aldrich) according to the manufacturer’s protocol, with modifications. Total

RNA was quantified by UV spectrometry at 260 nm. The purity was checked by ratios of the

readings at 260/280 nm and 260/230 nm (≥1.7). About 1.5 µg of cDNA was immediately

synthesized from the RNA samples, using the High Capacity cDNA Reverse Transcription

Kit (Applied Biosystems Canada, ON). qPCR was performed with SYBR Green detection

system. A PCR mixture (20 µl final volume) consisting of 75 ng cDNA, 1 µM of forward

and reverse primers, and 1 Power SYBR Green PCR Master Mix (Applied Biosystems)

was used to perform PCR analysis. Information on primer sequences are listed in Table 6-1.

Amplification and detection were performed using an ABI 7500 system. The qPCR system

was assigned the following PCR cycling temporal profile: 95°C for 10 min, and 40 cycles of

95°C for 15 sec and 60°C for 1 min, followed by the dissociation curve. Data were analyzed

using the ABI Sequence Detection software version 1.4 to obtain critical threshold cycle (CT)

values. Fold changes between vehicle control and treatment was expressed as 2-(∆∆CT). All

target mRNA data were normalized to villin mRNA for intestinal samples and Gapdh

mRNA for liver and kidney samples.

167

Table 6-1 Mouse primer sets for quantitative Real-Time qPCR

Gene Bank Number Forward (5’→ 3’ Sequence) Reverse (5’→ 3’ Sequence)

Cyp7a1 NM_007824 AGCAACTAAACAACCTGCCAGTACTA GTCCGGATATTCAAGGATGCA

Cyp24 NM_009996 CTGCCCCATTGACAAAAGGC CTCACCGTCGGTCATCAGC

Mdr1 NM_011076 TACGACCCCATGGCTGGATC GGTAGCGAGTCGATGAACTG

TRPV6 NM_022413 ATCGATGGCCCTGCCAACT CAGAGTAGAGGCCATCTTGTTGCTG



168

6.4 RESULTS

6.4.1 Plasma Concentration of 1,25(OH)2D3 and Calcium in Single and Multiple

Doses of 1,25(OH)2D3 in Mice

Fig. 6-1 shows the plasma concentration-time profiles of 1,25(OH)2D3 and calcium

after a single dose or multiple i.p. doses of 2.5 µg/kg of 1,25(OH)2D3 to mice. A

monoexponential decay of 1,25(OH)2D3 was noted in the plasma 1,25(OH)2D3

concentration-time profile (Fig. 6.1A). For the single dose treatment, the plasma

1,25(OH)2D3 level was similar to basal level at one day after injection, but fell below the

basal level after two days and returned to the basal level eight days after 1,25(OH)2D3

administration. The calcium concentration rose above basal levels on Day 1 after treatment,

but fell below basal level 2 days after treatment (Fig. 6-1A), and returned to basal level on

the eighth day.

For multiple dose administration, plasma 1,25(OH)2D3 concentrations peaked around

60 nM 0.5 h after each injection and fell below the basal level at the end of each dosing

period (Fig. 6-1B), possibly due to induction of Cyp24 (see Fig. 6.3 later). The

concentrations of 1,25(OH)2D3 at the nadir fell below the corresponding control (basal) level,

and this pattern persisted throughout the dosing regimen. The plasma calcium concentration

peaked one day after dosing, but decreased to basal levels thereafter (Fig. 6-1B). The pattern

was similar after subsequent injections, with the peak calcium concentrations about 11%-

50% above the basal level after subsequent administrations. The increase in calcium was

about 10% above the basal level at two days after the last injection. The calcium exposure

[AUC(0→8days)] in the 1,25(OH)2D3-treated mice was 100.8 mg/dl•day compared to control,

84.2 mg/dl•day.

169

Because it is recognized that the 1,25(OH)2D3 concentrations subsequent to i.p.

administration is the sum of the basal and exogenously derived 1,25(OH)2D3, a very

simplistic approach was taken to address the question of increased 1,25(OH)2D3 metabolism

due to increased Cyp24. The pharmacokinetics of 1,25(OH)2D3, based on the total

1,25(OH)2D3 (exogenous + basal) concentration after the administered 1,25(OH)2D3 differed

slightly after each injection. The elimination rate constant (k) was 0.282 h-1 with an

elimination half life of 2.46 h after the first dose, and this was increased to 0.339 h-1 with a

Time (Day)

0 2 4 6 8

Cal

cium

Con

cent

ratio

n (m

g/dl

)

0

5

10

15

20

Vehicle Control1,25(OH)2D3

Plasma

Time (Day)

0 2 4 6 8 10 12 14 16

Cal

cium

Con

cent

ratio

n (m

g/dl

)

0

5

10

15

20


Plasma

Time (Day)

0 2 4 6 8 10 12 14 16

1,25

(OH

) 2D

3 C

once

ntra

tion

(pM

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Plasma

Time (Day)

0 2 4 6 8

1,25

(OH

) 2D

3 C

once

ntra

tion

(pM

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Plasma

Figure 6-1 Plasma 1,25(OH)2D3 and calcium concentration-time profiles after (A) a single dose or (B) multiple doses of 2.5 µg/kg i.p. 1,25(OH)2D3 or vehicle to mice. Data from vehicle-treated mice were denoted as open circles, whereas those from 1,25(OH)2D3-treated mice were denoted as solid circles.

(A) (B)

170

decreased half life of 2.05 h for the last dose (Table 6-2). The plasma AUC0-48 (243 vs. 183

nM•h) was decreased after the last dose compared to the first dose (Table 6-2).

Table 6-2 Pharmacokinetic parameters of 1,25(OH)2D3 in mice Doses of 2.5 µg/kg 1,25(OH)2D3

1st Dose 2nd Dose 3rd Dose 4th Dose Plasma elimination rate constant, k (h-1) 0.282 0.291 0.253 0.339 Plasma elimination half-life, t1/2 (h) 2.46 2.38 2.74 2.05 Plasma AUC0-48 (pM*h) 243638 145949 173266 183626

6.4.2 Tissue Concentrations of 1,25(OH)2D3 in Single and Multiple Doses of

1,25(OH)2D3 in Mice

Fig. 6-2 illustrates the tissue concentrations (ileum, liver, kidney, and brain) of

1,25(OH)2D3- and calcium-concentration time profiles after a single intraperitoneal (Fig. 6-

2A) and multiple (Fig. 6-2B) doses of 2.5 µg/kg of 1,25(OH)2D3 to mice. Similar to the

plasma concentration-time profile, a parallel, monoexponential decay of 1,25(OH)2D3 was

observed in each tissue (ileum, liver, kidney, and brain). The single, i.p. 1,25(OH)2D3

injection to mice did not result in a drastic lowering of 1,25(OH)2D3 concentrations at the

nadir in tissues below the basal level for the multiple doses, except in the liver, where the

nadir dipped slightly below basal levels on the 2nd day but returned to basal level on the 4th

day after administration (Fig. 6-2A). Multiple doses of 1,25(OH)2D3 resulted in

1,25(OH)2D3 tissue levels similar to those in plasma after each injection for all tissues (Fig.

6-2B). However, the half lives of the exogenously administered 1,25(OH)2D3 seemed to be

generally faster (14-26%) in all tissues after the fourth dose compared to after the first dose.

171

6.4.3 Comparison of Renal Cyp24 mRNA and Protein in a Single or Multiple Doses

of 1,25(OH)2D3 in Mice

Cyp24 is the major catabolic enzyme that degrades 1,25(OH)2D3 (Jones et al., 1998).

Administration of 1,25(OH)2D3 to mice increased Cyp24 mRNA and protein levels by 80-

fold at 1 hand 27-fold at 12 h after a single dose injection (Fig. 6-3A). The increase in

mRNA peaked at around 3 h whereas the protein expression peaked at 12 h, and remained

above basal levels for at least 8 and 16 days, respectively (Fig. 6-3A). Similar patterns were

observed for multiple doses of 1,25(OH)2D3 to mice that showed high increases in renal

Cyp24 mRNA and protein levels, with expressions that were 40 and 5-fold those of the basal

level, respectively, at the end of the treatment period (Fig. 6-3B).

6.4.4 Temporal Changes in Ileal Cyp24, TRPV6 and FGF15, Liver Cyp24, Cyp7a1

and SHP, and Renal Cyp24, Mdr1 and TRPV6 mRNA Expressions after

Multiple Doses of 1,25(OH)2D3 in Mice

Fig. 6-4 illustrates the temporal effect of VDR on target genes in different tissues

after the multiple doses of 1,25(OH)2D3. There was no difference in the basal expression of

ileal Cyp24 and TRPV6, liver Cyp24, and renal Mdr1 and TRPV6 mRNA from 0 to 12 h

after injection of vehicle to control mice, likely due to the absence of circadian rhythms (Fig.

6-4). However, a circadian rhythm was observed in the liver Cyp7a1 mRNA, increasing to

20-fold during the first 12th hours after vehicle treatment, then later returning to basal level

(Fig. 6-4B).

In the ileum, the increase in Cyp24 mRNA expression peaked at approximately 6 h

after each 1,25(OH)2D3 injection, and the mRNA returned to baseline after 1 day (Fig. 6-4A).

Similarly, TRPV6 expression increased at approximately 9 h after each dose, and the mRNA

172

returned to baseline after one day, with subsequent increases being dramatically higher

(about 500-fold) after the 3rd injection compared to the first and second injections (Fig. 6-

4A). Induction of Cyp24 mRNA in the liver was observed at 3 h after each 1,25(OH)2D3

injection and levels returned to basal level after a day (Fig. 6-4B).

An increase in renal Mdr1 mRNA was seen at the beginning of the 2nd injection, and

the induction remained over 6-fold till the end of the experiment (Fig. 6-4C). Similar to the

data from ileum, the increase of renal TRPV6 mRNA was observed 6 to 9 h after each

treatment, and the induction was increased no more than 13-fold (Fig. 6-4C). The increase in

renal TRPV6 remained above baseline until 24 to 48 h after each injection of 1,25(OH)2D3.

The patterns for intestinal FGF15 and hepatic SHP were erratic (Figs. 6-4A and 6-4B), and,

due to the known instability of their expression shown in the control mouse during the

vehicle treatment period, no conclusion could be made in regard to the data from the

1,25(OH)2D3- treated group.

173

Time (Day)

0 2 4 6 8 10 12 14 161,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Ileum

Time (Day)

0 2 4 6 81,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Ileum

Time (Day)

0 2 4 6 8 10 12 14 161,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Liver

Time (Day)

0 2 4 6 81,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Liver

Time (Day)

0 2 4 6 8 10 12 14 161,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Kidney

Time (Day)

0 2 4 6 81,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Kidney

Time (Day)

0 2 4 6 81,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Brain

Time (Day)

0 2 4 6 8 10 12 14 161,25

(OH

) 2D

3 C

once

ntra

tion

(pm

ol/g

)

0.0001

0.001

0.01

0.1

1

10

100

1000

10000

100000

1000000


Brain

1,25

(OH

) 2D

3C

on

cen

trat

ion

(p

mo

l/g

)

1,25

(OH

) 2D

3C

on

cen

trat

ion

(p

mo

l/g

)

Figure 6-2 Tissue 1,25(OH)2D3 (ileum, liver, kidney, and brain) concentration-time profile from (A) a single dose or (B) multiple doses of 2.5 µg/kg i.p. 1,25(OH)2D3 to mice. Data from vehicle treated mice were denoted as open circle while those from 1,25(OH)2D3 treated mice were denoted as solid circle

(A) (B)

174

The induction of liver Cyp7a1 mRNA levels after the first dose of 1,25(OH)2D3 were

higher than those control Cyp7a1 levels that showed a circadian rhythm (Fig. 6-4B); a more

drastic increase of liver Cyp7a1 mRNA was observed 12 h after the 2nd and 4th injections (60

and 80-fold). In fact, a 13-fold increase in liver Cyp7a1 mRNA expression was attained at

48 h after the last injection.

Time (Day)

0 2 4 6 8Rel

ativ

e R

enal

Cyp

24 m

RN

A E

xpre

ssio

n

0

20

40

60

80

100Vehicle Control1,25(OH)2D3

0

Kidney

Time (Day)

0 2 4 6 8 10 12 14 16Rel

ativ

e R

enal

Cyp

24 m

RN

A E

xpre

ssio

n

0

20

40

60

80

100


0

Kidney

Time (Day)

0 2 4 6 8Rel

ativ

e R

enal

Cyp

24 P

rote

in E

xpre

ssio

n

0

5

10

15

20

25

30


0

Kidney

Time (Day)

0 2 4 6 8 10 12 14 16Rel

ativ

e R

enal

Cyp

24 P

rote

in E

xpre

ssio

n

0

5

10

15

20

25

30


0

Kidney

(A) (B)

Figure 6-3 Renal Cyp24 mRNA and protein expression after (A) a single dose or (B) multiple doses of 2.5 µg/kg i.p. of 1,25(OH)2D3 to mice. Data from vehicle treated mice were denoted as open circle, whereas those from 1,25(OH)2D3 treated mice were denoted as solid circle

175

(A) (B) (C)

Figure 6-4 mRNA expression of (A) ileal Cyp24, TRPV6 and FGF15, (B) hepatic Cyp24, Cyp7a1 and SHP, and (C) renal Cyp24, Mdr1 and TRPV6 after multiple doses of 2.5 µg/kg i.p. of 1,25(OH)2D3 to mice. Data from vehicle treated mice were noted as open circles while those from 1,25(OH)2D3 treated mice were augmented as solid circles

Time (Day)

0 2 4 6 8Rel

ativ

e Ile

al C

yp24

mR

NA

Exp

ress

ion

0

100

200

300

400

500


0

Ileum

Time (Day)

0 2 4 6 8Rel

ativ

e Li

ver

Cyp

7a1

mR

NA

Exp

ress

ion

0

20

40

60

80


0

Liver

Time (Day)

0 2 4 6 8Rel

ativ

e Li

ver

Cyp

24 m

RN

A E

xpre

ssio

n

0

20

40

60

80

100

120

140

160

180


0

Liver

Tim e (Day)

0 2 4 6 8Rel

ativ

e Ile

al T

RP

V6

mR

NA

Exp

ress

ion

0

100

200

300

400

500

600

700


0

Ileum

Time (Day)

0 2 4 6 8Rel

ativ

e R

enal

Cyp

24 m

RN

A E

xpre

ssio

n

0

20

40

60

80


0

Kidney

Time (Day)

0 2 4 6 8Rel

ativ

e Li

ver

SH

P m

RN

A E

xpre

ssio

n

0.0

0.2

0.4

0.6

0.8

1.0

1.2Vehicle Control1,25(OH)2D3

0

Liver

Time (Day)

0 2 4 6 8Rel

ativ

e Il

eal F

GF

15

mR

NA

Exp

ress

ion

0 .0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

1.6

1.8 Vehicle Control1,25(OH)2D3

0

Ileum

Time (Day)

0 2 4 6 8Rel

ativ

e R

enal

Mdr

1 m

RN

A E

xpre

ssio

n

0

2

4

6

8

10

12

14

16


0

Kidney

Time (Day)

0 2 4 6 8

Rel

ativ

e R

enal

TR

PV

6 m

RN

A E

xpre

ssio

n

0

2

4

6

8

10

12

14


0

Kidney

176

6.5 DISCUSSION

In this study, we examined the plasma and tissue concentration-time profiles of

1,25(OH)2D3 and the pharmacokinetic changes after a single vs. multiple dosing schedule.

We appraised whether the 1,25(OH)2D3 tissue concentrations relate to changes in gene

expressions in the ileum, liver, and kidney. Pharmacokinetic parameters of exogenously

administered 1,25(OH)2D3 differed between the 1st and last injections (Table 6-1) due to

induction of Cyp24 expression in ileum, liver, and kidney (Figs. 6-2 and 6-4). Cyp24 is an

enzyme that metabolizes 1,25(OH)2D3 to inactive forms, 1,24,25-trihydroxyvitamin D3 and

25-hydroxyvitamin D3 to 24,25-dihydroxyvitamin D3 (Jones et al., 1998). The increase in

Cyp24 resulted in enhanced 1,25(OH)2D3 elimination and larger rate constants and shorter

half-lives (Table 6-1). Although the fold-induction of Cyp24 mRNA in ileum was higher

than that in the kidney, the increase in ileal Cyp24 was less sustainable compared to that in

kidney, perhaps due to the higher turnover rate of Cyp24 in enterocytes (Ferraris et al.,

1992; Bonventre, 2003). As a result, the rise in renal Cyp24 mRNA and protein levels was

maintained for at least one week. Because the kidney is considered the major organ for the

elimination of 1,25(OH)2D3, the increase in Cyp24 from multiple dosing of exogenous

1,25(OH)2D3 increased the total body clearance significantly after the fourth dose.

1,25(OH)2D3 was found in intestine, liver, kidney, and brain. 1,25(OH)2D3 is

lipophilic, but is tightly bound to the vitamin D binding protein (DBP) in plasma (Dusso et

al., 2005). Despite this binding, the present study showed that exogenous 1,25(OH)2D3

distributes quite non-discriminately into tissues that contain either low or high expression

of VDR. In addition, the concentration of 1,25(OH)2D3 in these tissues remained above

177

basal levels over a long period of time, suggesting that treatment with 1,25(OH)2D3 could

result in sustainable pharmacological effects in these tissues.

The mRNA of VDR target genes in the intestine, liver, and kidney, altered by

administration of 1,25(OH)2D3, were parallel to changes in the tissue concentrations of

1,25(OH)2D3. As seen in Figs. 6-3 and 6-4, induction of ileal and renal Cyp24 and TRPV6,

known VDR targets (Meyer et al., 2007), occurred 3 to 6 h after each dose of 1,25(OH)2D3,

with tissue concentrations of 1,25(OH)2D3 being much higher than that of the baseline. The

peak 1,25(OH)2D3 tissue concentrations in ileum and kidney occurred at approximately 1 to

3 h after dosing, a few h prior to the observed induction of Cyp24 and Cyp7a1 mRNA. The

delay could be due to the time needed for translocation of VDR into the nucleus and

heterodimization with RXRα to initiate the increase in transcription. Fan et al. (2009) also

reported that CYP3A4 mRNA in Caco-2 cells was highly induced with a longer time

exposure of 1,25(OH)2D3. This was presently mirrored in our studies by the increase of

renal Mdr1 mRNA, whose induction was sustained for 2 days after each injection, and the

magnitude of induction depended on the number of doses given and the frequency.

Data on the induction of liver Cyp24 mRNA in Fig. 6-4B infers that there is VDR

activation in the liver after 1,25(OH)2D3 administration. Similarly, Cyp7a1 mRNA was

induced after each dosing interval. Although a circadian rhythm of Cyp7a1 was observed,

as did others (Gielen et al., 1975), the higher increase in Cyp7a1 (60 to 80-fold) among the

treated mice compared to controls at 12 h, suggests that the higher Cyp7a1 mRNA was not

due to circadian rhythm. Activation of Cyp7a1 by VDR was previously found in vivo to

involve direct inhibition of hepatic SHP (Chapter 5). Thus, the steps for VDR activation of

178

Cyp7a1 are reliant on the time needed for VDR to decrease hepatic SHP, which in turn,

leads to increased Cyp7a1 expression.

In conclusion, this study conclusively shows that 1,25(OH)2D3 administration to

mice increased the tissue levels of 1,25(OH)2D3 and increased the expression of VDR

target genes. Chronic dosing of 1,25(OH)2D3, resulted in an increase in 1,25(OH)2D3

clearance, due to increased Cyp24 expression in all tissues, especially in the kidney, to

degrade 1,25(OH)2D3. However, the increase in elimination did not significantly lower

1,25(OH)2D3 tissue concentrations compared to baseline levels, suggesting that

1,25(OH)2D3 treatment could maintain sustainable concentrations of 1,25(OH)2D3 in tissues

to activate the VDR, and regulate VDR target genes.

6.6 ACKNOWLEDGMENTS


Grant [MOP89850]. Edwin C.Y. Chow was supported by the University of Toronto Open

Fellowship and the National Sciences and Engineering Research Council of Canada

Alexander Graham Bell Canada Graduate Scholarship (NSERC-CGS). We like to thank

Dennis Wagner for his support in the project.


In this chapter, plasma and tissue (ileum, liver, kidney, and brain) concentrations of

1,25(OH)2D3, when given every two days, were quantified and correlated to gene changes

in tissues. The resultant concentrations of 1,25(OH)2D3 in tissues were much higher than

basal levels. However, the pharmacokinetic parameters of 1,25(OH)2D3 were changed in

the multiple dosing scheme due to induction of the enzyme, Cyp24, that is present mostly

179

in the kidney. However, concentrations of 1,25(OH)2D3 in tissues remained above baseline

throughout the treatment period. Changes in VDR target genes such as Cyp24, TRPV6,

Mdr1 and Cyp7a1 correlated well to 1,25(OH)2D3 concentrations in tissues. This study

conclusively shows that the induction of VDR target genes depends on tissue

concentrations of 1,25(OH)2D3 and the duration of treatment.

In the study, I performed the administration of 1,25(OH)2D3 to mice, tissue

harvesting, mRNA and protein analyses, tissue lipid extraction, 1,25(OH)2D3 analyses in

plasma and tissue and calcium analyses.

180

CHAPTER 7

7. GENERAL DISCUSSION AND CONCLUSIONS

181

Transporters and enzymes are important proteins that determine the biological fates

of both endogenous molecules such as hormones, bile acids, and cholesterol as well as

exogenous molecules, such as xenobiotics and their metabolites. In the past two decades,

studies have shown that transcription factors, which are activated nuclear receptors,

regulate the levels of transporters and enzymes and control the balance of endogenous and

exogenous molecules in the body (Tirona and Kim, 2005; Tirona, 2011). However, the

expression of various nuclear receptors varies among the organs and different species, and

thus, changes in transporter and enzyme levels resulting from the administration of a

nuclear receptor ligand differ in different organs and species.

The vitamin D receptor (VDR), a member of the nuclear receptor 1 superfamily,

exhibits significant homology with the xenobiotic nuclear receptors, the pregnane X

receptor (PXR) and the constitutive androstane receptor (CAR), and is found to be an

important regulator of transporters and enzymes (Reschly and Krasowski, 2006; Zöllner

and Trauner, 2009). VDR is present abundantly in rat intestine and kidney (Sandgren et al.,

1991), and much less exists in liver (Gascon-Barré et al., 2003) where the VDR exists

mostly in stellate and Kupffer cells, endothelial cells, and cholangiocytes. However, the

VDR is in human hepatocytes and mouse liver (Gascon-Barré et al., 2003; Han and Chiang,

2009; Khan et al., 2009b). Recently, the VDR was suggested to be as an important bile acid

sensor, due to its ability to control the balance of bile acids by regulating enzymes for

detoxification and synthesis, as well as transporters for uptake and secretion. This

dissertation examined the role of the VDR in drug disposition and cholesterol metabolism

in different organs and species in vivo.

182

In Chapter 3, we examined the direct and indirect role of the VDR in the rat

intestine, liver, and kidney in vivo (Fig. 7-1) (Chow et al., 2009; Chow et al., 2010). We

first investigated the expression of VDR in tissues in which the VDR is highly expressed -

intestine and kidney – as well as in liver, in which VDR is poorly expressed (Fig. 3-1). The

tissue abundance of VDR observed were similar to those of previous studies (Sandgren et

al., 1991). We also examined the mRNA and protein expression of enzymes and

transporters in tissues and showed that induction of known VDR target genes was different

in various tissues and organs. Rat Cyp3a1, Cyp3a2, and Cyp3a9, isoforms of human

CYP3A4, were increased by 1,25(OH)2D3 in a tissue-specific manner: Cyp3a1 in intestine,

Cyp3a2 in liver, and Cyp3a9 in kidney (Chapter 3). Efflux transporters such as Mrp2, Mrp3,

Mrp4 were induced with 1,25(OH)2D3 only in the proximal segments of the intestine (Figs.

3-8, 3-9, and 3-10), and these are speculated to be non-genomic, VDR effects (Chow et al.,

2010). In addition, activation of VDR in the intestine stimulates secondary, FXR effects in

intestine and liver. Previously, our laboratory demonstrated that intestinal Asbt in the ileum

was induced by VDR activation, which increased bile acid reabsorption from the rat

intestine (Chen et al., 2006). Bile acids, which are FXR ligands, can trigger a negative

feedback mechanism to decrease cholesterol metabolism in liver by downregulating the

expression of liver Cyp7a1, the rate limiting enzyme for cholesterol metabolism (Goodwin

et al., 2000; Lu et al., 2000). Chapter 3 reported that 1,25(OH)2D3 induction of rat ileal

Asbt stimulated the reabsorption of bile acids from the intestine (Chow et al., 2009). As a

result, increased FXR target genes was observed in the intestine and liver, including

intestinal FGF15, a hormonal signaling molecule that activates FGFR4 in liver, and hepatic

SHP, a transcription factor, which are both negative regulators of Cyp7a1. P-gp, which is

183

known to be induced by activated VDR in Caco-2 cells (Fan et al., 2009), was found to be

increased in the rat kidney and liver (Chapter 3) (Chow et al., 2010). Due to the presence of

VDR and FXR in intestine, liver (very low), and kidney, the induction of Mdr1/P-gp is

likely to be attributed to FXR and not VDR activation. This aspect was clarified with us of

fxr knockout animals (Chapter 4).

Figure 7-1 Summary of nuclear receptor, transporter and enzyme changes in intestine, liver, and kidney

of rats treated with 1,25(OH)2D3

In Chapter 4, we used FXR knockout [fxr(-/-)] mice to discriminate whether the

regulation of P-gp is via the activation of VDR or FXR, and assessed the impact of P-gp

changes on drug disposition in the body (Chow et al., 2011a). We showed that there was no

change in intestinal and liver P-gp, and observed induction of P-gp in the kidney and brain

Hepatocyte Renal Epithelium

Blood

Urine

↑FXR; SHP

↓Cyp7a1

↑Cyp3a9

↑Cyp24

Enterocyte

↑Asbt↑Asbt↔P-gp↔P-gp↑Mrp2↑Mrp2

↑Mrp3↑Mrp3

Lumen

↑Mrp4↑Mrp4

↔Oatp*↔Oatp*

↔Ntcp↔Ntcp

↔Mrp3↔Mrp3

↔Mrp4↔Mrp4

↔Mrp3↔Mrp3

↔Mrp2↔Mrp2

↑P-gp↑P-gp

↑Bsep↑Bsep

↑Asbt↑Asbt

↑P-gp↑P-gpBile

Portal Vein

Enterocyte

Induction

Inhibition

mRNA

↓FXR; SHP

protein

↑VDR

↑FGF15; SHP↑Cyp3a1

↑Cyp3a2

184

after 1,25(OH)2D3 administration in both fxr(+/+) and fxr(-/-) mice, suggesting that the

induction is independent of FXR. We then evaluated the change in P-gp function with the

use of a whole body, physiologically-based pharmacokinetics (PBPK) model after

administrating a bolus dose of [3H]digoxin, a P-gp substrate, to 1,25(OH)2D3-treated

fxr(+/+) mice. We fitted the data to a model and showed that the intrinsic secretory

clearances of the kidney and brain were indeed increased by 1,25(OH)2D3. Although the

renal intrinsic secretory clearance was increased about 3.5-fold, the apparent total body and

renal clearances were increased only 34% and 74%, respectively. We further demonstrated

by simulations that, despite the sharp increase in the renal intrinsic secretory clearance,

there was only minimal impact on the overall total body and renal clearance since digoxin

reabsorption was high (Chow et al., 2011a). Chapter 4 reported mechanistically on the

impact of P-gp changes by VDR to overall changes in drug disposition.

There remains the uncertainty on whether activation of the VDR increases or

decreases cholesterol metabolism in the liver in vivo. The role of VDR in regulating

CYP7A1 remains controversial across different animal species. Previous results illustrate in

rat liver, which consists of very low VDR expression, decreased Cyp7a1 resulted with

1,25(OH)2D3 treatment indirect via the Asbt-FXR mechanism (Chapter 3) (Chow et al.,

2009). When the direct VDR and FXR effects were investigated directly, in absence of the

contribution of the intestine, in rat liver slices (Khan et al., 2009b; Khan et al., 2011),

rCyp7a were found to be unaffected by 1,25(OH)2D3 treatment (unpublished data) due to

the low protein level of VDR in rat liver. In studies utilizing human hepatocytes and

HepG2, where VDR was shown to be present, showed a decrease (Han and Chiang, 2009)

or a potential increase in CYP7A1 (Honjo et al., 2006) with 1,25(OH)2D3 treatment. Also

185

Han and Chiang (2009) showed that deletion of the bile acids response elements (BAREs)

abolished the inhibitory effect of VDR on CYP7A1. But the study overlooked the potential

interaction of VDR on other nuclear receptors such as FXR, SHP, and LRH-1, which may

further result in changes in CYP7A1. In mice, Makishima’s group found that treatment of

high doses of 1-hydroxyvitamin D3, a vitamin D analog, resulted in an upregulation of

mCyp7a1 mRNA (Nishida et al., 2009; Ogura et al., 2009), findings that are similar to ours

in Chapter 5. Hence, we suggest that the Cyp7a1 downregulation observed in mice given a

single, high 1,25(OH)2D3 dose (Schmidt et al., 2010) to be attributed to the extremely high

dose given, and the time-course in the determination of Cyp7a1 changes could be a

contributing factor to the difference of induction vs. downregulation among the data. In

Chapter 6, we unequivocally showed that induction of Cyp7a1 by the VDR had indeed

occurred under our low and protracted dosing regimen used for 1,25(OH)2D3 treatment.

Moreover, the observational Cyp7a1 changes in papers such as Schmidt et al. (2010)

differed in doses compared to our study and failed to conclusively show whether the

mRNA changes observed were due to VDR or FXR, or whether these changes could affect

Cyp7a1 protein and cholesterol levels. Moreover, the level of toxicity under high doses of

1,25(OH)2D3 on nuclear receptor responses need to be further clarified.

Thus, in Chapter 5, we selected the use of fxr(+/+) and fxr(-/-) mice to differentiate

between the FXR vs. VDR effects, in order to isolate the VDR effects from those of FXR in

vivo. We examined the amount of VDR in different tissues in mice and found that VDR

mRNA in mouse liver was similar to that in humans and was higher than that in rat.

Surprisingly, Cyp7a1 was increased by 1,25(OH)2D3 in both fxr(+/+) and fxr(-/-) groups,

which indicates that the induction of Cyp7a1 is independent of FXR. To investigate the

186

molecular mechanism of Cyp7a1 induction, we found that hepatic SHP mRNA expression

was decreased in both fxr(+/+) and fxr(-/-) mice treated with 1,25(OH)2D3. A strong,

negative correlation was observed between liver Cyp7a1 and SHP mRNA from individual

mouse samples. In addition, primary mouse hepatocyte data showed similar increases in

Cyp7a1 and decreases in SHP mRNA expression after 1,25(OH)2D3 incubation for 9 h.

These results suggest that VDR plays a direct role in liver, and the decrease in SHP is

responsible for the increase in Cyp7a1 expression. Further in Chapter 5, we showed that

VDR activation, downregulated mouse and human SHP promoter activities using luciferase

assays, and that truncation of the human SHP promoter abolished this inhibition. We also

showed that a putative VDRE region (-283) was found in the human SHP promoter

responsible for VDR binding and its inhibitory effect. In addition, Chapter 5 revealed that

VDR activation in vivo lowered plasma and liver cholesterol concentrations though

decreases in hepatic SHP and intestinal FGF15 expression in mouse models, such as fxr(-/-)

mice, and wild-type and shp(-/-) fed a high fat/high cholesterol diet. Finally, data in

Chapter 5 demonstrated that VDR activation in vivo can potentially lower cholesterol in

mice and humans. This was confirmed in human hepatocyte studies that showed CYP7A1

activation after 12 h of incubation with 100 nM 1,25(OH)2D3 (unpublished data, Fan and

Pang).

187

Figure 7-2 VDR increases cholesterol metabolism and lowers cholesterol via repression of hepatic SHP

(major mechanism) and possibly intestinal FGF15 (minor mechanism) in mice

In Chapter 6, we correlated gene changes observed in mice, described in Chapters 4

and 5, to 1,25(OH)2D3 concentrations in plasma and tissues. First, we found that multiple

doses of 1,25(OH)2D3 to mice can increase its own elimination by the induction of Cyp24

in tissues, especially in the kidney. However, 1,25(OH)2D3 concentrations in tissues

remained higher than their basal concentration after 1,25(OH)2D3 administration and that

the induction of Mdr1 in kidney and Cyp7a1 in liver strongly correlated to the timing of

administrated doses and the duration of treatment. The suggested molecular events of these

increases have been previously explained in Chapter 4 and 5. Thus, Chapter 6 illustrates

that VDR related gene changes correlate with the tissue levels of 1,25(OH)2D3.

Liver CholesterolCholesterol

BA

FXRFXR

SHPSHP

Bile

CYP7A1

FGFR4FGFR4

FXRFXR

EnterocytesFGF15

Portal Blood

VDRVDR

VDRVDR

BA

BA

VDRVDR

1,25(OH)2D31,25(OH)2D3

1,25(OH)2D31,25(OH)2D3

188

In conclusion, this thesis reveals that activation of VDR varies between different

organs and tissues. In rats, we showed that specific transporters and enzymes are

upregulated by the VDR in the intestine, liver, and kidney, and that induction of intestinal

Asbt triggered secondary FXR effects in intestine and liver. Transporter changes also

occurred via VDR activation and greatly affected the disposition of digoxin, a P-gp

substrate that displayed altered renal and brain efflux. In mice where higher VDR protein

levels are present in the liver compared to rats, VDR affects liver and intestine VDR targets

by decreasing the negative repressors of Cyp7a1, hepatic SHP and intestinal FGF15, to

lower plasma and liver cholesterol concentrations. These changes correlate to the

concentrations of 1,25(OH)2D3 in these tissues. My dissertation has demonstrated that VDR

activation in vivo displays beneficial effects in the liver to treat hypercholesterolemia and in

the brain to increase the excretion of brain -amyloids, a potential risk factor in Alzheimer's

disease.

Future Directions

We have established that 1,25(OH)2D3 is an effective cholesterol lowering agent, and

the concept may lead to a new therapeutic class of cholesterol lowering drugs with a new

underlying mechanism. Parallel changes need to be established in humans with respect to

cholesterol lowering. There are presently VDR ligands that are vitamin D analogues, and

alternate VDR ligands such as the lithocholic acid derivatives that do not cause

hypercalcemia (Ishizawa et al., 2008). Thus more studies are needed to examine these

compounds or alternate ligands and their potential role in humans. More studies are also

needed to dissect the lipoprotein fraction (LDL vs. HDL) that was lowered in plasma of

mouse in previous studies. In addition, a combination therapy with VDR agonists and

189

statins, such as atorvastatin can be examined to investigate the potential synergistic effect,

because a study has shown that a combination of vitamin D and atorvastatin greatly

increases the lowering of cholesterol (Schwartz, 2009). The proposed combined use of

VDR ligands as adjunct drugs for therapy of hypercholesterolemia may be invaluable in the

prevention and treatment of coronary heart diseases.

190

REFERENCES

Abrahamsson A, Gustafsson U, Ellis E, Nilsson LM, Sahlin S, Bjorkhem I and Einarsson C (2005) Feedback regulation of bile acid synthesis in human liver: importance of HNF-4 for regulation of CYP7A1. Biochem Biophys Res Commun 330:395-399.

Adesnik M, Bar-Nun S, Maschio F, Zunich M, Lippman A and Bard E (1981) Mechanism of induction of cytochrome P-450 by phenobarbital. J Biol Chem 256:10340-10345.

Agellon LB and Cheema SK (1997) The 3'-untranslated region of the mouse cholesterol 7-hydroxylase mRNA contains elements responsive to post-transcriptional regulation by bile acids. Biochem J 328 ( Pt 2):393-399.

Aiba T, Susa M, Fukumori S and Hashimoto Y (2005) The effects of culture conditions on CYP3A4 and MDR1 mRNA induction by 1α,25-dihydroxyvitamin D3 in human intestinal cell lines, Caco-2 and LS180. Drug Metab Pharmacokinet 20:268-274.

Akita H, Suzuki H and Sugiyama Y (2001) Sinusoidal efflux of taurocholate is enhanced in Mrp2-deficient rat liver. Pharm Res 18:1119-1125.

Akita H, Suzuki H and Sugiyama Y (2002) Sinusoidal efflux of taurocholate correlates with the hepatic expression level of Mrp3. Biochem Biophys Res Commun 299:681-687.

Almerighi C, Sinistro A, Cavazza A, Ciaprini C, Rocchi G and Bergamini A (2009) 1,25-dihydroxyvitamin D3 inhibits CD40L-induced pro-inflammatory and immunomodulatory activity in human monocytes. Cytokine 45:190-197.

Alsheikh-Ali AA, Maddukuri PV, Han H and Karas RH (2007) Effect of the magnitude of lipid lowering on risk of elevated liver enzymes, rhabdomyolysis, and cancer: insights from large randomized statin trials. J Am Coll Cardiol 50:409-418.

Anderson PH, Hendrix I, Sawyer RK, Zarrinkalam R, Manavis J, Sarvestani GT, May BK and Morris HA (2008) Co-expression of CYP27B1 enzyme with the 1.5kb CYP27B1 promoter-luciferase transgene in the mouse. Mol Cell Endocrinol 285:1-9.

Andress DL (2006) Vitamin D in chronic kidney disease: a systemic role for selective vitamin D receptor activation. Kidney Int 69:33-43.

Araya Z and Wikvall K (1999) 6-hydroxylation of taurochenodeoxycholic acid and lithocholic acid by CYP3A4 in human liver microsomes. Biochim Biophys Acta 1438:47-54.

Banach-Petrosky W, Ouyang X, Gao H, Nader K, Ji Y, Suh N, DiPaola RS and Abate-Shen C (2006) Vitamin D inhibits the formation of prostatic intraepithelial neoplasia in Nkx3.1;Pten mutant mice. Clin Cancer Res 12:5895-5901.

Bligh EG and Dyer WJ (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37:911-917.

Boggaram V, Funkenstein B, Waterman MR and Simpson ER (1984) Lipoproteins and the regulation of adrenal steroidogenesis. Endocr Res 10:387-409.

Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM and Mangelsdorf DJ (2006) Anatomical profiling of nuclear receptor expression reveals a hierarchical transcriptional network. Cell 126:789-799.

191

Brendel C, Schoonjans K, Botrugno OA, Treuter E and Auwerx J (2002) The small heterodimer partner interacts with the liver X receptor alpha and represses its transcriptional activity. Mol Endocrinol 16:2065-2076.

Brooks EL, Kuvin JT and Karas RH (2010) Niacin's role in the statin era. Expert Opin Pharmacother 11:2291-2300.

Brown AJ, Ritter CS, Holliday LS, Knutson JC and Strugnell SA (2004) Tissue distribution and activity studies of 1,24-dihydroxyvitamin D2, a metabolite of vitamin D2 with low calcemic activity in vivo. Biochem Pharmacol 68:1289-1296.

Brown AJ and Slatopolsky E (2008) Vitamin D analogs: therapeutic applications and mechanisms for selectivity. Mol Aspects Med 29:433-452.

Chandra P, Zhang P and Brouwer KL (2005) Short-term regulation of multidrug resistance-associated protein 3 in rat and human hepatocytes. Am J Physiol Gastrointest Liver Physiol 288:G1252-1258.

Chen F, Ma L, Dawson PA, Sinal CJ, Sehayek E, Gonzalez FJ, Breslow J, Ananthanarayanan M and Shneider BL (2003) Liver receptor homologue-1 mediates species- and cell line-specific bile acid-dependent negative feedback regulation of the apical sodium-dependent bile acid transporter. J Biol Chem 278:19909-19916.

Chen KS and DeLuca HF (1995) Cloning of the human 1,25-dihydroxyvitamin D3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements. Biochim Biophys Acta 1263:1-9.

Chen X, Chen F, Liu S, Glaeser H, Dawson PA, Hofmann AF, Kim RB, Shneider BL and Pang KS (2006) Transactivation of rat apical sodium-dependent bile acid transporter and increased bile acid transport by 1α,25-dihydroxyvitamin D3 via the vitamin D receptor. Mol Pharmacol 69:1913-1923.

Cheng JB, Motola DL, Mangelsdorf DJ and Russell DW (2003) De-orphanization of cytochrome P450 2R1: a microsomal vitamin D 25-hydroxylase. J Biol Chem 278:38084-38093.

Chiang JY (1998) Regulation of bile acid synthesis. Front Biosci 3:d176-193. Chiang JY (2002) Bile acid regulation of gene expression: roles of nuclear hormone

receptors. Endocr Rev 23:443-463. Chiang JY (2003) Bile acid regulation of hepatic physiology: III. Bile acids and nuclear

receptors. Am J Physiol Gastrointest Liver Physiol 284:G349-356. Chiang JY (2004) Regulation of bile acid synthesis: pathways, nuclear receptors, and

mechanisms. J Hepatol 40:539-551. Chiang JY, Kimmel R and Stroup D (2001) Regulation of cholesterol 7α-hydroxylase gene

(CYP7A1) transcription by the liver orphan receptor (LXRα). Gene 262:257-265. Chiang JY, Kimmel R, Weinberger C and Stroup D (2000) Farnesoid X receptor responds

to bile acids and represses cholesterol 7-hydroxylase gene (CYP7A1) transcription. J Biol Chem 275:10918-10924.

Chiang JY and Stroup D (1994) Identification and characterization of a putative bile acid-responsive element in cholesterol 7-hydroxylase gene promoter. J Biol Chem 269:17502-17507.

Chiang KC and Chen TC (2009) Vitamin D for the prevention and treatment of pancreatic cancer. World J Gastroenterol 15:3349-3354.

192

Cho BH (1983) Improved enzymatic determination of total cholesterol in tissues. Clin Chem 29:166-168.

Chow EC, Durk MR, Cummins CL and Pang KS (2011a) 1,25-dihydroxyvitamin D3 upregulates P-glycoprotein via the vitamin D receptor and not farnesoid X receptor in both fxr(-/-) and fxr(+/+) mice and increased renal and brain efflux of digoxin in mice in vivo. J Pharmacol Exp Ther 337:846-859.

Chow EC, Maeng HJ, Liu S, Khan AA, Groothuis GM and Pang KS (2009) 1,25-Dihydroxyvitamin D3 triggered vitamin D receptor and farnesoid X receptor-like effects in rat intestine and liver in vivo. Biopharm Drug Dispos 30:457-475.

Chow EC, Sondervan M, Jin C, Groothuis GM and Pang KS (2011b) Comparative effects of doxercalciferol (1-hydroxyvitamin D2) versus calcitriol (1,25-dihydroxyvitamin D3) on the expression of transporters and enzymes in the rat in vivo. J Pharm Sci 100:1594-1604.

Chow EC, Sun H, Khan AA, Groothuis GM and Pang KS (2010) Effects of 1,25-dihydroxyvitamin D3 on transporters and enzymes of the rat intestine and kidney in vivo. Biopharm Drug Dispos 31:91-108.

Colston KW, Chander SK, Mackay AG and Coombes RC (1992) Effects of synthetic vitamin D analogues on breast cancer cell proliferation in vivo and in vitro. Biochem Pharmacol 44:693-702.

Cong D, Doherty M and Pang KS (2000) A new physiologically based, segregated-flow model to explain route-dependent intestinal metabolism. Drug Metab Dispos 28:224-235.

Cooke NE and Haddad JG (1989) Vitamin D binding protein (Gc-globulin). Endocr Rev 10:294-307.

Cordon-Cardo C, O'Brien JP, Boccia J, Casals D, Bertino JR and Melamed MR (1990) Expression of the multidrug resistance gene product (P-glycoprotein) in human normal and tumor tissues. J Histochem Cytochem 38:1277-1287.

Crestani M, Sadeghpour A, Stroup D, Galli G and Chiang JY (1998) Transcriptional activation of the cholesterol 7α-hydroxylase gene (CYP7A) by nuclear hormone receptors. J Lipid Res 39:2192-2200.

Cucinell SA, Koster R, Conney AH and Burns JJ (1963) Stimulatory Effect of Phenobarbital on the Metabolism of Diphenylhydantoin. J Pharmacol Exp Ther 141:157-160.

Cutolo M, Otsa K, Uprus M, Paolino S and Seriolo B (2007) Vitamin D in rheumatoid arthritis. Autoimmun Rev 7:59-64.

Dawson PA, Hubbert M, Haywood J, Craddock AL, Zerangue N, Christian WV and Ballatori N (2005) The heteromeric organic solute transporter -, Ost-Ost, is an ileal basolateral bile acid transporter. J Biol Chem 280:6960-6968.

Dawson PA, Lan T and Rao A (2009) Bile acid transporters. J Lipid Res 50:2340-2357. Dawson PA and Markovich D (2002) Regulation of the mouse Nas1 promoter by vitamin

D and thyroid hormone. Pflugers Arch 444:353-359. Dean M and Allikmets R (2001) Complete characterization of the human ABC gene family.

J Bioenerg Biomembr 33:475-479. Deeb KK, Trump DL and Johnson CS (2007) Vitamin D signalling pathways in cancer:

potential for anticancer therapeutics. Nat Rev Cancer 7:684-700.

193

DeLuca HF (1988) The vitamin D story: a collaborative effort of basic science and clinical medicine. FASEB J 2:224-236.

den Dekker E, Hoenderop JG, Nilius B and Bindels RJ (2003) The epithelial calcium channels, TRPV5 & TRPV6: from identification towards regulation. Cell Calcium 33:497-507.

Dresser GK, Spence JD and Bailey DG (2000) Pharmacokinetic-pharmacodynamic consequences and clinical relevance of cytochrome P450 3A4 inhibition. Clin Pharmacokinet 38:41-57.

Drocourt L, Ourlin JC, Pascussi JM, Maurel P and Vilarem MJ (2002) Expression of CYP3A4, CYP2B6, and CYP2C9 is regulated by the vitamin D receptor pathway in primary human hepatocytes. J Biol Chem 277:25125-25132.

Drover VA and Agellon LB (2004) Regulation of the human cholesterol 7-hydroxylase gene (CYP7A1) by thyroid hormone in transgenic mice. Endocrinology 145:574-581.

Durk MR, Chan GN, Fung AK, Bendayan R and Pang KS (2011a) The vitamin D receptor increases p-glycoprotein expression, leading to enhanced clearance of p-glycoprotein (p-gp) substrates in rodent and human brain capillary endothelial cell lines. 2011 AAPS Annual Meeting, Washington, DC. Poster#1272.

Durk MR, Chow EC and Pang KS (2011b) Regulation of brain p-glycoprotein (p-gp) by the vitamin D receptor (VDR) leads to reduced accumulation of beta amyloids. 2011 AAPS National Biotechnology Conference, San Francisco, CA. Poster#T2103.

Dusso AS, Brown AJ and Slatopolsky E (2005) Vitamin D. Am J Physiol Renal Physiol 289:F8-28.

Echchgadda I, Song CS, Roy AK and Chatterjee B (2004) Dehydroepiandrosterone sulfotransferase is a target for transcriptional induction by the vitamin D receptor. Mol Pharmacol 65:720-729.

Eloranta JJ, Zair ZM, Hiller C, Hausler S, Stieger B and Kullak-Ublick GA (2009) Vitamin D3 and its nuclear receptor increase the expression and activity of the human proton-coupled folate transporter. Mol Pharmacol 76:1062-1071.

Enomoto H, Hendy GN, Andrews GK and Clemens TL (1992) Regulation of avian calbindin-D28K gene expression in primary chick kidney cells: importance of posttranscriptional mechanisms and calcium ion concentration. Endocrinology 130:3467-3474.

Eyles DW, Smith S, Kinobe R, Hewison M and McGrath JJ (2005) Distribution of the vitamin D receptor and 1 alpha-hydroxylase in human brain. J Chem Neuroanat 29:21-30.

Fan J, Liu S, Du Y, Morrison J, Shipman R and Pang KS (2009) Upregulation of transporters and enzymes by the vitamin D receptor ligands, 1,25-dihydroxyvitamin D3 and vitamin D analogs, in the Caco-2 cell monolayer. J Pharmacol Exp Ther 330:389-402.

Folch J, Lees M and Sloane Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226:497-509.

Forman JP, Giovannucci E, Holmes MD, Bischoff-Ferrari HA, Tworoger SS, Willett WC and Curhan GC (2007) Plasma 25-hydroxyvitamin D levels and risk of incident hypertension. Hypertension 49:1063-1069.

194

Fraser DR and Kodicek E (1970) Unique biosynthesis by kidney of a biological active vitamin D metabolite. Nature 228:764-766.

Fredriksson R, Nordstrom KJ, Stephansson O, Hagglund MG and Schioth HB (2008) The solute carrier (SLC) complement of the human genome: phylogenetic classification reveals four major families. FEBS Lett 582:3811-3816.

Fu GK, Lin D, Zhang MY, Bikle DD, Shackleton CH, Miller WL and Portale AA (1997) Cloning of human 25-hydroxyvitamin D-1 -hydroxylase and mutations causing vitamin D-dependent rickets type 1. Mol Endocrinol 11:1961-1970.

Furster C and Wikvall K (1999) Identification of CYP3A4 as the major enzyme responsible for 25-hydroxylation of 5-cholestane-3,7,12-triol in human liver microsomes. Biochim Biophys Acta 1437:46-52.

Gascon-Barré M, Demers C, Mirshahi A, Neron S, Zalzal S and Nanci A (2003) The normal liver harbors the vitamin D nuclear receptor in nonparenchymal and biliary epithelial cells. Hepatology 37:1034-1042.

Gielen J, Van Cantfort J, Robaye B and Renson J (1975) Rat-liver cholesterol 7-hydroxylase. 3. New results about its circadian rhythm. Eur J Biochem 55:41-48.

Goodwin B, Hodgson E, D'Costa DJ, Robertson GR and Liddle C (2002) Transcriptional regulation of the human CYP3A4 gene by the constitutive androstane receptor. Mol Pharmacol 62:359-365.

Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR, Willson TM and Kliewer SA (2000) A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 6:517-526.

Goodwin B, Watson MA, Kim H, Miao J, Kemper JK and Kliewer SA (2003) Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha. Mol Endocrinol 17:386-394.

Grant DM, Blum M, Beer M and Meyer UA (1991) Monomorphic and polymorphic human arylamine N-acetyltransferases: a comparison of liver isozymes and expressed products of two cloned genes. Mol Pharmacol 39:184-191.

Griffiths NM, Hewick DS and Stevenson IH (1984) The effect of immunization with digoxin-specific antibodies on digoxin disposition in the mouse. Biochem Pharmacol 33:3041-3046.

Guengerich FP (1999) Cytochrome P-450 3A4: regulation and role in drug metabolism. Annu Rev Pharmacol Toxicol 39:1-17.

Guo GL, Lambert G, Negishi M, Ward JM, Brewer HB, Jr., Kliewer SA, Gonzalez FJ and Sinal CJ (2003) Complementary roles of farnesoid X receptor, pregnane X receptor, and constitutive androstane receptor in protection against bile acid toxicity. J Biol Chem 278:45062-45071.

Gupta A, Guyomard V, Zaman MJ, Rehman HU and Myint PK (2010) Systematic review on evidence of the effectiveness of cholesterol-lowering drugs. Adv Ther 27:348-364.

Gupta S, Pandak WM and Hylemon PB (2002) LXR alpha is the dominant regulator of CYP7A1 transcription. Biochem Biophys Res Commun 293:338-343.

195

Gupta S, Stravitz RT, Dent P and Hylemon PB (2001) Downregulation of cholesterol 7-hydroxylase (CYP7A1) gene expression by bile acids in primary rat hepatocytes is mediated by the c-Jun N-terminal kinase pathway. J Biol Chem 276:15816-15822.

Hagenbuch B and Meier PJ (1994) Molecular cloning, chromosomal localization, and functional characterization of a human liver Na+/bile acid cotransporter. J Clin Invest 93:1326-1331.

Hagenbuch B and Meier PJ (2004) Organic anion transporting polypeptides of the OATP/ SLC21 family: phylogenetic classification as OATP/ SLCO superfamily, new nomenclature and molecular/functional properties. Pflugers Arch 447:653-665.

Hamden K, Carreau S, Jamoussi K, Miladi S, Lajmi S, Aloulou D, Ayadi F and Elfeki A (2009) 1,25 dihydroxyvitamin D3: therapeutic and preventive effects against oxidative stress, hepatic, pancreatic and renal injury in alloxan-induced diabetes in rats. J Nutr Sci Vitaminol (Tokyo) 55:215-222.

Han S and Chiang JY (2009) Mechanism of vitamin D receptor inhibition of cholesterol 7-hydroxylase gene transcription in human hepatocytes. Drug Metab Dispos 37:469-478.

Han S, Li T, Ellis E, Strom S and Chiang JY (2010) A novel bile acid-activated vitamin D receptor signaling in human hepatocytes. Mol Endocrinol 24:1151-1164.

Hartman HB, Lai K and Evans MJ (2009) Loss of small heterodimer partner expression in the liver protects against dyslipidemia. J Lipid Res 50:193-203.

Heaney RP, Horst RL, Cullen DM and Armas LA (2009) Vitamin D3 distribution and status in the body. J Am Coll Nutr 28:252-256.

Henry HL and Norman AW (1984) Vitamin D: metabolism and biological actions. Annu Rev Nutr 4:493-520.

Hershberger PA, McGuire TF, Yu WD, Zuhowski EG, Schellens JH, Egorin MJ, Trump DL and Johnson CS (2002) Cisplatin potentiates 1,25-dihydroxyvitamin D3-induced apoptosis in association with increased mitogen-activated protein kinase kinase kinase 1 (MEKK-1) expression. Mol Cancer Ther 1:821-829.

Ho RH, Choi L, Lee W, Mayo G, Schwarz UI, Tirona RG, Bailey DG, Michael Stein C and Kim RB (2007) Effect of drug transporter genotypes on pravastatin disposition in European- and African-American participants. Pharmacogenet Genomics 17:647-656.

Ho RH, Tirona RG, Leake BF, Glaeser H, Lee W, Lemke CJ, Wang Y and Kim RB (2006) Drug and bile acid transporters in rosuvastatin hepatic uptake: function, expression, and pharmacogenetics. Gastroenterology 130:1793-1806.

Hofmann AF (1999) Bile Acids: The Good, the Bad, and the Ugly. News Physiol Sci 14:24-29.

Holick MF (2005) Stay tuned to PXR: an orphan actor that may not be D-structive only to bone. J Clin Invest 115:32-34.

Honjo Y, Sasaki S, Kobayashi Y, Misawa H and Nakamura H (2006) 1,25-Dihydroxyvitamin D3 and its receptor inhibit the chenodeoxycholic acid-dependent transactivation by farnesoid X receptor. J Endocrinol 188:635-643.

Inagaki T, Choi M, Moschetta A, Peng L, Cummins CL, McDonald JG, Luo G, Jones SA, Goodwin B, Richardson JA, Gerard RD, Repa JJ, Mangelsdorf DJ and Kliewer SA

196

(2005) Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2:217-225.

Ishiguro N, Maeda K, Kishimoto W, Saito A, Harada A, Ebner T, Roth W, Igarashi T and Sugiyama Y (2006) Predominant contribution of OATP1B3 to the hepatic uptake of telmisartan, an angiotensin II receptor antagonist, in humans. Drug Metab Dispos 34:1109-1115.

Ishizawa M, Matsunawa M, Adachi R, Uno S, Ikeda K, Masuno H, Shimizu M, Iwasaki K, Yamada S and Makishima M (2008) Lithocholic acid derivatives act as selective vitamin D receptor modulators without inducing hypercalcemia. J Lipid Res 49:763-772.

Javitt NB (1994) Bile acid synthesis from cholesterol: regulatory and auxiliary pathways. FASEB J 8:1308-1311.

Jia L, Ma Y, Rong S, Betters JL, Xie P, Chung S, Wang N, Tang W and Yu L (2010) Niemann-Pick C1-Like 1 deletion in mice prevents high-fat diet-induced fatty liver by reducing lipogenesis. J Lipid Res 51:3135-3144.

Jiang W, Miyamoto T, Kakizawa T, Nishio SI, Oiwa A, Takeda T, Suzuki S and Hashizume K (2006) Inhibition of LXRα signaling by vitamin D receptor: possible role of VDR in bile acid synthesis. Biochem Biophys Res Commun 351:176-184.

Johnson BM, Zhang P, Schuetz JD and Brouwer KL (2006) Characterization of transport protein expression in multidrug resistance-associated protein (Mrp) 2-deficient rats. Drug Metab Dispos 34:556-562.

Jones G, Strugnell SA and DeLuca HF (1998) Current understanding of the molecular actions of vitamin D. Physiol Rev 78:1193-1231.

Juliano RL and Ling V (1976) A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim Biophys Acta 455:152-162.

Jung D, Hagenbuch B, Fried M, Meier PJ and Kullak-Ublick GA (2004) Role of liver-enriched transcription factors and nuclear receptors in regulating the human, mouse, and rat NTCP gene. Am J Physiol Gastrointest Liver Physiol 286:G752-761.

Kamei Y, Kawada T, Fukuwatari T, Ono T, Kato S and Sugimoto E (1995) Cloning and sequencing of the gene encoding the mouse vitamin D receptor. Gene 152:281-282.

Katona BW, Anant S, Covey DF and Stenson WF (2009) Characterization of enantiomeric bile acid-induced apoptosis in colon cancer cell lines. J Biol Chem 284:3354-3364.

Kawahara M, Sakata A, Miyashita T, Tamai I and Tsuji A (1999) Physiologically based pharmacokinetics of digoxin in mdr1a knockout mice. J Pharm Sci 88:1281-1287.

Khan AA, Chow EC, Porte RJ, Pang KS and Groothuis GM (2009a) Expression and regulation of the bile acid transporter, OST-OST in rat and human intestine and liver. Biopharm Drug Dispos 30:241-258.

Khan AA, Chow EC, Porte RJ, Pang KS and Groothuis GM (2011) The role of lithocholic acid in the regulation of bile acid detoxication, synthesis, and transport proteins in rat and human intestine and liver slices. Toxicol In Vitro 25:80-90.

Khan AA, Chow EC, van Loenen-Weemaes AM, Porte RJ, Pang KS and Groothuis GM (2009b) Comparison of effects of VDR versus PXR, FXR and GR ligands on the regulation of CYP3A isozymes in rat and human intestine and liver. Eur J Pharm Sci 37:115-125.

197

Kim RB (2002a) Drugs as P-glycoprotein substrates, inhibitors, and inducers. Drug Metab Rev 34:47-54.

Kim RB (2002b) Transporters and xenobiotic disposition. Toxicology 181-182:291-297. Klaassen CD and Aleksunes LM (2011) Xenobiotic, bile acid, and cholesterol transporters:

function and regulation. Pharmacol Rev 62:1-96. König J, Seithel A, Gradhand U and Fromm MF (2006) Pharmacogenomics of human

OATP transporters. Naunyn Schmiedebergs Arch Pharmacol 372:432-443. Kullak-Ublick GA, Stieger B, Hagenbuch B and Meier PJ (2000) Hepatic transport of bile

salts. Semin Liver Dis 20:273-292. Kutuzova GD and DeLuca HF (2007) 1,25-Dihydroxyvitamin D3 regulates genes

responsible for detoxification in intestine. Toxicol Appl Pharmacol 218:37-44. Lazaridis KN, Pham L, Tietz P, Marinelli RA, deGroen PC, Levine S, Dawson PA and

LaRusso NF (1997) Rat cholangiocytes absorb bile acids at their apical domain via the ileal sodium-dependent bile acid transporter. J Clin Invest 100:2714-2721.

Lee HK, Lee YK, Park SH, Kim YS, Lee JW, Kwon HB, Soh J, Moore DD and Choi HS (1998) Structure and expression of the orphan nuclear receptor SHP gene. J Biol Chem 273:14398-14402.

Lee JH, O'Keefe JH, Bell D, Hensrud DD and Holick MF (2008) Vitamin D deficiency an important, common, and easily treatable cardiovascular risk factor? J Am Coll Cardiol 52:1949-1956.

Lee YK and Moore DD (2002) Dual mechanisms for repression of the monomeric orphan receptor liver receptor homologous protein-1 by the orphan small heterodimer partner. J Biol Chem 277:2463-2467.

Leon C, Sachs-Barrable K and Wasan KM (2006) Does p-glycoprotein play a role in gastrointestinal absorption and cellular transport of dietary cholesterol? Drug Dev Ind Pharm 32:779-782.

Levy G (1980) Effect of plasma protein binding on renal clearance of drugs. J Pharm Sci 69:482-483.

Li YC, Kong J, Wei M, Chen ZF, Liu SQ and Cao LP (2002) 1,25-Dihydroxyvitamin D3 is a negative endocrine regulator of the renin-angiotensin system. J Clin Invest 110:229-238.

Liu L, Cui Y, Chung AY, Shitara Y, Sugiyama Y, Keppler D and Pang KS (2006a) Vectorial transport of enalapril by Oatp1a1/Mrp2 and OATP1B1 and OATP1B3/MRP2 in rat and human livers. J Pharmacol Exp Ther 318:395-402.

Liu S, Tam D, Chen X and Pang KS (2006b) P-glycoprotein and an unstirred water layer barring digoxin absorption in the vascularly perfused rat small intestine preparation: induction studies with pregnenolone-16α-carbonitrile. Drug Metab Dispos 34:1468-1479.

Los EL, Wolters H, Stellaard F, Kuipers F, Verkade HJ and Rings EH (2007) Intestinal capacity to digest and absorb carbohydrates is maintained in a rat model of cholestasis. Am J Physiol Gastrointest Liver Physiol 293:G615-622.

Lowry OH, Rosebrough NJ, Farr AL and Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-275.

Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J and Mangelsdorf DJ (2000) Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 6:507-515.

198

Luker GD, Dahlheimer JL, Ostlund RE, Jr. and Piwnica-Worms D (2001) Decreased hepatic accumulation and enhanced esterification of cholesterol in mice deficient in mdr1a and mdr1b P-glycoproteins. J Lipid Res 42:1389-1394.

Luna-Tortos C, Rambeck B, Jurgens UH and Loscher W (2009) The antiepileptic drug topiramate is a substrate for human P-glycoprotein but not multidrug resistance proteins. Pharm Res 26:2464-2470.

Ma KY, Yang N, Jiao R, Peng C, Guan L, Huang Y and Chen ZY (2011) Dietary calcium decreases plasma cholesterol by downregulation of intestinal Niemann-Pick C1 like 1 and microsomal triacylglycerol transport protein and upregulation of CYP7A1 and ABCG 5/8 in hamsters. Mol Nutr Food Res 55:247-258.

Maeng HJ, Durk MR, Chow EC, Ghoneim R and Pang KS (2011) 1,25-Dihydroxyvitamin D3 on intestinal transporter function: studies with the rat everted intestinal sac. Biopharm Drug Dispos 32:112-125.

Makishima M (2005) Nuclear receptors as targets for drug development: regulation of cholesterol and bile acid metabolism by nuclear receptors. J Pharmacol Sci 97:177-183.

Makishima M, Lu TT, Xie W, Whitfield GK, Domoto H, Evans RM, Haussler MR and Mangelsdorf DJ (2002) Vitamin D receptor as an intestinal bile acid sensor. Science 296:1313-1316.

Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P and Evans RM (1995) The nuclear receptor superfamily: the second decade. Cell 83:835-839.

Marks HD, Fleet JC and Peleg S (2007) Transgenic expression of the human Vitamin D receptor (hVDR) in the duodenum of VDR-null mice attenuates the age-dependent decline in calcium absorption. J Steroid Biochem Mol Biol 103:513-516.

Massheimer V, Boland R and de Boland AR (1994) Rapid 1,25(OH)2-vitamin D3 stimulation of calcium uptake by rat intestinal cells involves a dihydropyridine-sensitive cAMP-dependent pathway. Cell Signal 6:299-304.

Masson D (2009) Anacetrapib, a cholesterol ester transfer protein (CETP) inhibitor for the treatment of atherosclerosis. Curr Opin Investig Drugs 10:980-987.

Masuda S and Jones G (2006) Promise of vitamin D analogues in the treatment of hyperproliferative conditions. Mol Cancer Ther 5:797-808.

McCarthy TC, Li X and Sinal CJ (2005) Vitamin D receptor-dependent regulation of colon multidrug resistance-associated protein 3 gene expression by bile acids. J Biol Chem 280:23232-23242.

Meyer MB, Zella LA, Nerenz RD and Pike JW (2007) Characterizing early events associated with the activation of target genes by 1,25-dihydroxyvitamin D3 in mouse kidney and intestine in vivo. J Biol Chem 282:22344-22352.

Miao J, Xiao Z, Kanamaluru D, Min G, Yau PM, Veenstra TD, Ellis E, Strom S, Suino-Powell K, Xu HE and Kemper JK (2009) Bile acid signaling pathways increase stability of small heterodimer partner (SHP) by inhibiting ubiquitin-proteasomal degradation. Genes Dev 23:986-996.

Morimoto K, Nakakariya M, Shirasaka Y, Kakinuma C, Fujita T, Tamai I and Ogihara T (2008) Oseltamivir (Tamiflu) efflux transport at the blood-brain barrier via P-glycoprotein. Drug Metab Dispos 36:6-9.

199

Mottino AD, Hoffman T, Jennes L and Vore M (2000) Expression and localization of multidrug resistant protein mrp2 in rat small intestine. J Pharmacol Exp Ther 293:717-723.

Nakagawa K, Kawaura A, Kato S, Takeda E and Okano T (2005) 1,25-Dihydroxyvitamin D3 is a preventive factor in the metastasis of lung cancer. Carcinogenesis 26:429-440.

Nehring JA, Zierold C and DeLuca HF (2007) Lithocholic acid can carry out in vivo functions of vitamin D. Proc Natl Acad Sci U S A 104:10006-10009.

Nishida S, Ozeki J and Makishima M (2009) Modulation of bile acid metabolism by 1-hydroxyvitamin D3 administration in mice. Drug Metab Dispos 37:2037-2044.

O'Connell TD, Berry JE, Jarvis AK, Somerman MJ and Simpson RU (1997) 1,25-Dihydroxyvitamin D3 regulation of cardiac myocyte proliferation and hypertrophy. Am J Physiol 272:H1751-1758.

O'Connell TD, Giacherio DA, Jarvis AK and Simpson RU (1995) Inhibition of cardiac myocyte maturation by 1,25-dihydroxyvitamin D3. Endocrinology 136:482-488.

Ogura M, Nishida S, Ishizawa M, Sakurai K, Shimizu M, Matsuo S, Amano S, Uno S and Makishima M (2009) Vitamin D3 modulates the expression of bile acid regulatory genes and represses inflammation in bile duct-ligated mice. J Pharmacol Exp Ther 328:564-570.

Olefsky JM (2001) Nuclear receptor minireview series. J Biol Chem 276:36863-36864. Omura T (1999) Forty years of cytochrome P450. Biochem Biophys Res Commun 266:690-

698. Pang KS, Rodrigues AD, Peter RM and ebrary Inc. (2010) Enzyme- and transporter-based

drug-drug interactions progress and future challenges, pp xviii, 746 p., Springer : American Association of Pharmaceutical Scientists, New York.

Patel J, Pal D, Vangal V, Gandhi M and Mitra AL (2002) Transport of HIV-protease inhibitors across 1,25di-hydroxy vitamin D3-treated Calu-3 cell monolayers: modulation of P-glycoprotein activity. Pharm Res 19:1696-1703.

Peet DJ, Turley SD, Ma W, Janowski BA, Lobaccaro JM, Hammer RE and Mangelsdorf DJ (1998) Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93:693-704.

Pfrunder A, Gutmann H, Beglinger C and Drewe J (2003) Gene expression of CYP3A4, ABC-transporters (MDR1 and MRP1-MRP5) and hPXR in three different human colon carcinoma cell lines. J Pharm Pharmacol 55:59-66.

Racanelli V and Rehermann B (2006) The liver as an immunological organ. Hepatology 43:S54-62.

Radcliffe KA and Campbell WW (2008) Statin myopathy. Curr Neurol Neurosci Rep 8:66-72.

Rahman A, Hershey S, Ahmed S, Nibbelink K and Simpson RU (2007) Heart extracellular matrix gene expression profile in the vitamin D receptor knockout mice. J Steroid Biochem Mol Biol 103:416-419.

Rao A, Haywood J, Craddock AL, Belinsky MG, Kruh GD and Dawson PA (2008) The organic solute transporter α-β, Ostα-Ostβ, is essential for intestinal bile acid transport and homeostasis. Proc Natl Acad Sci U S A 105:3891-3896.

200

Reddy GS and Tserng KY (1989) Calcitroic acid, end product of renal metabolism of 1,25-dihydroxyvitamin D3 through C-24 oxidation pathway. Biochemistry 28:1763-1769.

Reis JP, von Muhlen D, Miller ER, 3rd, Michos ED and Appel LJ (2009) Vitamin D status and cardiometabolic risk factors in the United States adolescent population. Pediatrics 124:e371-379.

Remmer H, Schoene B and Fleischmann RA (1973) Induction of the unspecific microsomal hydroxylase in the human liver. Drug Metab Dispos 1:224-230.

Reschly EJ and Krasowski MD (2006) Evolution and function of the NR1I nuclear hormone receptor subfamily (VDR, PXR, and CAR) with respect to metabolism of xenobiotics and endogenous compounds. Curr Drug Metab 7:349-365.

Rezen T (2011) The impact of cholesterol and its metabolites on drug metabolism. Expert Opin Drug Metab Toxicol 7:387-398.

Rezen T, Rozman D, Pascussi JM and Monostory K (2010) Interplay between cholesterol and drug metabolism. Biochim Biophys Acta 1814:146-160.

Ritter JK (2000) Roles of glucuronidation and UDP-glucuronosyltransferases in xenobiotic bioactivation reactions. Chem Biol Interact 129:171-193.

Russell DW and Setchell KD (1992) Bile acid biosynthesis. Biochemistry 31:4737-4749. Sacchettini JC, Hauft SM, Van Camp SL, Cistola DP and Gordon JI (1990) Developmental

and structural studies of an intracellular lipid binding protein expressed in the ileal epithelium. J Biol Chem 265:19199-19207.

Saeki M, Kurose K, Tohkin M and Hasegawa R (2008) Identification of the functional vitamin D response elements in the human MDR1 gene. Biochem Pharmacol 76:531-542.

Safadi FF, Thornton P, Magiera H, Hollis BW, Gentile M, Haddad JG, Liebhaber SA and Cooke NE (1999) Osteopathy and resistance to vitamin D toxicity in mice null for vitamin D binding protein. J Clin Invest 103:239-251.

Sakuma T, Miyamoto T, Jiang W, Kakizawa T, Nishio SI, Suzuki S, Takeda T, Oiwa A and Hashizume K (2003) Inhibition of peroxisome proliferator-activated receptor signaling by vitamin D receptor. Biochem Biophys Res Commun 312:513-519.

Sandgren ME, Bronnegard M and DeLuca HF (1991) Tissue distribution of the 1,25-dihydroxyvitamin D3 receptor in the male rat. Biochem Biophys Res Commun 181:611-616.

Sarkinen BE (2011) Vitamin D deficiency & cardiovascular disease. Nurse Pract 36:46-53. Schmidt DR, Holmstrom SR, Fon Tacer K, Bookout AL, Kliewer SA and Mangelsdorf DJ

(2010) Regulation of bile acid synthesis by fat-soluble vitamins A and D. J Biol Chem 285:14486-14494.

Schmiedlin-Ren P, Thummel KE, Fisher JM, Paine MF, Lown KS and Watkins PB (1997) Expression of enzymatically active CYP3A4 by Caco-2 cells grown on extracellular matrix-coated permeable supports in the presence of 1α,25-dihydroxyvitamin D3. Mol Pharmacol 51:741-754.

Schmiedlin-Ren P, Thummel KE, Fisher JM, Paine MF and Watkins PB (2001) Induction of CYP3A4 by 1 α,25-dihydroxyvitamin D3 is human cell line-specific and is unlikely to involve pregnane X receptor. Drug Metab Dispos 29:1446-1453.

201

Schoene B, Fleischmann RA, Remmer H and von Oldershausen HF (1972) Determination of drug metabolizing enzymes in needle biopsies of human liver. Eur J Clin Pharmacol 4:65-73.

Schoonjans K and Auwerx J (2002) A sharper image of SHP. Nat Med 8:789-791. Schwartz JB (2009) Effects of vitamin D supplementation in atorvastatin-treated patients: a

new drug interaction with an unexpected consequence. Clin Pharmacol Ther 85:198-203.

Seol W, Choi HS and Moore DD (1996) An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 272:1336-1339.

Sertznig P, Dunlop T, Seifert M, Tilgen W and Reichrath J (2009) Cross-talk between vitamin D receptor (VDR)- and peroxisome proliferator-activated receptor (PPAR)-signaling in melanoma cells. Anticancer Res 29:3647-3658.

Seshadri KG, Tamilselvan B and Rajendran A (2011) Role of Vitamin D in Diabetes. J Endocrinol Metab 1:47-56.

Shneider BL (2001) Intestinal bile acid transport: biology, physiology, and pathophysiology. J Pediatr Gastroenterol Nutr 32:407-417.

Silver J, Moallem E, Kilav R, Epstein E, Sela A and Naveh-Many T (1996) New insights into the regulation of parathyroid hormone synthesis and secretion in chronic renal failure. Nephrol Dial Transplant 11 Suppl 3:2-5.

Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G and Gonzalez FJ (2000) Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 102:731-744.

Sjoden G, Smith C, Lindgren U and DeLuca HF (1985) 1-Hydroxyvitamin D2 is less toxic than 1-hydroxyvitamin D3 in the rat. Proc Soc Exp Biol Med 178:432-436.

Song KH, Li T, Owsley E, Strom S and Chiang JY (2009) Bile acids activate fibroblast growth factor 19 signaling in human hepatocytes to inhibit cholesterol 7α-hydroxylase gene expression. Hepatology 49:297-305.

Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A, Liu Y, Klaassen CD, Brown KK, Reinhard J, Willson TM, Koller BH and Kliewer SA (2001) The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A 98:3369-3374.

Stravitz RT, Hylemon PB, Heuman DM, Hagey LR, Schteingart CD, Ton-Nu HT, Hofmann AF and Vlahcevic ZR (1993) Transcriptional regulation of cholesterol 7-hydroxylase mRNA by conjugated bile acids in primary cultures of rat hepatocytes. J Biol Chem 268:13987-13993.

Szakacs G, Varadi A, Ozvegy-Laczka C and Sarkadi B (2008) The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox). Drug Discov Today 13:379-393.

Tachibana S, Yoshinari K, Chikada T, Toriyabe T, Nagata K and Yamazoe Y (2009) Involvement of Vitamin D receptor in the intestinal induction of human ABCB1. Drug Metab Dispos 37:1604-1610.

Taketani Y, Segawa H, Chikamori M, Morita K, Tanaka K, Kido S, Yamamoto H, Iemori Y, Tatsumi S, Tsugawa N, Okano T, Kobayashi T, Miyamoto K and Takeda E (1998) Regulation of type II renal Na+-dependent inorganic phosphate transporters

202

by 1,25-dihydroxyvitamin D3. Identification of a vitamin D-responsive element in the human NAPi-3 gene. J Biol Chem 273:14575-14581.

Tamashevskii AV, Kozlova NM, Goncharova NV, Zubritskaia GP and Slobozhanina EI (2011) Effect of cholesterol on the functional activity of proteins responsible for the resistance of human lymphocytes to xenobiotics. Biofizika 56:455-464.

Tanaka Y, Frank H and DeLuca HF (1973) Biological activity of 1,25-dihydroxyvitamin D3 in the rat. Endocrinology 92:417-422.

Thompson PD, Jurutka PW, Whitfield GK, Myskowski SM, Eichhorst KR, Dominguez CE, Haussler CA and Haussler MR (2002) Liganded VDR induces CYP3A4 in small intestinal and colon cancer cells via DR3 and ER6 vitamin D responsive elements. Biochem Biophys Res Commun 299:730-738.

Thummel KE, Brimer C, Yasuda K, Thottassery J, Senn T, Lin Y, Ishizuka H, Kharasch E, Schuetz J and Schuetz E (2001) Transcriptional control of intestinal cytochrome P-4503A by 1α,25-dihydroxy vitamin D3. Mol Pharmacol 60:1399-1406.

Tirona RG (2011) Molecular mechanisms of drug transporter regulation. Handb Exp Pharmacol:373-402.

Tirona RG and Kim RB (2005) Nuclear receptors and drug disposition gene regulation. J Pharm Sci 94:1169-1186.

Tirona RG, Lee W, Leake BF, Lan LB, Cline CB, Lamba V, Parviz F, Duncan SA, Inoue Y, Gonzalez FJ, Schuetz EG and Kim RB (2003) The orphan nuclear receptor HNF4alpha determines PXR- and CAR-mediated xenobiotic induction of CYP3A4. Nat Med 9:220-224.

Tishkoff DX, Nibbelink KA, Holmberg KH, Dandu L and Simpson RU (2008) Functional vitamin D receptor (VDR) in the t-tubules of cardiac myocytes: VDR knockout cardiomyocyte contractility. Endocrinology 149:558-564.

Trauner M and Boyer JL (2003) Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev 83:633-671.

Valdivielso JM, Cannata-Andia J, Coll B and Fernandez E (2009) A new role for vitamin D receptor activation in chronic kidney disease. Am J Physiol Renal Physiol 297:F1502-1509.

van Aubel RA, Smeets PH, Peters JG, Bindels RJ and Russel FG (2002) The MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney proximal tubules: putative efflux pump for urinary cAMP and cGMP. J Am Soc Nephrol 13:595-603.

Vanhooke JL, Benning MM, Bauer CB, Pike JW and DeLuca HF (2004) Molecular structure of the rat vitamin D receptor ligand binding domain complexed with 2-carbon-substituted vitamin D3 hormone analogues and a LXXLL-containing coactivator peptide. Biochemistry 43:4101-4110.

Venkatakrishnan K, Von Moltke LL and Greenblatt DJ (2001) Human drug metabolism and the cytochromes P450: application and relevance of in vitro models. J Clin Pharmacol 41:1149-1179.

Vieth R, Kooh SW, Balfe JW, Rawlins M and Tinmouth WW (1990) Tracer kinetics and actions of oral and intraperitoneal 1,25-dihydroxyvitamin D3 administration in rats. Kidney Int 38:857-861.

Wagner M, Zollner G and Trauner M (2010) Nuclear receptor regulation of the adaptive response of bile acid transporters in cholestasis. Semin Liver Dis 30:160-177.

203

Wang JH, Keisala T, Solakivi T, Minasyan A, Kalueff AV and Tuohimaa P (2009) Serum cholesterol and expression of ApoAI, LXR and SREBP2 in vitamin D receptor knock-out mice. J Steroid Biochem Mol Biol 113:222-226.

Wang K, Chen S, Xie W and Wan YJ (2008a) Retinoids induce cytochrome P450 3A4 through RXR/VDR-mediated pathway. Biochem Pharmacol 75:2204-2213.

Wang L, Lee YK, Bundman D, Han Y, Thevananther S, Kim CS, Chua SS, Wei P, Heyman RA, Karin M and Moore DD (2002) Redundant pathways for negative feedback regulation of bile acid production. Dev Cell 2:721-731.

Wang TJ, Pencina MJ, Booth SL, Jacques PF, Ingelsson E, Lanier K, Benjamin EJ, D'Agostino RB, Wolf M and Vasan RS (2008b) Vitamin D deficiency and risk of cardiovascular disease. Circulation 117:503-511.

Wang XX, Jiang T, Shen Y, Santamaria H, Solis N, Arbeeny C and Levi M (2011a) Vitamin D receptor agonist doxercalciferol modulates dietary fat-induced renal disease and renal lipid metabolism. Am J Physiol Renal Physiol 300:F801-810.

Wang Z, Lin YS, Zheng XE, Senn T, Hashizume T, Scian M, Dickmann LJ, Nelson SD, Baillie TA, Hebert MF, Blough D, Davis CL and Thummel KE (2011b) An inducible cytochrome P450 3A4-dependent vitamin D catabolic pathway. Mol Pharmacol. Epub [doi:10.1124/mol.111.076356]

Wu FS, Zheng SS, Wu LJ, Teng LS, Ma ZM, Zhao WH and Wu W (2007) Calcitriol inhibits the growth of MHCC97 heptocellular cell lines by downmodulating c-met and ERK expressions. Liver Int 27:700-707.

Wu J, Garami M, Cheng T and Gardner DG (1996) 1,25(OH)2 vitamin D3, and retinoic acid antagonize endothelin-stimulated hypertrophy of neonatal rat cardiac myocytes. J Clin Invest 97:1577-1588.

Xiang W, Kong J, Chen S, Cao LP, Qiao G, Zheng W, Liu W, Li X, Gardner DG and Li YC (2005) Cardiac hypertrophy in vitamin D receptor knockout mice: role of the systemic and cardiac renin-angiotensin systems. Am J Physiol Endocrinol Metab 288:E125-132.

Xie W, Radominska-Pandya A, Shi Y, Simon CM, Nelson MC, Ong ES, Waxman DJ and Evans RM (2001) An essential role for nuclear receptors SXR/PXR in detoxification of cholestatic bile acids. Proc Natl Acad Sci U S A 98:3375-3380.

Xu Y, Iwanaga K, Zhou C, Cheesman MJ, Farin F and Thummel KE (2006) Selective induction of intestinal CYP3A23 by 1α,25-dihydroxyvitamin D3 in rats. Biochem Pharmacol 72:385-392.

Yagci A, Werner A, Murer H and Biber J (1992) Effect of rabbit duodenal mRNA on phosphate transport in Xenopus laevis oocytes: dependence on 1,25-dihydroxy-vitamin-D3. Pflugers Arch 422:211-216.

Yamagishi K, Yamamoto K, Yamada S and Tokiwa H (2006) Functions of key residues in the ligand-binding pocket of vitamin D receptor: Fragment molecular orbital-interfragment interaction energy analysis. Chemical Physics Letters 420:465-468.

Yamane T, Takeuchi K, Yamamoto Y, Li YH, Fujiwara M, Nishi K, Takahashi S and Ohkubo I (2002) Legumain from bovine kidney: its purification, molecular cloning, immunohistochemical localization and degradation of annexin II and vitamin D-binding protein. Biochim Biophys Acta 1596:108-120.

204

You G and Morris ME (2007) Drug Transporters : Molecular Characterization And Role In Drug Disposition. Wiley-Interscience, Hoboken, N.J.

Yu DK (1999) The contribution of P-glycoprotein to pharmacokinetic drug-drug interactions. J Clin Pharmacol 39:1203-1211.

Yuan W, Pan W, Kong J, Zheng W, Szeto FL, Wong KE, Cohen R, Klopot A, Zhang Z and Li YC (2007) 1,25-dihydroxyvitamin D3 suppresses renin gene transcription by blocking the activity of the cyclic AMP response element in the renin gene promoter. J Biol Chem 282:29821-29830.

Zastre JA, Chan GN, Ronaldson PT, Ramaswamy M, Couraud PO, Romero IA, Weksler B, Bendayan M and Bendayan R (2009) Upregulation of P-glycoprotein by HIV protease inhibitors in a human brain microvessel endothelial cell line. J Neurosci Res 87:1023-1036.

Zhang HL and Wu J (2011) Role of vitamin D in immune responses and autoimmune diseases, with emphasis on its role in multiple sclerosis. Neurosci Bull 26:445-454.

Zhang X, Jiang F, Li P, Li C, Ma Q, Nicosia SV and Bai W (2005) Growth suppression of ovarian cancer xenografts in nude mice by vitamin D analogue EB1089. Clin Cancer Res 11:323-328.

Zhang Y, Hagedorn CH and Wang L (2011) Role of nuclear receptor SHP in metabolism and cancer. Biochim Biophys Acta 1812:893-908.

Zhu Y, Li F and Guo GL (2011) Tissue-specific function of farnesoid X receptor in liver and intestine. Pharmacol Res 63:259-265.

Zierold C, Mings JA and Deluca HF (2006) 19nor-1,25-dihydroxyvitamin D2 specifically induces CYP3A9 in rat intestine more strongly than 1,25-dihydroxyvitamin D3 in vivo and in vitro. Mol Pharmacol 69:1740-1747.

Zollner G, Fickert P, Fuchsbichler A, Silbert D, Wagner M, Arbeiter S, Gonzalez FJ, Marschall HU, Zatloukal K, Denk H and Trauner M (2003) Role of nuclear bile acid receptor, FXR, in adaptive ABC transporter regulation by cholic and ursodeoxycholic acid in mouse liver, kidney and intestine. J Hepatol 39:480-488.

Zöllner G, Marschall HU, Wagner M and Trauner M (2006) Role of nuclear receptors in the adaptive response to bile acids and cholestasis: pathogenetic and therapeutic considerations. Mol Pharm 3:231-251.

205

APPENDIX A1 Khan AA, Chow EC, van Loenen-Weemaes AM, Porte RJ, Pang KS and Groothuis GM (2009) Comparison of effects of VDR versus PXR, FXR and GR ligands on the regulation of CYP3A isozymes in rat and human intestine and liver. Eur J Pharm Sci 37:115-125

European Journal of Pharmaceutical Sciences 37 (2009) 115–125

Contents lists available at ScienceDirect

European Journal of Pharmaceutical Sciences

journa l homepage: www.e lsev ier .com/ locate /e jps

Comparison of effects of VDR versus PXR, FXR and GR ligands on the regulation

of CYP3A isozymes in rat and human intestine and liver

Ansar A. Khana,∗, Edwin C.Y. Chowb, Anne-miek M.A. van Loenen-Weemaesa, Robert J. Portec,K. Sandy Pangb, Geny M.M. Groothuisa

a Pharmacokinetics, Toxicology and Targeting, Department of Pharmacy, University of Groningen, Ant. Deusinglaan 1, 9713 AV, Groningen, The Netherlandsb Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, 144 College Street, Toronto, ON M5S 3M2, Canadac Department of Hepatobiliary Surgery and Liver Transplantation, University Medical Center Groningen (UMCG), University of Groningen, Hanzeplein 1,

9700 RB Groningen, The Netherlands

a r t i c l e i n f o

Article history:

Received 2 December 2008

Received in revised form 19 January 2009

Accepted 20 January 2009

Available online 30 January 2009

Keywords:

Cytochrome P450

Induction

Intestinal slices

Liver slices

1�,25-Dihydroxyvitamin D3

a b s t r a c t

In this study, we compared the regulation of CYP3A isozymes by the vitamin D receptor (VDR) ligand 1�,25-

dihydroxyvitamin D3 (1,25(OH)2D3) against ligands of the pregnane X receptor (PXR), the glucocorticoid

receptor (GR) and the farnesoid X receptor (FXR) in precision-cut tissue slices of the rat jejunum, ileum,

colon and liver, and human ileum and liver. In the rat, 1,25(OH)2D3 strongly induced CYP3A1 mRNA,

quantified by qRT-PCR, along the entire length of the intestine, induced CYP3A2 only in ileum but had no

effect on CYP3A9. In contrast, the PXR/GR ligand, dexamethasone (DEX), the PXR ligand, pregnenolone-16�carbonitrile (PCN), and the FXR ligand, chenodeoxycholic acid (CDCA), but not the GR ligand, budesonide

(BUD), induced CYP3A1 only in the ileum, none of them influenced CYP3A2 expression, and PCN, DEX

and BUD but not CDCA induced CYP3A9 in jejunum, ileum and colon. In rat liver, CYP3A1, CYP3A2 and

CYP3A9 mRNA expression was unaffected by 1,25(OH)2D3, whereas CDCA decreased the mRNA of all

CYP3A isozymes; PCN induced CYP3A1 and CYP3A9, BUD induced CYP3A9, and DEX induced all three

CYP3A isozymes. In human ileum and liver, 1,25(OH)2D3 and DEX induced CYP3A4 expression, whereas

CDCA induced CYP3A4 expression in liver only. In conclusion, the regulation of rat CYP3A isozymes by

VDR, PXR, FXR and GR ligands differed for different segments of the rat and human intestine and liver,

and the changes did not parallel expression levels of the nuclear receptors.

© 2009 Elsevier B.V. All rights reserved.

1. Introduction

The cytochrome P450 enzymes constitute a family of heme

protein oxygenases that display considerable similarities in their

molecular weights, immunohistochemical properties, and sub-

strate specificities (Gonzalez, 1988). The CYP3A isoforms play

an important role in oxidation of endogenous steroids and toxic

hydrophobic bile acids. In the rat, the CYP3A family consists of

five isoforms: CYP3A1/CYP3A23 (Gonzalez et al., 1985), CYP3A2

(Gonzalez et al., 1986), CYP3A9 (Wang et al., 1996), CYP3A18

(Strotkamp et al., 1995) and CYP3A62 (Matsubara et al., 2004).

These enzymes are expressed predominantly in the liver and in the

enterocytes of the intestine (Kolars et al., 1994). The distribution

of CYP3A isozymes in the rat appears to be sex-, tissue- and age-

dependent. CYP3A2 and CYP3A18 are predominantly expressed in

male rats (Gonzalez et al., 1986; Nagata et al., 1996; Strotkamp

∗ Corresponding author. Tel.: +31 50 363 7565; fax: +31 50 363 3247.

E-mail address: [email protected] (A.A. Khan).

et al., 1995), while CYP3A9 and CYP3A62 expression is higher in

female rats. CYP3A1 and CYP3A2 are predominantly expressed in

the rat liver, and CYP3A62, in female livers (Matsubara et al., 2004),

whereas CYP3A9 is highly expressed in the intestine relative to the

liver (Mahnke et al., 1997; Wang and Strobel, 1997). The human

CYP3A family which is expressed in the liver is composed of at least

four isozymes: CYP3A4, CYP3A5, CYP3A7 and CYP3A43 of which

CYP3A4 is the predominant isozyme expressed in adult human liver

(Guengerich et al., 1986). CYP3A4 and CYP3A5 isozymes are present

along the human digestive tract, with CYP3A5 mainly present in

the stomach and CYP3A4 along the intestine segments (Kolars et

al., 1994).

The expression of CYP3A isoforms in rats and humans was

reported to be modulated by exogenous and endogenous ligands

through the pregnane X receptor (PXR) (Lu et al., 1972), the glu-

cocorticoid receptor (GR) (Huss et al., 1999), and the vitamin D

receptor (VDR) (Makishima et al., 2002; Thummel et al., 2001; Xu

et al., 2006). Recently, a FXR response element (FXRE) was found in

the human CYP3A4 promoter, and induction by CDCA, a FXR ligand,

was noted (Gnerre et al., 2004). The 5′ flanking promoter regions of

0928-0987/$ – see front matter © 2009 Elsevier B.V. All rights reserved.

doi:10.1016/j.ejps.2009.01.006

206

116 A.A. Khan et al. / European Journal of Pharmaceutical Sciences 37 (2009) 115–125

the rat and human CYP3A are characterized by direct repeats spaced

by three base pairs (DR3) and everted repeats spaced by six base

pairs (ER6) (Gnerre et al., 2004; Hashimoto et al., 1993; Thummel

et al., 2001). PXR, FXR and VDR directly bind to the respective

response elements pursuant to the ligand binding and heterodimer-

ization with retinoic acid X receptor � (RXR�) (Gnerre et al., 2004;

Lehmann et al., 1998; Thompson et al., 1999). In contrast, the GR

effects on CYP3A isozymes in rat and humans have been attributed

indirectly to the induction of HNF4� and PXR (Huss and Kasper,

1998).

The effects of various ligands on rat and human CYP3A enzymes

in the intestine and liver have been studied in vitro in both pri-

mary cultured hepatocytes and enterocytes, and immortalized

human cell lines such as HepG2 and Caco-2 cells. Immortalized

intestinal cell lines derived from the different regions of the rat

intestine were utilized to study the regulation of drug metaboliz-

ing enzymes (Zhang et al., 1997). However, these cell lines lack the

normal expression of nuclear receptors (NRs), metabolic enzymes

and transporters. For example, Caco-2 cells are PXR-deficient and

exhibit reduced levels of drug metabolizing enzymes (Li et al.,

2003). Furthermore, cell lines are unable to reflect the segmental

expression of CYP3A isozymes and the gradients of activities along

the length of the rat intestine (Liu et al., 2006; van de Kerkhof et al.,

2005). The induction/repression of CYP3A isoforms in the intact

liver and intestinal tissue in response to ligands of the NRs has

not been extensively investigated. Such a response is dependent

not only on the presence of NR response elements, but also on the

expression levels of the NRs and exposure of the particular cell to

the ligand. This exposure is the result of uptake, metabolism and

excretion of the ligand and its metabolites and may differ between

the various regions of the intestine and the liver as a result of dif-

ferences in expression of uptake and excretion transporters and

metabolizing enzymes. Different regions of the intestine and liver

are exposed to different concentrations of the ligands in vivo. For an

appreciation of the potential variation between the different organs

and their sensitivity towards the NR ligands, these organs or tissues

should be studied under identical conditions.

Therefore, in this study, we compared the effects of various NR

ligands on the intestine and liver of the rat and human in precision-

cut tissue slices. This model has been previously validated as a

useful ex vivo model for induction studies (Olinga et al., 2008; van

de Kerkhof et al., 2007b, 2008) that enables us to investigate the

effects of inducing ligands under identical incubation conditions

for the liver and intestine. We tested the hypothesis that the reg-

ulation of rat and human CYP3A isozymes by VDR ligands differed

from those by PXR, GR and FXR ligands. We compared the induction

potential of PXR, FXR and GR ligands to that of VDR ligand, 1�,25-

dihydroxyvitamin D3 (1,25(OH)2D3) on changes in mRNAs of the

various CYP3A isoforms in the small intestine (jejunum and ileum),

colon and liver of the rat and the CYP3A4 in human ileum and liver

slices, and investigated whether these responses correlated to the

expression levels of the NRs.

2. Materials and methods

2.1. Materials

1,25(OH)2D3 in ethanol was purchased from BIOMOL Research

Laboratories, Inc., Plymouth Meeting, PA. Chenodeoxycholic acid

was purchased from Calbiochem, San Diego, CA, dexamethasone

was from Genfarma bv, Maarssen. The solvents: ethanol, methanol

and DMSO were purchased from Sigma–Aldrich Chemical Co. (St.

Louis, MO); Gentamicin and Williams medium E with glutamax-

I and amphotericin B (Fungizone)-solution were obtained from

Gibco (Paisley, UK). D-Glucose and HEPES were procured from ICN

Biomedicals, Inc. (Eschwege, Germany). Low gelling temperature

agarose, pregnenolone-16� carbonitrile and budesonide were pur-

chased from Sigma–Aldrich (St. Louis, MO). RNAeasy mini columns

were obtained from Qiagen, Hilden, Germany. Random primers

(500 �g/ml), MgCl2 (25 mM), RT buffer (10×), PCR nucleotide mix

(10 mM), AMV RT (22 U/�l) and RNasin (40 U/�l) were procured

from Promega Corporation, Madison WI, USA. SYBR green and Taq

Master Mixes were purchased from Applied Biosystems, Warring-

ton, UK and Eurogentech, respectively. ATP Bioluminescence Assay

kit CLS II is procured from Roche, Mannheim, Germany. All primers

were purchased from Sigma Genosys. All reagents and materials

used were of the highest purity that was commercially available.

2.2. Animals

Male Wistar (HsdCpb:WU) rats weighing about 230–250 g were

purchased from Harlan (Horst, The Netherlands). Rats were housed

in a temperature and humidity controlled room on a 12-h light/dark

cycle with food (Harlan chow no 2018, Horst, The Netherlands) and

tap water ad libitum. The animals were allowed to acclimatize for

7 days before experimentation. The experimental protocols were

approved by the Animal Ethical Committee of the University of

Groningen.

2.3. Rat liver and intestine

Under isoflurane/O2/N2O anaesthesia, the small intestine, colon

and liver were excised from the rat. Small intestine and colon were

immediately placed into ice-cold carbogenated Krebs–Henseleit

buffer, supplemented with 10 mM HEPES, 25 mM sodium bicarbon-

ate and 25 mM D-Glucose, pH 7.4 (KHB) and stored on ice until the

preparation of slices. Livers were stored in ice-cold University of

Wisconsin solution (UW) until slicing.

2.4. Human liver and ileum tissue

Pieces of human liver tissue were obtained from patients under-

going partial hepactectomy for the removal of carcinoma or from

redundant parts of donor livers remaining after split liver trans-

plantation as described previously by Olinga et al. (2008). Donor

characteristics are given in Table 1. Human ileum was obtained as

part of the surgical waste after resection of the ileo-colonic part

of the intestine in colon carcinoma patients, donor characteris-

tics are given in Table 2. After surgical resection, the ileum tissue

was immediately placed in ice-cold KHB. The research protocols

were approved by the Medical Ethical Committee of the University

Medical Center, Groningen with informed consent of the patients.

Table 1Characteristics of human liver donor used: ATP contents after 3 and 24 h of incuba-

tion (each value is a mean ± S.D. of three slices per time point)a.

Human liver (HL) Gender Age ATP-content (pmol/�g of protein)

3 h 24 h

HL1b,c Female 54 9.2 ± 0.5 10.4 ± 1.5

HL2 Not available 4.2 ± 0.9 5.7 ± 1.9

HL3c Female 72 3.4 ± 0.8 3.3 ± 1.2

HL4 Female 64 7.2 ± 1.2 9.7 ± 1.8

HL5c Male 65 12.1 ± 1.2 12.1 ± 1.0

Mean ± S.E.M. 7.2 ± 1.6 8.2 ± 1.6

P value 0.66

a Data were expressed as mean ± S.D.b Human liver tissue for immunohistochemistry of VDR.c Human livers responsive to CYP3A4 induction by 1,25(OH)2D3.

207

A.A. Khan et al. / European Journal of Pharmaceutical Sciences 37 (2009) 115–125 117

Table 2Characteristics of human ileum donor used. The terminal ileum was obtained from

colon carcinoma patients as part of tumor resection.

Human ileum (HIL) Gender Age Medical history

HIL 1 F 85 Colon carcinoma; coronary disease

HIL 2 M 60 Colon carcinoma

HIL 3 F 61 Colon carcinoma

HIL 4 Not available

HIL 5 F 69 Colon carcinoma

2.5. Preparation of slices

2.5.1. Rat and human intestinal slices

Rat intestinal slices were prepared as published before (van de

Kerkhof et al., 2005). In brief, the rat jejunum (at 25–40 cm from

the stomach), ileum (5 cm proximal to the ileocecal valve) and

colon (large intestine, distal to the ileocecal valve) tissues were

separated. The jejunum, ileum and colon were divided into approx-

imately 3-cm segments. The lumen of the segments was flushed

with ice-cold KHB that was aerated with carbogen. Thereafter, seg-

ments were tied at one end and filled with 3% low gelling agarose

solution in saline that was kept at 37 ◦C, then cooled immedi-

ately in KHB allowing the agarose to solidify. Subsequently, the

agarose filled segments were embedded in agarose solution filled

pre-cooled embedding unit (Alabama R&D, Munford, AL, USA). The

agarose filled solid embedded intestinal segments were then placed

in the pre-cooled Krumdieck tissue slicer (Alabama R&D, Munford,

AL, USA) containing carbogenated ice-cold KHB, and precision-cut

slices were prepared with a thickness of approximately 200 �m

and wet weight of 2–3 mg (without agarose) (cycle speed 40: inter-

rupted mode). Slices were stored in carbogenated ice-cold KHB on

ice until the start of the experiment which usually varies between

2 to 3 h after sacrificing the rat.

Human ileum slices were prepared according to the method

described for the jejunum (van de Kerkhof et al., 2006). In brief,

ileum tissue was stripped of the muscular layer and the mucosal

tissue was transferred to carbogenated ice-cold KHB. Mucosal tis-

sue was cut into rectangular pieces of ∼6–8 mm wide and these

were subsequently embedded in low gelling 3% agarose in saline

using pre-cooled tissue embedding unit (Alabama R&D, Munford,

AL, USA) allowing the agarose solution to solidify. Precision-cut

slices of approximately 200-�m thick were prepared as described

above for rat intestine.

2.5.2. Rat and human liver slices

Cylindrical cores of 8 mm were prepared from rat livers and

human liver tissue by advancing a sharp rotating metal tube in

the liver tissue and were subsequently placed in the pre-cooled

Krumdieck tissue slicer. The slicing was performed in carbo-

genated ice-cold KHB. The thickness of the liver slice was kept at

∼200–300 �m and a wet weight of 10–12 mg were prepared with

the standard settings (cycle speed 40: interrupted mode) of the

Krumdieck tissue slicer. Subsequently, slices were stored in ice-cold

UW solution on ice prior to the start of the experiment, which usu-

ally varies from 1 to 3 h from sacrificing the rat and for human livers

2 to 3 h post-surgery.

2.6. Incubation of rat and human intestinal slices

Slices were incubated individually in the 12-well, sterile tissue

culture plates (Grenier bio-one GmbH, Frickenhausen, Austria) con-

taining 1.3 ml William’s medium E supplemented with D-glucose

to a final concentration of 25 mM, gentamicin sulfate (50 �g/ml),

amphotericin/fungizone (250 �g/ml), and saturated with carbo-

gen. The plates were placed in humidified plastic container kept at

37 ◦C and continuously gassed with carbogen and shaken at 80 rpm.

Rat intestinal slices were incubated for 12 h because the expres-

sion of villin and GAPDH remained unchanged up to 12 h, whereas

in pilot experiments, the expression of villin was significantly

decreased after 24 h of incubation, indicating loss of epithelial cells.

Human ileum slices were incubated for 8 and 24 h, and showed

that villin expression remained unchanged up to 24 h. Rat and

human intestinal slices were incubated with 1,25(OH)2D3 (final

concentrations 5–100 nM), CDCA (final concentration 50 �M), DEX

(final concentrations 1 and 50 �M) and BUD (final concentration

10 nM). Furthermore, rat intestinal slices were also incubated with

PCN (final concentration 10 �M). All ligands were added as a 100-

times concentrated, stock solution in ethanol (for 1,25(OH)2D3),

methanol (for CDCA) and DMSO (for DEX/BUD/PCN) and had no

or only minor effects on villin expression. Higher concentrations

of CDCA (100 �M) significantly reduced villin expression and con-

sidered toxic. Control slices were incubated in William’s medium E

with 1% ethanol, methanol and DMSO without inducers. From a sin-

gle rat or human tissue sample, six (rat intestine) or three (human

intestine) replicate slices were subjected to each experimental con-

dition. After the incubation these replicate slices were harvested,

pooled and snap-frozen in liquid nitrogen to obtain sufficient total

RNA for qRT-PCR analysis. Samples were stored in −80 ◦C freezer

until RNA isolation. These experiments were replicated in 3–5 rats

and 3–5 human ileum donors.

2.7. Incubation of rat and human liver slices

Slices were incubated individually in 6-well, sterile tissue

culture plates (Grenier bio-one GmbH, Frickenhausen, Austria) con-

taining 3.2 ml William’s medium E supplemented with D-glucose

to a final concentration of 25 mM, gentamicin sulfate (50 �g/ml)

and saturated with carbogen. The plates were placed in humidi-

fied plastic container kept at 37 ◦C and continuously gassed with

carbogen and shaken at 80 rpm. Rat slices were incubated with

1,25(OH)2D3 (final concentrations 10–200 nM), CDCA (final con-

centrations 10–100 �M) and DEX (final concentrations 1–50 �M).

Apart from the above inducers, rat liver slices were also incubated

with PCN (final concentration 10 �M) and BUD (final concen-

trations 10–100 nM). All inducers were added as a 100-times

concentrated stock solution in ethanol (for 1,25(OH)2D3), methanol

(for CDCA) and DMSO (for DEX/PCN/BUD). Control rat and human

liver slices were incubated in William’s medium E with 1% ethanol,

methanol, and DMSO, the vehicles. Rat and human liver slices were

incubated for 8 and 24 h, respectively. From a single rat/single

human liver donor three replicate slices were subjected to identical

incubation conditions. At the end of the incubation these replicate

slices were harvested, pooled and snap-frozen in liquid nitrogen

to obtain sufficient total RNA for qRT-PCR analysis. Samples were

stored in −80 ◦C freezer until RNA isolation. These experiments

were replicated in 3–5 rats and 4–5 human liver donors.

2.8. RNA isolation and quantitative real-time PCR (qRT-PCR)

Total RNA from rat and human intestine and liver samples were

isolated by using RNAeasy mini columns from Qiagen according

to the manufacturer’s instruction. RNA quality and concentrations

were determined by measuring the absorbance at 260, 230 and

280 nm using a Nanodrop ND100 spectrophotometer (Wilming-

ton, DE, USA). The ratio of absorbance measured at 260 over 280

and 230 over 260 was always above 1.8. About 2 �g of total RNA

in 50 �l was reverse transcribed into template cDNA using ran-

dom primers (0.5 �g/ml), PCR nucleotide mix (10 mM), AMV RT

(22 U/�l), RT buffer (10×), MgCl2 (25 mM) and RNAasin (40 U/�l).

Real time quantitative PCR (qRT-PCR) was performed for

genes of interest using primer sequences given in Table 3 by

208


Table 3Oligonucleotides for quantitative real-time PCR, rat and human genes (SYBR Green and Taqman® analysis).

Gene Forward primer(5′–3′) Reverse primer(5′–3′) Gene bank number

r Villin GCTCTTTGAGTGCTCCAACC GGGGTGGGTCTTGAGGTATT XM 001057825

r GAPDH CTGTGGTCATGAGCCCCTCC CGCTGGTGCTGAGTATGTCG XR 008524

r CYP3A1 GGAAATTCGATGTGGAGTGC AGGTTTGCCTTTCTCTTGCC L24207

r CYP3A2 AGTAGTGACGATTCCAACATAT TCAGAGGTATCTGTGTTTCCT XM 573414

r CYP3A9 GGACGATTCTTGCTTACAGG ATGCTGGTGGGCTTGCCTTC U46118

r FXR CCAACCTGGGTTTCTACCC CACACAGCTCATCCCCTTT NM 021745

r PXR GATGATCATGTCTGATGCCGCTG GAGGTTGGTAGTTCCAGATGCTG NM 052980

h Villin CAGCTAGTGAACAAGCCTGTAGAGGAGC CCACAGAAGTTTGTGCTCATAGGC NM 007127

h CYP3A4 GCCTGGTGCTCCTCTATCTA GGCTGTTGACCATCATAAAAG DQ924960

h VDR GGAAGTGCAGAGGAAGCGGGAGATG AGAGCTGGGACAGCTCTAGGGTCAC NM 000376

r � actina Assay-by-DesignTM FAM labelled, Part number 4331348 (Applied Biosystems) NM 031144

r VDRa TGACCCCACCTACGCTGACT CCTTGGAGAATAGCTCCCTGTACT24873

Probe, 6FAM, ACTTCCGGCCTCCAGTTCGTATGGAC-TAMRA

h GAPDHbAssay-by-DesignTM ID, Hs99999905 m1

NM 002046Probe, 6FAM, GCGCCTGGTCACCAGGGCTGCTTTT, NFQ

r, rat genes and h, human genes.a Primer sets for rat Taqman® Gene analysis.b Primer sets for human Taqman® Gene analysis.

two detection systems based on the availability of primer sets;

villin and GAPDH were used as house-keeping genes for intesti-

nal epithelial cells and liver cells, respectively, and CYP3A1,

CYP3A2, CYP3A9, PXR and FXR were analyzed by the SYBR

Green detection system. Primer sequences used for CYP3A1,

CYP3A2 and CYP3A9 analysis were identical to those reported

earlier by Mahnke et al. (1997). All primer sets were analyzed

using BLASTn to ensure primer specificity for the gene of inter-

est (http://www.ncbi.nlm.nih.gov/BLAST/). For qRT-PCR using the

SYBR Green detection system ∼50 ng of cDNA was used in a total

reaction mixture of 20 �l of the SYBR Green mixture (Applied

Biosystems, Warrington, UK). The PCR conditions are step 1: 95 ◦C

for 10 min; and step 2: 40 cycles of 95 ◦C, 15 s; 56 ◦C, 60 s and 72 ◦C,

40 s, followed by a dissociation stage (at 95 ◦C for 15 s, at 60 ◦C for

15 s and at 95 ◦C for 15 s) to determine the homogeneity of the

PCR product. Further, the control consisting of water (with water

instead of total mRNA, which has been subjected to reverse tran-

scription protocol) and the mRNA control (isolated mRNA which

has not been subjected to reverse transcription protocol) were

used to determine primer dimer formation and contamination of

DNA in the isolated samples, respectively. Amplification plots and

dissociation curves of the controls did not show any signal and

dissociation product, suggesting the lack of primer dimer forma-

tion. In addition total RNA from the samples for the preparation of

cDNA appeared to be free of DNA contamination. �-actin and VDR

genes were analyzed by Taqman® analysis using primer sequences

given in Table 3. For Taqman® analysis ∼250 ng of cDNA was used

in a total reaction mixture of 10 �l Taq Master Mix (2×). The qRT-

PCR conditions for Taqman® analysis were: step 1, 95 ◦C for 10 min;

step 2, 40 cycles of 95 ◦C for 15 s and 60 ◦C for 60 s. All samples

were analyzed in duplicates in 384 well plates using ABI7900HT

from Applied Biosystems. The comparative threshold cycle (CT)

method was used for relative quantification since CT was inversely

related to the abundance of mRNA transcripts in the initial sam-

ple. The mean CT of the duplicate measurements was used to

calculate the difference in CT for gene of interest and the house

keeping gene, villin for intestine and GAPDH for liver (�CT). This

�CT value of the treated sample was compared to the correspond-

ing �CT of the solvent control (��CT). Data are expressed as fold

induction or repression of the gene of interest according to the

formula 2−(��CT).

2.9. ATP and protein content of the human liver slices

Viability of human liver slices during incubation was deter-

mined by measuring the ATP contents of the slices according to

the method described earlier by de Kanter et al. (2002). In brief,

control human liver slices were incubated in 3.2 ml of William’s

medium E, supplemented with D-glucose to a final concentration

of 25 mM, gentamicin sulfate (50 �g/ml), and saturated with car-

bogen, as described in Section 2.7 for 3 and 24 h. At the end of

incubation time, three replicate slices were collected individually

in 1 ml 70% ethanol (v/v) containing 2 mM EDTA (pH 10.9) and snap-

frozen in liquid nitrogen and stored at −80 ◦C freezer until analysis.

The samples were disrupted and homogenized by sonication, and

ATP extracts were diluted 10 times with 0.1 M Tris–HCl contain-

ing 2 mM EDTA (pH 7.8) to reduce the ethanol concentration. The

ATP content was measured using the ATP Bioluminescence Assay

kit CLS II from Roche (Mannheim, Germany) in a 96-well plate

Lucy1 luminometer (Anthos, Durham, NC, USA) using a standard

ATP-calibration curve.

Protein content of the slices was estimated in three identical,

replicate slices which were not used for incubation. The slices

were digested with 5 M NaOH and homogenized, and subsequently

diluted with water to result in a concentration of 0.1 M NaOH. The

protein content of the diluted homogenate was determined by the

Bio-Rad protein assay dye reagent method (Bio-Rad, Munich, Ger-

many) using bovine serum albumin (BSA) for the calibration curve.

The ATP content of the slice was expressed as pmol/�g of protein.

2.10. Statistics

All experiments were performed in 3–5 rats and in 4–5 human

tissue samples. Values were expressed as mean ± S.E.M. All data

were analyzed by the unpaired student’s t-test or Mann–Whitney

U-test to detect differences between the means of different treat-

ments. The Student’s t-test was used to analyze the rat data where

the error distribution was found to be normal with equal vari-

ance except for the CYP3A1 and CYP3A2 genes. Among experiments

where non-equal error distribution and high variance (e.g. expres-

sion of CYP3A1 and CYP3A2 genes in Wistar rats and CYP3A4 in

human tissues due to age and habits) were observed, the non-

parametric Mann–Whitney U-test was used. Statistical analysis was

performed on fold induction as well as on ��CT with similar

results. The P value <0.05 was considered as significant.

3. Results

3.1. Expression of nuclear receptors in rat intestine and liver

VDR, PXR and FXR mRNA were detected in rat intestine as well

as in liver. To analyze the expression of the NRs, enzymes and

209


Fig. 1. Expression of PXR, FXR and VDR mRNA in rat intestine was normalized to

that of villin (A); the value of jejunum/villin was set to 1. The expression of PXR,

FXR and VDR mRNA in rat intestine and liver, after normalizing to GAPDH (B),

with the liver value set to 1. Results were mean ± S.E.M. of three rats. “*” denotes

P < 0.05, compared to jejunum (A) or liver (B). “#” denotes P < 0.05, compared to ileum

(A and B).

transporters per enterocyte, their expression is expressed rela-

tive to that of villin, which is present exclusively in the epithelial

cells of the intestine. In rat intestine, PXR, FXR and VDR expres-

sion varied along the length of the small intestine and colon.

The expression of PXR and VDR mRNA relative to villin was 5-

fold higher in the colon compared to the jejunum and the ileum

(Fig. 1A). FXR expression relative to villin was 5-fold higher in

the ileum compared to the jejunum and was similar to that in

the colon (Fig. 1A). For comparison of the expression in liver,

GAPDH was used as a reference since villin is not expressed in

hepatocytes. In the rat liver, the expression of FXR and PXR, rel-

ative to GAPDH, was significantly higher (2–10-fold) compared

to those in the small intestine and colon (Fig. 1B). However, the

mRNA expression of VDR relative to GAPDH in the rat liver was

very low, about 0.1% compared to those in the small intestine and

colon, and was detected at approximate CT values of 32–34 cycles

(Fig. 1B).

3.2. Expression and regulation of CYP3A isozymes in rat intestine

and liver slices

3.2.1. Rat intestine slices

Among the CYP3A isozymes in the rat intestine, CYP3A9 was

clearly expressed (CT value ∼19–21) in all segments: the expres-

sion of CYP3A9 in rat intestine per enterocyte was in the rank

order of colon > jejunum ≥ ileum. CYP3A1 expression was low but

detectable (CT values ≥33 for CYP3A1) in all regions of the intestine.

CYP3A2 was barely detectable in the ileum (≥35 for CYP3A2) but

was undetectable in the jejunum and colon. Because CYP3A1 and

CYP3A2 mRNA expression was decreased, whereas that of CYP3A9

expression was moderately elevated during incubation of the slices

(data not shown), results on ligand-induced effects were expressed

relative to “control” slices incubated with solvent for the same incu-

bation period.

Increasing concentrations of the VDR ligand, 1,25(OH)2D3

strongly induced CYP3A1 mRNA in all regions of the rat intes-

tine (700-fold at 100 nM of 1,25(OH)2D3 in jejunum, 15,000-fold

for the ileum, and 1000-fold for the colon; P < 0.05) (Fig. 2A), but

the mRNA expression of CYP3A9 remained unchanged (Fig. 2C).

In contrast, PCN, DEX and BUD strongly induced CYP3A9 mRNA

in the jejunum and ileum, and to a much lesser extent, in the

colon (Fig. 2C). PCN and DEX but not BUD induced CYP3A1 in the

ileum (Fig. 2A), but had no effect on CYP3A1 in the colon. Although

PCN, BUD and DEX induced CYP3A1 mRNA in the jejunum sam-

ples, the results failed to reach statistical significance due to the

high variation among the data (Fig. 2A). CDCA induced CYP3A1

mRNA only in the ileum and not in the jejunum and colon (Fig. 2A),

and failed to affect the expression of CYP3A9 mRNA along the

length of the intestine (Fig. 2C). CYP3A2 mRNA, though practi-

cally undetectable after incubation with PCN, BUD, DEX and CDCA,

was highly induced by 1,25(OH)2D3 in the ileum; however, CYP3A2

remained undetectable in the jejunum and colon for all situations

(Fig. 2B).

3.2.2. Rat liver slices

In the rat liver, the expression of CYP3A1 and CYP3A2 was very

high compared to that in the intestine, and was detected at a

CT value of 18–19, where as CYP3A9 was detected at a CT value

of 22. The expression of CYP3A1, CYP3A2, and CYP3A9 mRNAs

was significantly decreased during incubation, but was not further

affected by the presence of the solvent vehicle. Distinct from intesti-

nal slices, incubation of rat liver slices with 1,25(OH)2D3 did not

change the expression of CYP3A1, CYP3A2 and CYP3A9 (Fig. 3A).

DEX induced CYP3A1, CYP3A2 and CP3A9 mRNA expression in rat

liver slices in a concentration-dependent manner (Fig. 3C). PCN

induced CYP3A1 and CYP3A9 but not CYP3A2 mRNA expression

(Fig. 3C). However, BUD induced CYP3A9 expression without affect-

ing those of CYP3A1 and CYP3A2 (Fig. 3C). CDCA significantly

decreased the expression of CYP3A1, CYP3A2 and CYP3A9 with

increasing concentration (Fig. 3B) to 0.7-fold, 0.5-fold and 0.7-fold,

respectively.

3.3. Induction of PXR in rat intestine and liver slices

The expression of PXR, a known GR-responsive gene, was

studied in the rat intestinal and liver samples treated with GR

(DEX/BUD) and PXR (PCN) ligands. DEX and BUD but not PCN

induced PXR expression in all the three regions of the intestine

and in the liver (Fig. 4A and B). Furthermore, PXR induction by

DEX (1 �M) and BUD (10 nM) in the rat colon was lower com-

pared to that in the jejunum and ileum, but the fold-induction

at 50 �M DEX, in the jejunum, ileum and colon was comparable

(Fig. 4A).

3.4. Expression and regulation of CYP3A4 in human ileum and

liver slices

CYP3A4 mRNA expression was constant up to 8 h of incubation

in ileum slices, but decreased to 30–50% by 24 h, with only minor

differences between the control and the solvent-treated slices

(Fig. 5A). The FXR and PXR expression in human ileum and liver,

210


Fig. 2. Slices from rat jejunum, ileum and colon were exposed to 1,25(OH)2D3 (5, 10 and 100 nM), CDCA (50 �M), DEX (1 and 50 �M), BUD (10 nM) and PCN (10 �M) for 12 h,

after which total RNA was isolated and mRNA expression of CYP3A1 (A), CYP3A2 (B) and CYP3A9 (C) were evaluated by qRT-PCR. Results were expressed as fold induction

after normalizing with villin expression and compared to the control slices of the same segment that was also incubated for 12 h; the control value was set as 1. Results were

mean ± S.E.M. of 3–5 rats; in each experiment, 6 slices were incubated per condition. Significant differences towards the control incubations are indicated with *P < 0.05 and

**P = < 0.01. “†” denotes induction of CYP3A1 and CYP3A2 in all experiments, but the results failed to reach significance due to the high variation between the experiments,

ND—not detectable; “‡” denotes one or two out of three experiments showed induction.

when expressed relative to GAPDH, was higher in the liver com-

pared to that in the ileum (1.5–4 fold); the opposite was observed

for the VDR expression, which was significantly higher in the ileum

than in the liver.

3.4.1. Human ileum

Incubation of ileum slices with increasing concentrations of

1,25(OH)2D3 induced CYP3A4 mRNA expression (Fig. 5B). DEX and

BUD but not CDCA also induced CYP3A4 mRNA expression in the

ileum slices (Fig. 5C and D).

3.4.2. Human liver

In human liver slices, CYP3A4 expression was significantly

decreased to 10–20% upon incubation for 24 h in the solvent-treated

controls (Fig. 6A). 1,25(OH)2D3 induced CYP3A4 in three out of four

livers (Fig. 6B) (fold induction at 100 and 200 nM were: human liver

(HL)1, 2.66/2.29; HL2, 2.89/0.83; HL3, 0.33/0.25; HL5, 1.43/1.41).

CDCA and DEX induced CYP3A4 significantly in all the five human

livers studied (Fig. 6C and D).

The effects of the ligands for VDR, PXR, GR and FXR on the regula-

tion of CYP3A isozymes in rat intestine (jejunum, ileum and colon),

211


Fig. 3. Slices from rat liver were exposed to 1,25(OH)2D3 (10, 100 and 200 nM) (A),

CDCA (50 �M) (B), and DEX (1, 10 and 50 �M), BUD (10 and 100 nM) and PCN (10 �M)

(C) for 8 h, after which total RNA was isolated and mRNA expression of CYP3A1 (A),

CYP3A2 (B) and CYP3A9 (C) were evaluated by qRT-PCR. Results were expressed as

fold induction, after being normalized to the GAPDH expression, and compared with

the control slices that were incubated for 8 h, whose value was set to 1. Results were

mean ± S.E.M. of 3–5 rats; in each experiment, 3 slices were incubated per condition.

Significant differences towards the control incubations are denoted by *, denoting

P < 0.05.

rat liver, human ileum and liver are summarized as an overview in

Table 4 to facilitate comparison of the effects of the various ligands

in the different tissues.

4. Discussion

In this report, we compared the regulation of CYP3A isozymes

by the VDR-specific ligand, 1,25(OH)2D3, in different regions of the

Fig. 4. Slices from rat intestine (jejunum, ileum and colon) were exposed to DEX (1

and 50 �M), BUD (10 nM) and PCN (10 �M) (A) for 12 h. Liver slices were exposed

to DEX (1, 10 and 50 �M), BUD (10 and 100 nM) and PCN (10 �M) (B) for 8 h after,

which total RNA was isolated and mRNA expression of PXR was evaluated by qRT-

PCR. Results were expressed as fold induction after being normalized to the villin

for the intestine and GAPDH for liver expression, and compared with the control

slices (values set to 1) that were incubated for 12 and 8 h, respectively. Results were

mean ± S.E.M. of 3–5 rats; in each experiment 6 intestinal and 3 liver slices were

incubated per condition. Significant differences towards the control incubations

were denoted by *P < 0.05.

intestine and in the liver of the rat and humans with PXR-, GR- and

FXR-specific ligands, and investigated whether the changes were

related to expression levels of the NRs in the tissues. Most data con-

cerning the regulation of CYP3A isoforms in the rat are restricted to

the liver and the small intestine, mostly jejunum, and the data on

the comparison of regulation of CYP3A isozymes across the intesti-

nal tract, jejunum, ileum and colon is scarce. In vivo, the extent of

exposure of the various organs to ligands of the NRs is rarely con-

trolled, and it is difficult to discriminate between the direct and

indirect effects of the ligands. In this study, we compared the reg-

ulation of gene expression in different segments of the intestine

and liver under identical experimental conditions using precision-

cut tissue slices (Olinga et al., 2008; van de Kerkhof et al., 2007a,

2008). Viability of the liver and intestinal slices during incubation

was revealed by the stable expression of house-keeping genes, villin

as specific gene for enterocytes, and GAPDH for the intestinal and

liver tissue (data not shown). In addition, the ATP content of the

human liver slices was assessed as an additional viability marker

during incubation; these levels were found to be constant during

incubation (Table 1). Furthermore, metabolism in tissue slices is

comparable to in vivo (Graaf et al., 2007; van de Kerkhof et al.,

2007b) with adequate expression of transporters and enzymes.

Therefore, the uptake and metabolism of ligands is expected to be

212


Fig. 5. Slices from human ileum were exposed to control solvents (ethanol, methanol, and DMSO) (A), 1,25(OH)2D3 (10, 50 and 100 nM) (B), CDCA (50 �M) (C), DEX (1 and

50 �M) and BUD (10 nM) (D) for 12 and 24 h, after which total RNA was isolated and mRNA expression of CYP3A4 was evaluated by qRT-PCR. Results were expressed as fold

induction after being normalized to the villin and compared to the control slices (values set as 1) that were incubated for 12 and 24 h. Results were mean ± S.E.M. of 4–5

human ileum donors; in each experiment, 3 slices were incubated per condition. Significant difference towards the control incubations is denoted by *P < 0.05 and **P < 0.01.

“†” denotes induction of CYP3A4 in all experiments with high variation between the experiments, and failed to reach statistical significance.

similar to in vivo and to reflect species differences between human

and rat. The concentrations of ligands for various nuclear recep-

tors used in this study are similar to those used in earlier studies

with metabolically active cells (Drocourt et al., 2002; Hoen et al.,

2000), which seem to be adequate to elicit nuclear receptor-specific

induction responses, monitored by the induction of signature

genes.

In rat intestine, the mRNA expression of PXR, FXR and VDR was

found to be present in varying abundances along the length of the

small intestine (jejunum and ileum), with the highest expression of

Fig. 6. Slices from human liver were exposed to control solvents (EtOH, MeOH and DMSO) (A), 1,25(OH)2D3 (100 and 200 nM) (B), CDCA (100 �M) (C) and DEX (50 �M) (D) for

24 h, after which total RNA was isolated and CYP3A4 mRNA expression was evaluated by qRT-PCR. Results were expressed as fold induction after being normalized to GAPDH

and compared to the control slices (values set as 1) that were incubated for 24 h. Results were mean ± S.E.M. of 5 human liver donors for all ligands except for1,25(OH)2D3

where n = 4; in each experiment 3 slices were incubated per condition. Significant differences towards the control incubations are indicated with *P < 0.05 and **P < 0.01. “¥”

denotes induction of CYP3A4 in three out of four human livers, which fails to reach statistical significance.

213


Table 4Effect of VDR, PXR, FXR and GR ligands on the expression of CYP3A isozymes in rat and human intestine and liver.

Ligands Nuclear receptor Rat Human

CYP3A1 CYP3A2 CYP3A9 CYP3A4

Intestine Liver Intestine Liver Intestine Liver IL Liver

J IL Co J IL Co J IL Co

1,25(OH)2D3 VDR ↑ ↑ ↑ ↔ ↔ ↑ ↔ ↔ ↔ ↔ ↔ ↔ ↑ ↑c

PCN PXR ↑a ↑ ↔ ↑ Not detectable ↔ ↑ ↑ ↑ ↑ Not done

CDCA FXR/VDR ↔a ↑ ↔ ↓ Not detectable ↓ ↔ ↔ ↔ ↓ ↔ ↑BUD GR ↔a ↔ ↔ ↔ Not detectable ↔ ↑ ↑ ↑ ↑ ↔ Not done

DEX PXR/GR ↑b ↑ ↔ ↑ Not detectable ↑ ↑ ↑ ↑ ↑ ↑ ↑J, jejunum; IL, ileum; Co, colon.

↑, induction; ↓, repression; ↔, no induction.a ↔, induction in one out of three experiment.b ↑, induction with high variation between the experiments.c ↑, induction in three out of four experiments.

all the NRs in the colon. In the rat, the expression of PXR and FXR was

2–10-fold lower in the intestine than in the liver, while in humans,

the expression of PXR and FXR was 1.5–4-fold lower in the ileum

compared to the liver. Whether this lower liver to intestine ratio of

the NRs in humans is significantly different from that in rats could

not be concluded from our data, because human samples showed

larger inter-individual differences and the liver and intestinal sam-

ples were obtained from different patients. The expression of VDR

mRNA showed an increasing gradient from rat jejunum to colon, in

contrast to the reported gradual decrease of VDR receptor concen-

tration from jejunum to ileum, as determined by the 1,25(OH)2D3

binding assay (Feldman et al., 1979). The VDR expression relative

to GAPDH was even higher (up to 2500-fold) in rat intestine and

human ileum compared to rat and human liver, respectively, as

reported earlier (Chan and Atkins, 1984; Sandgren et al., 1991).

Immunohistochemical staining showed that the VDR protein was

exclusively localized in the bile duct epithelial cells (BECs) in rat

livers, whereas in the human livers, not only BEC cells but also

hepatocytes contained VDR protein, though to a lower extent (data

not shown), confirming the earlier findings of Gascon-Barre et al.

(2003). In human livers, the mRNA expression of VDR showed high

inter-individual variations; only three out of four human livers

showed detectable VDR expression.

In the rat intestine, the VDR ligand, 1,25(OH)2D3 strongly

induced CYP3A1 mRNA along the entire length of the intestine and

CYP3A2 only in ileum, but did not affect CYP3A9 expression. The

induction of CYP3A1 mRNA by 1,25(OH)2D3 which was found in

rat jejunum slices is consistent with earlier in vivo report by Xu

et al. (2006) in Sprague–Dawley rats. We also report on CYP3A1

induction by 1,25(OH)2D3 in ileum and colon slices, with the high-

est induction occurring in ileum slices compared to the jejunum

and colon slices, where induction was similar, despite the highest

expression of VDR in colon. Recently, Chow et al. (2008) showed

dose-dependent induction of CYP3A1 in the duodenum, jejunum,

and ileum and not the colon in the Sprague–Dawley rats in vivo

after intraperitoneal injections of 1,25(OH)2D3 for 4 days. This is

likely explained by lower exposure of the colon than the small

intestine to 1,25(OH)2D3 than the small intestine in vivo. In vivo,

CYP3A2 mRNA levels were found to be very low and undetectable,

rendering the study of the regulation of CYP3A2 along the length

of the rat intestine difficult (Chow et al., 2008). Recently Xu et

al. (2006) and Chow et al. (2008) reported that CYP3A2 gene was

not responsive to 1,25(OH)2D3 treatment. We also found very low

expressions of CYP3A2 mRNA along the length of the intestine of

the Wistar rats, and found, surprisingly, that 1,25(OH)2D3 signifi-

cantly induced CYP3A2 mRNA in the ileum, though not in jejunum

and colon slices. Furthermore, CYP3A9 expression was unaffected

by 1,25(OH)2D3 along the length of the intestine, as reported by

Xu et al. (2006) and Chow et al. (2008) in rats in vivo. This finding

contrasts that of Zierold et al. (2006). Our novel observation on the

induction of CYP3A2 by 1,25(OH)2D3 in the rat ileum emphasizes

the segmental regulation of CYP3A isozymes in the small intestine.

In contrast to the effects of 1,25(OH)2D3 on CYP3A isozymes

in rat intestine, the prototypical PXR ligand, PCN, and DEX, which

is a GR ligand at low concentrations (<1 �M) and a PXR ligand at

higher concentrations (>1 �M), induced CYP3A9 mRNA expression

in the jejunum, ileum and colon, CYP3A1 in the ileum only, but did

not affect the expression of CYP3A2 along the entire length of the

intestine. BUD, a specific GR ligand, induced CYP3A9 expression

but not CYP3A1 and CYP3A2 in the jejunum, ileum and colon slices.

CDCA, the FXR ligand, induced CYP3A1 in the ileum slices but not

in jejunum and colon slices. Our results on the induction of CYP3A1

by PXR ligands, PCN and DEX, in rat intestine are consistent with

earlier reports on rat jejunum explants (Schmiedlin-Ren et al.,

1993). Based on the BUD results, a synthetic GR ligand which did

not affect CYP3A1 mRNA expression, we conclude that CYP3A1

is not regulated by GR. The induction by DEX at 1 �M, can be

explained as a PXR mediated effect, which was further confirmed

by the observation that induction of CYP3A1 occurred with PCN,

the PXR ligand. The observation on induction of CYP3A9 by PCN,

DEX and BUD in rat intestine had not been reported earlier. Our

results suggest that apart from PXR, CYP3A9 expression was also

regulated by GR. However our data failed to discriminate whether

BUD mediated regulation of CYP3A9 acted via the GRE in the

promoter or indirectly via the induction of HNF4�. The induction

of PXR by DEX via GR, as reported previously by Huss and Kasper

(2000), was evident in our studies, since BUD and DEX both

induced PXR (Fig. 4A). The induction potential of the PXR ligands,

PCN and DEX (at 50 �M) on CYP3A1 in the ileum but not in the

colon slices did not correlate with the higher expression of PXR in

the colon compared to the jejunum.

Although an FXRE has not been identified in the CYP3A1 pro-

moter, the FXR ligand, CDCA, was found to increase CYP3A1 mRNA

in the ileum. This observation could be the result of VDR-mediated

regulation, since CDCA is also a VDR ligand, albeit of relatively low

affinity (Makishima et al., 2002). However, induction of CYP3A1 was

not observed in the colon with CDCA despite the high FXR and VDR

expression. The possible explanation that CDCA is not efficiently

taken up into the colonocytes is in contradiction with our finding

that CDCA showed a strong upregulation of the Ost� and Ost� genes

in rat colon slices (Khan et al., manuscript submitted). Among the

VDR, FXR, PXR and GR ligands, the VDR ligand, 1,25(OH)2D3, was

by far the strongest inducer of CYP3A1 and also induced CYP3A2 in

ileum. These results also showed that, although CYP3A1 was upreg-

214


ulated by VDR, PXR and FXR ligands and CYP3A9 by PXR and GR

ligands, dramatic differences in the extents of the induction were

found in the different segments of the intestine (Table 4). These dif-

ferences were apparently not related to the differential expression

of the respective NRs. The colon, although endowed with an abun-

dance of NRs, exhibited low induction potential of CYP3A isozymes

compared to those of the jejunum and ileum.

The VDR-, PXR-, FXR- and GR-dependent regulation of CYP3A1,

CYP3A2 and CYP3A9 mRNA in rat liver slices differed dramat-

ically from intestinal slices. The expression of CYP3A1, CYP3A2

and CYP3A9 mRNA was unchanged in liver slices incubated with

1,25(OH)2D3, as found in vivo by Xu et al. (2006) and Chow et al.

(2008). The lack of regulation of CYP3A1 in liver can be explained by

the absence of VDR in rat hepatocytes, the major site of the target

CYP genes, since VDR is found only in non-parenchymal cells and

biliary epithelial cells (Gascon-Barre et al., 2003). This was con-

firmed by immunohistochemisty of rat liver slices in our studies

where CYP3A1 was present exclusively in hepatocytes and CYP3A2,

mainly in hepatocytes, and expressed at a much lower level in bil-

iary epithelial cells (unpublished observations).

In contrast, PCN and DEX induced the expression of hepatic

CYP3A1 and CYP3A9, and BUD induced CYP3A9, whereas CYP3A2

expression was modestly induced only by DEX. These data on the

induction of CYP3A1 and CYP3A9 by the PXR ligands, PCN and

DEX, agree with earlier reports on Sprague–Dawley rats (Huss

and Kasper, 1998; Mahnke et al., 1997). However, the induction of

CYP3A9 by BUD (GR), though suggested by Komori and Oda (1994),

has not been reported earlier. Induction of CYP3A9 by PCN and DEX

in the rat liver and intestine implies that CYP3A9 is likely regulated

by PXR via a PXRE. However, it remains to be elucidated whether

the inductive effect of BUD on CYP3A9 is directly mediated via GR

and a GRE in the CYP3A9 promoter, or indirectly via upregulation

of PXR and HNF4� by BUD. The two stage induction by the GR on

the upregulation of CYP via induction of PXR has been suggested

for CYP3A1/23 (Huss and Kasper, 2000), and is a likely possibility

since PXR induction was also observed with GR ligands (Fig. 4B).

Unlike the induction of CYP3A1 observed in the ileum, CDCA, an

FXR ligand, showed repression of CYP3A1, CYP3A2 and CYP3A9 in

rat liver slices. This might be due to the CDCA mediated repression

of PXR (data not shown), which in turn, affects the basal expression

of CYP3A isozymes in rat liver. These results are in stark contrast

to the mouse studies of Jung et al. (2006), where Cyp3a11 and pxr

were positively regulated by FXR in mice that were treated with FXR

agonists, cholic acid and GW4064, suggesting species difference in

the regulation of these genes.

In the human ileum, CYP3A4 was significantly induced by VDR,

PXR and GR ligands (Fig. 6B and D). Although the regulation of

CYP3A4 in vivo by PXR and GR ligands in the human intestine is

well known, we are the first to show the regulation of CYP3A4

in human intestinal tissue by the VDR ligand, 1,25(OH)2D3. These

observations agree with findings in cultured monolayers such as

Caco-2 and LS180 cells (Fukumori et al., 2007; Schmiedlin-Ren et

al., 2001). Also in human liver slices, CYP3A4 is upregulated by

1,25(OH)2D3, but only in those three liver samples that showed

expression of VDR, as reported for human hepatocytes (Drocourt

et al., 2002). For the liver that did not express VDR, no upregula-

tion of CYP3A4 by 1,25(OH)2D3 was found. This variation between

samples was not due to viability differences because human liver

slices treated with the PXR/GR ligand, DEX induced CYP3A4 in all

the experiments, observations that were in agreement with earlier

report (Lehmann et al., 1998). CDCA induced expression of CYP3A4

in human liver, confirming the FXR-dependent regulation in earlier

reports by Gnerre et al. (2004). But this response was not observed

in the ileum. It appears that all NRs: VDR, PXR, GR and FXR, are able

to induce CYP3A4 in the human liver.

In summary, studies in tissue slices showed that the overall

effects of ligands for NRs on regulation of CYP3A isozymes dif-

fered in different regions of the rat intestine and liver, and human

ileum and liver slices, despite the incubation was conducted under

identical circumstances. This difference appears not to be directly

related to the different expression levels of the nuclear receptors

involved. In the rat intestine, CYP3A1 expression is very sensitive

to the VDR ligand, and to a lesser extent, to PXR and GR ligands,

whereas CYP3A2 expression is exclusively regulated by the VDR.

CYP3A9 expression both in the liver and in all regions of the intes-

tine appears to be mainly regulated by PXR and GR but not by VDR.

In human tissue, however, CYP3A4 in ileum and liver was upregu-

lated by PXR, VDR and GR ligands. By contrast, CDCA elicited varying

effects, ranging from decreased expression in rat liver, lack of effect

in human ileum, and increased expression in rat ileum and human

liver, effects that are not explained by the expression of FXR. Our

results suggest that prediction of the inducing potential of drugs

should not rely strictly on whether or not the drug under study is

a ligand for a certain NR and the expression levels of this NR in

the target organ. Uptake, metabolism and excretion of the ligand as

well as the availability of co-activators or repressors in the specific

tissue and species may play a decisive role.

Acknowledgments

The authors thank Dr. Vincent B. Nieuwenhuijs (University Med-

ical Center, Groningen) for providing the human ileum tissue.

Grants: This work was supported in part by the Canadian Insti-

tutes for Health Research, MOP89850.

References

Chan, S.D., Atkins, D., 1984. The temporal distribution of the 1 alpha,25-dihydroxycholecalciferol receptor in the rat jejunal villus. Clin. Sci. (Lond.) 67,285–290.

Chow, E.C.Y., Liu, S., Sun, H., Khan, A.A., Groothuis, G.M.M., Pang, K.S., 2008. Effectsof 1�,25-dihydroxyvitamin D3 (calcitriol) and the vitamin D receptor (VDR) onrat enzymes, transporters and nuclear receptors. In: Proceedings of the AAPSAnnual Meeting, Atlanta, GA.

de Kanter, R., Monshouwer, M., Meijer, D.K., Groothuis, G.M., 2002. Precision-cutorgan slices as a tool to study toxicity and metabolism of xenobiotics with specialreference to non-hepatic tissues. Curr. Drug Metab. 3, 39–59.

Drocourt, L., Ourlin, J.C., Pascussi, J.M., Maurel, P., Vilarem, M.J., 2002. Expression ofCYP3A4, CYP2B6, and CYP2C9 is regulated by the vitamin D receptor pathwayin primary human hepatocytes. J. Biol. Chem. 277, 25125–25132.

Feldman, D., McCain, T.A., Hirst, M.A., Chen, T.L., Colston, K.W., 1979. Characterizationof a cytoplasmic receptor-like binder for 1 alpha, 25-dihydroxycholecalciferol inrat intestinal mucosa. J. Biol. Chem. 254, 10378–10384.

Fukumori, S., Murata, T., Taguchi, M., Hashimoto, Y., 2007. Rapid and drastic inductionof CYP3A4 mRNA expression via vitamin D receptor in human intestinal LS180cells. Drug Metab. Pharmacokinet. 22, 377–381.

Gascon-Barre, M., Demers, C., Mirshahi, A., Neron, S., Zalzal, S., Nanci, A., 2003. Thenormal liver harbors the vitamin D nuclear receptor in nonparenchymal andbiliary epithelial cells. Hepatology 37, 1034–1042.

Gnerre, C., Blattler, S., Kaufmann, M.R., Looser, R., Meyer, U.A., 2004. Regulation ofCYP3A4 by the bile acid receptor FXR: evidence for functional binding sites inthe CYP3A4 gene. Pharmacogenetics 14, 635–645.

Gonzalez, F.J., 1988. The molecular biology of cytochrome P450s. Pharmacol. Rev. 40,243–288.

Gonzalez, F.J., Kimura, S., Song, B.J., Pastewka, J., Gelboin, H.V., Hardwick, J.P., 1986.Sequence of two related P-450 mRNAs transcriptionally increased during ratdevelopment. An R. dre. 1 sequence occupies the complete 3′ untranslated regionof a liver mRNA. J. Biol. Chem. 261, 10667–10672.

Gonzalez, F.J., Nebert, D.W., Hardwick, J.P., Kasper, C.B., 1985. Complete cDNA andprotein sequence of a pregnenolone 16 alpha-carbonitrile-induced cytochromeP-450. A representative of a new gene family. J. Biol. Chem. 260, 7435–7441.

Graaf, I.A., Groothuis, G.M., Olinga, P., 2007. Precision-cut tissue slices as a tool topredict metabolism of novel drugs. Expert Opin. Drug Metab. Toxicol. 3, 879–898.

Guengerich, F.P., Martin, M.V., Beaune, P.H., Kremers, P., Wolff, T., Waxman, D.J.,1986. Characterization of rat and human liver microsomal cytochrome P-450forms involved in nifedipine oxidation, a prototype for genetic polymorphismin oxidative drug metabolism. J. Biol. Chem. 261, 5051–5060.

Hashimoto, H., Toide, K., Kitamura, R., Fujita, M., Tagawa, S., Itoh, S., Kamataki, T.,1993. Gene structure of CYP3A4, an adult-specific form of cytochrome P450 inhuman livers, and its transcriptional control. Eur. J. Biochem. 218, 585–595.

215


Hoen, P.A., Commandeur, J.N., Vermeulen, N.P., Van Berkel, T.J., Bijsterbosch,M.K., 2000. Selective induction of cytochrome P450 3A1 by dexamethasonein cultured rat hepatocytes: analysis with a novel reverse transcriptase-polymerase chain reaction assay section sign. Biochem. Pharmacol. 60,1509–1518.

Huss, J.M., Kasper, C.B., 1998. Nuclear receptor involvement in the regulation of ratcytochrome P450 3A23 expression. J. Biol. Chem. 273, 16155–16162.

Huss, J.M., Kasper, C.B., 2000. Two-stage glucocorticoid induction of CYP3A23through both the glucocorticoid and pregnane X receptors. Mol. Pharmacol. 58,48–57.

Huss, J.M., Wang, S.I., Kasper, C.B., 1999. Differential glucocorticoid responses ofCYP3A23 and CYP3A2 are mediated by selective binding of orphan nuclearreceptors. Arch. Biochem. Biophys. 372, 321–332.

Jung, D., Mangelsdorf, D.J., Meyer, U.A., 2006. Pregnane X receptor is a target offarnesoid X receptor. J. Biol. Chem. 281, 19081–19091.

Kolars, J.C., Lown, K.S., Schmiedlin-Ren, P., Ghosh, M., Fang, C., Wrighton, S.A., Merion,R.M., Watkins, P.B., 1994. CYP3A gene expression in human gut epithelium. Phar-macogenetics 4, 247–259.

Komori, M., Oda, Y., 1994. A major glucocorticoid-inducible P450 in rat liver is notP450 3A1. J. Biochem. 116, 114–120.

Lehmann, J.M., McKee, D.D., Watson, M.A., Willson, T.M., Moore, J.T., Kliewer, S.A.,1998. The human orphan nuclear receptor PXR is activated by compounds thatregulate CYP3A4 gene expression and cause drug interactions. J. Clin. Invest. 102,1016–1023.

Li, Q., Sai, Y., Kato, Y., Tamai, I., Tsuji, A., 2003. Influence of drugs and nutrients ontransporter gene expression levels in Caco-2 and LS180 intestinal epithelial celllines. Pharm. Res. 20, 1119–1124.

Liu, S., Tam, D., Chen, X., Pang, K.S., 2006. P-glycoprotein and an unstirred waterlayer barring digoxin absorption in the vascularly perfused rat small intestinepreparation: induction studies with pregnenolone-16alpha-carbonitrile. DrugMetab. Dispos. 34, 1468–1479.

Lu, A.Y., Somogyi, A., West, S., Kuntzman, R., Conney, A.H., 1972. Pregnenolone-16-carbonitrile: a new type of inducer of drug-metabolizing enzymes. Arch.Biochem. Biophys. 152, 457–462.

Mahnke, A., Strotkamp, D., Roos, P.H., Hanstein, W.G., Chabot, G.G., Nef, P., 1997.Expression and inducibility of cytochrome P450 3A9 (CYP3A9) and othermembers of the CYP3A subfamily in rat liver. Arch. Biochem. Biophys. 337,62–68.

Makishima, M., Lu, T.T., Xie, W., Whitfield, G.K., Domoto, H., Evans, R.M., Haussler,M.R., Mangelsdorf, D.J., 2002. Vitamin D receptor as an intestinal bile acid sensor.Science 296, 1313–1316.

Matsubara, T., Kim, H.J., Miyata, M., Shimada, M., Nagata, K., Yamazoe, Y., 2004. Iso-lation and characterization of a new major intestinal CYP3A form, CYP3A62, inthe rat. J. Pharmacol. Exp. Ther. 309, 1282–1290.

Nagata, K., Murayama, N., Miyata, M., Shimada, M., Urahashi, A., Yamazoe, Y., Kato, R.,1996. Isolation and characterization of a new rat P450 (CYP3A18) cDNA encod-ing P450(6)beta-2 catalyzing testosterone 6 beta- and 16 alpha-hydroxylations.Pharmacogenetics 6, 103–111.

Olinga, P., Elferink, M.G., Draaisma, A.L., Merema, M.T., Castell, J.V., Perez, G.,Groothuis, G.M., 2008. Coordinated induction of drug transporters and phaseI and II metabolism in human liver slices. Eur. J. Pharm. Sci. 33, 380–389.

Sandgren, M.E., Bronnegard, M., DeLuca, H.F., 1991. Tissue distribution of the 1,25-dihydroxyvitamin D3 receptor in the male rat. Biochem. Biophys. Res. Commun.181, 611–616.

Schmiedlin-Ren, P., Benedict, P.E., Dobbins 3rd, W.O., Ghosh, M., Kolars, J.C., Watkins,P.B., 1993. Cultured adult rat jejunal explants as a model for studying regulationof CYP3A. Biochem. Pharmacol. 46, 905–918.

Schmiedlin-Ren, P., Thummel, K.E., Fisher, J.M., Paine, M.F., Watkins, P.B., 2001.Induction of CYP3A4 by 1 alpha,25-dihydroxyvitamin D3 is human cell line-specific and is unlikely to involve pregnane X receptor. Drug Metab. Dispos. 29,1446–1453.

Strotkamp, D., Roos, P.H., Hanstein, W.G., 1995. A novel CYP3 gene from female rats.Biochim. Biophys. Acta 1260, 341–344.

Thompson, P.D., Hsieh, J.C., Whitfield, G.K., Haussler, C.A., Jurutka, P.W., Galligan,M.A., Tillman, J.B., Spindler, S.R., Haussler, M.R., 1999. Vitamin D receptor displaysDNA binding and transactivation as a heterodimer with the retinoid X receptor,but not with the thyroid hormone receptor. J. Cell. Biochem. 75, 462–480.

Thummel, K.E., Brimer, C., Yasuda, K., Thottassery, J., Senn, T., Lin, Y., Ishizuka, H.,Kharasch, E., Schuetz, J., Schuetz, E., 2001. Transcriptional control of intestinalcytochrome P-4503A by 1alpha,25-dihydroxy vitamin D3. Mol. Pharmacol. 60,1399–1406.

van de Kerkhof, E.G., de Graaf, I.A., de Jager, M.H., Groothuis, G.M., 2007a. Inductionof phase I and II drug metabolism in rat small intestine and colon in vitro. DrugMetab. Dispos. 35, 898–907.

van de Kerkhof, E.G., de Graaf, I.A., de Jager, M.H., Meijer, D.K., Groothuis, G.M., 2005.Characterization of rat small intestinal and colon precision-cut slices as an invitro system for drug metabolism and induction studies. Drug Metab. Dispos.33, 1613–1620.

van de Kerkhof, E.G., de Graaf, I.A., Groothuis, G.M., 2007b. In vitro methods to studyintestinal drug metabolism. Curr. Drug Metab. 8, 658–675.

van de Kerkhof, E.G., de Graaf, I.A., Ungell, A.L., Groothuis, G.M., 2008. Induction ofmetabolism and transport in human intestine: validation of precision-cut slicesas a tool to study induction of drug metabolism in human intestine in vitro. DrugMetab. Dispos. 36, 604–613.

van de Kerkhof, E.G., Ungell, A.L., Sjoberg, A.K., de Jager, M.H., Hilgendorf, C., deGraaf, I.A., Groothuis, G.M., 2006. Innovative methods to study human intestinaldrug metabolism in vitro: precision-cut slices compared with using chamberpreparations. Drug Metab. Dispos. 34, 1893–1902.

Wang, H., Kawashima, H., Strobel, H.W., 1996. cDNA cloning of a novel CYP3A fromrat brain. Biochem. Biophys. Res. Commun. 221, 157–162.

Wang, H., Strobel, H.W., 1997. Regulation of CYP3A9 gene expression by estrogenand catalytic studies using cytochrome P450 3A9 expressed in Escherichia coli.Arch. Biochem. Biophys. 344, 365–372.

Xu, Y., Iwanaga, K., Zhou, C., Cheesman, M.J., Farin, F., Thummel, K.E., 2006. Selec-tive induction of intestinal CYP3A23 by 1alpha,25-dihydroxyvitamin D3 in rats.Biochem. Pharmacol. 72, 385–392.

Zhang, Q.Y., He, W., Dunbar, D., Kaminsky, L., 1997. Induction of CYP1A1 by beta-naphthoflavone in IEC-18 rat intestinal epithelial cells and potentiation ofinduction by dibutyryl cAMP. Biochem. Biophys. Res. Commun. 233, 623–626.

Zierold, C., Mings, J.A., Deluca, H.F., 2006. 19nor-1,25-dihydroxyvitamin D2 specifi-cally induces CYP3A9 in rat intestine more strongly than 1,25-dihydroxyvitaminD3 in vivo and in vitro. Mol. Pharmacol. 69, 1740–1747.

216

217

APPENDIX A2 Khan AA, Chow EC, Porte RJ, Pang KS and Groothuis GM (2009) Expression and regulation of the bile acid transporter, OSTα-OST in rat and human intestine and liver. Biopharm Drug Dispos 30:241-258

BIOPHARMACEUTICS & DRUG DISPOSITIONBiopharm. Drug Dispos. 30: 241–258 (2009)

Published online in Wiley InterScience

(www.interscience.wiley.com) DOI: 10.1002/bdd.663

Expression and Regulation of the Bile Acid Transporter,OSTa-OSTb in Rat and Human Intestine and Liver

Ansar A. Khana,�, Edwin C. Y. Chowb, Robert J. Portec, K. Sandy Pangb and Geny M. M. Groothuisa

aPharmacokinetics, Toxicology and Targeting, Department of Pharmacy, University of Groningen, The NetherlandsbDepartment of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, CanadacDepartments of Hepatobiliary Surgery and Liver Transplantation, University of Groningen, University Medical Center Groningen,

The Netherlands

ABSTRACT: The regulation of the OSTa and OSTb expression was studied in the rat jejunum,ileum, colon and liver and in human ileum and liver by ligands for the farnesoid X receptor (FXR),pregnane X receptor (PXR), vitamin D receptor (VDR) and glucocorticoid receptor (GR) usingprecision cut tissue slices. The gradient of protein and mRNA expression in segments of theintestine for rOSTa and rOSTb paralleled that of rASBT. OSTa and OSTb mRNA expression,quantified by qRT-PCR, in rat jejunum, ileum, colon and liver, and in human ileum and liver waspositively regulated by FXR and GR ligands. In contrast, the VDR ligand, 1,25(OH)2D3 decreasedthe expression of rOSTa-rOSTb in rat intestine, but had no effect on human ileum, and rat andhuman liver slices. Lithocholic acid (LCA) decreased the expression of rOSTa and rOSTb in ratileum but induced OSTa-OSTb expression in rat liver slices, and human ileum and liver slices. ThePXR ligand, pregnenolone-16a carbonitrile (PCN) had no effect. This study suggest that, apart fromFXR ligands, the OSTa and OSTb genes are also regulated by VDR and GR ligands and not by PXRligands. This study show that VDR ligands exerted different effects on OSTa-OSTb in the rat andhuman intestine and liver compared with other nuclear receptors, FXR, PXR, and GR, pointing tospecies- and organ-specific differences in the regulation of OSTa-OSTb genes. Copyright r 2009John Wiley & Sons, Ltd.

Key words: OSTa-OSTb; regulation; nuclear receptors; intestinal slices; liver slices

Introduction

Bile acids (BA) undergo extensive enterohepaticcycling and are actively reabsorbed in theterminal part of the ileum, the bile duct epithelialcells (BEC) [1] and the renal proximal tubularcells [2,3]. They play an important role in theregulation of bile acid synthesis and cholesterolhomeostasis. The primary transporter involved

in the absorption of bile acids is the sodiumdependent bile acid transporter, ASBT(SLC10A2) [4], that is expressed along the apicalsurface of ileocytes, BEC and renal proximaltubular cells. In enterocytes, bile acids areeffluxed out of the cells into the portal circula-tion, and may be transported back to theintestinal lumen. Several basolateral bile acidtransporters such as truncated ASBT (tASBT),MRP3 and MRP4, showing affinity towards bileacid transport have been proposed [5–8].Although MRP3 was shown to transport bilesalts and regulated by chenodeoxycholic acid(CDCA) in human ileum [7], its role in ileal bile

*Correspondence to: Department of Pharmacy, Pharmacokinetics, Toxicology and Targeting, A. Deusinglaan 1, 9713AV Groningen, The Netherlands.E-mail: [email protected]

Received 19 January 2009Revised 12 May 2009

Accepted 26 May 2009Copyright r 2009 John Wiley & Sons, Ltd.

218

salt absorption may not be significant, sincemrp3�/� mice failed to show any apparent defectin bile acid absorption [9].

Recently, Wang et al. [10] identified an organicsolute transporter (OST) consisting of two halftransporters, a and b (OSTa and OSTb), in theskate, Raja ernacea. Subsequently, rodent andhuman OSTa-OSTb orthologues that are able tomediate sodium independent transport of organ-ic anions, bile acids and sterols in transfectedXenopus oocytes were identified [11]. Theexpression of OSTa and OSTb are shown toparallel that of ASBT expression in enterocytesalong the length of the intestine and wereco-incident with ASBT in BECs and renalproximal tubular cells of rat, mouse and human[11,12]. The OSTa and OSTb proteins are found tobe localized at the basolateral membrane andcatalogued as the ileal bile acid basolateraltransporter in the mouse [12], since bile acidhomeostasis was perturbed in the Osta knockoutmouse [13,14]. The mouse and human OSTa-OSTb genes are regulated by the farnesoid Xreceptor (FXR) and the liver X receptor a (LXRa)[15–17]. Both FXR and LXRa heterodimerizewith the retinoic acid X receptor a (RXRa), and,upon ligand binding, the resulting complex bindsto the inverted repeat-1 (IR1) in the promoters ofOSTa and OSTb, thereby increasing their expres-sion. Furthermore, human and mouse OSTa andOSTb promoters are endowed with binding sitesfor the transcription factors, hepatocyte nuclearfactor 4a (HNF4a) [17] and liver receptor homo-log protein-1 (LRH-1) [16,18].

Studies on rodent and human OSTa-OSTbgenes in the intestine and liver usually entailuse of FXR and LXRa ligands on immortalizedcell lines such as CT26, Caco-2, Huh-7 andHepG2 cells [15,17,19]. However, these cell lineslack the normal expression of various nuclearreceptors, transporters and coactivators, and areunable to reflect the regulation in distinctsegmental regions of OSTa and OSTb genes inintestine. In the rat, the regulation of rOSTa-rOSTbgenes has not been studied in great detail. Landrieret al. [15] reported on the induction of hOSTaand hOSTb genes by CDCA, the FXR ligand,in human ileum biopsies after 4h in culture.However, evidence for the regulation of hOSTa-hOSTb in human livers was predominantly

obtained indirectly from analysis of the livers ofpatients with cholestatic disease [19,20]. In themouse in vivo, the regulation of Osta-Ostb by FXRin the intestine was shown [16]. In this study weinvestigated whether OSTa and OSTb genes wereregulated by ligands for the vitamin D receptor(VDR) and glucocorticoid receptor (GR) in the ratand human liver and intestine, since these nuclearreceptors were reported to regulate ASBT [21–23],the bile acid transporter that was under negativeregulation by FXR in mouse, rabbit and human butnot in rat intestine [24–26]. Precision-cut tissueslices were used from the rat intestine (jejunum,ileum and colon) and liver and human ileum andliver, and the effects of VDR and GR ligands arecompared with those of FXR on the regulation ofthe mRNA expression of the OSTa and OSTbgenes. In addition, the involvement of PXR in theregulation of OSTa and OSTb genes was alsoinvestigated. This ex vivo model enables to studythe regulation of genes of interest under controlledand nearly physiological conditions directly, andallowed the comparison of direct effects of ligandsin different organs under identical conditions[27,28].

Materials and Methods

Male Wistar (HsdCpb:WU) rats weighing about230–250 g were purchased from Harlan (Horst,The Netherlands). Pieces of human liver andileum tissue were obtained as surgical wastefrom the University Medical Center, Groningen(UMCG) with the informed consent of thepatients/donors. 1,25(OH)2D3 in ethanol waspurchased from BIOMOL Research Laboratories,Inc., Plymouth Meeting, PA. Chenodeoxy-cholic acid (CDCA) and lithocholic acid (LCA)were purchased from Calbiochem, San Diego,California, dexamethasone was obtained fromGenfarma bv, Maarssen. Ethanol, methanol andDMSO were purchased from Sigma-AldrichChemical Co. (St Louis, MO); gentamicinand Williams’s medium E with glutamax-Iand amphotericin B (Fungizone)-solution wereobtained from Gibco (Paisley, UK). D-Glucoseand HEPES were from ICN Biomedicals, Inc.(Eschwege, Germany). University of Wisconsin

A.A. KHAN ET AL.242

Copyright r 2009 John Wiley & Sons, Ltd. Biopharm. Drug Dispos. 30: 241–258 (2009)DOI: 10.1002/bdd

219

organ preservation solution (UW) was obtainedfrom Du Pont Critical Care, Waukegab, Illinois,USA. Low gelling temperature agarose, budiso-nide (BUD) and pregnenolone-16a carbonitrile(PCN) were purchased from Sigma–Aldrich (StLouis, MO). RNAeasy mini columns were ob-tained from Qiagen, Hilden, Germany. Randomprimers (500 mg/ml), MgCl2 (25mM), RT buffer(10X), the PCR nucleotide mix (10mM), AMVRT(22U/ml) and RNasin (40U/ml) were purchasedfrom Promega Corporation, Madison WI, USA.Assay-on-DemandTM human GAPDH primersand probe for the Taqman analysis were pur-chased from Applied Biosystems, Warrington,UK. All SYBR Green primers were purchasedfrom Sigma Genosys. The Taq Master Mixes wasprocured from Eurogentech. The rabbit anti-ratOsta and Ostb antibodies were generous giftsfrom Dr Ned Ballatori (Rochester, New York,USA). The secondary antibody, Alexa Fluor-488anti-rabbit immunoglobulin (IgG) was purchasedfrom Invitrogen, Molecular Probes, Eugene, OR,USA. All reagents and materials used were of thehighest purity that is commercially available.

Experimental protocols

All experimental protocols involving animalswere approved by the Animal Ethical Committeeof the University of Groningen. Experimentalprotocols involving human tissue (liver andileum) were approved by the Medical EthicalCommittee of the UMCG.

Preparation of rat and human intestinal and liverslices

The small intestine, colon and liver were excisedfrom the rat under isoflurane/O2 anaesthesia. Thesmall intestine and colon were immediately placedinto ice-cold Krebs-Henseleit buffer supplementedwith 10mM HEPES, 25mM sodium bicarbonateand 25mM D-glucose, pH 7.4 (KHB), saturatedwith carbogen (95% O2/5% CO2) and stored on iceuntil preparation of the slices. The rat liver wasstored in ice-cold UW until slicing. Pieces ofhuman liver tissue were obtained from patientsundergoing partial hepatectomy for the removal ofcarcinoma (PH livers) or from redundant parts ofdonor livers remaining after split-liver transplan-tation (Tx livers) as described previously by Olinga

et al. [29]. Human ileum tissue was obtained as apart of the surgical waste after resection of the ileo-colonic part of the intestine in colon carcinomapatients. After surgical resection, the ileum tissuewas placed immediately inice-cold carbogenated KHB. Human liver andileum donor characteristics are as reported earlier[30]. Human liver and ileum slices were preparedwithin 30–60min after resection. Rat and humanintestinal and liver slices were prepared accordingto the published methods [29,31,32].

Induction studies

Precision-cut slices, prepared from rat intestine(jejunum, ileum and colon) and human ileumwere incubated individually in 12-well steriletissue culture plates (Grenier bio-one GmbH,Frickenhausen, Austria) containing 1.3ml Wil-liams medium E supplemented with D-glucose(final concentration of 25mM), gentamicin sulfate(50 mg/ml), amphotericin/fungizone (250 mg/ml)and saturated with carbogen. The plates wereplaced in humidified plastic container kept at371C and continuously gassed with carbogen andshaken at 80 rpm. Intestinal slices were incubatedwith 1,25(OH)2D3 (final concentrations of 5 nM,10 nM and 100 nM), CDCA (final concentration of50 mM), LCA (final concentrations of 5 mM and10 mM), DEX (final concentrations of 1 mM and50 mM), BUD (final concentration of 10 nM)and PCN (final concentration of 10 mM) addedas a 100-times concentrated stock solution inethanol (1,25(OH)2D3), methanol (CDCA andLCA) or DMSO (DEX, BUD and PCN). Higherconcentrations of CDCA (100 mM) and LCA(50 mM) were toxic to the intestinal slices. Ratintestinal slices were incubated for 12 h, since at24 h, the expression of villin was found to bedecreased. Human ileum slices were incubatedfor 8 h and 24 h; villin expression was stable up to24 h. Data are presented for 24 h only, since theresults obtained at 24 h were not different fromthose obtained at 8 h. Further, rat ileum sliceswere incubated in the presence of both1,25(OH)2D3 (final concentration of 100 nM) andCDCA (final concentration of 50 mM). Controlslices were incubated in Williams medium E(supplemented with D-glucose and gentamicinsulfate) with 1% ethanol, methanol, DMSO and

REGULATION OF OSTa-OSTb IN RAT AND HUMAN INTESTINE AND LIVER 243


220

ethanol1DMSO without ligands. From a single rator human tissue sample, six (rat intestine) or three(human ileum) replicate slices were subjected toeach experimental condition. After the incubation,these replicate slices were harvested, pooled andsnap-frozen in liquid nitrogen to obtain sufficienttotal RNA for qRT-PCR analysis. Samples werestored at �801C until RNA isolation. Theseexperiments were replicated in 3–5 rats and 3–5human ileum donors.

Liver slices (8mm diameter and 250mm thick)were incubated individually in sterile six-welltissue culture plates (Grenier bio-one GmbH,Frickenhausen, Austria) containing 3.2ml Williamsmedium E supplemented with D-glucose to afinal concentration of 25mM, gentamicin sulfate(50mg/ml) and saturated with carbogen. The plateswere placed in humidified plastic container kept at371C and continuously gassed with carbogen andshaken at 80 rpm. Liver slices were induced with1,25(OH)2D3 (final concentration, 100nM), CDCA(final concentration, 100mM), LCA (final concentra-tion, 50mM), DEX (final concentration, 50mM), BUD(final concentrations 10nM and 100nM) and PCN(final concentration, 10mM) added as a 100-foldconcentrated stock solution in ethanol (for1,25(OH)2D3), methanol (for CDCA and LCA) orDMSO (DEX, BUD and PCN). Rat and human liverslices were incubated for 8h and 24h. Data are

presented for the 24h time point, since the resultswere similar to those obtained at 8h. Control liverslices were incubated in supplemented Williamsmedium E with 1% ethanol, methanol and DMSOwithout inducers. From a single rat/single humanliver donor, three replicate slices were subjected toidentical incubation conditions. At the end of theincubation these replicate slices were harvested,pooled and snap-frozen in liquid nitrogen to obtainsufficient total RNA for qRT-PCR analysis. Sampleswere stored at �801C until RNA isolation. Theseexperiments were replicated in 3–5 rats and 4–5human liver donors.

RNA isolation and quantitative real time PCR(qRT-PCR)

Total RNA from rat and human intestine and liversamples was isolated using RNAeasy minicolumns from Qiagen according to the manu-facturer’s instruction. The RNA concentration andquality were determined by measuring the absor-bance at 260nm, 230nm and 280nm using aNanodrop ND100 spectrophotometer (Wilming-ton, DE, USA). The ratios of absorbance measuredat 260 over 280 and 230 over 260 were found to beabove 1.8. About 2mg of total RNA in 50ml wasreverse-transcribed into template cDNA as re-ported earlier by van de Kerkhof et al. [33].

Table 1. Sequence of oligonucleotides for quantitative Real-Time PCR, rat and human genes (SYBR and Taqmans analysis)

Gene Forward primer (50-30) Reverse primer (50-30) Gene banknumber

rVillin GCTCTTTGAGTGCTCCAACC GGGGTGGGTCTTGAGGTATT XM_001057825rGAPDH CTGTGGTCATGAGCCCCTCC CGCTGGTGCTGAGTATGTCG XR_008524rOSTa CCCTCATACTTACCAGGAAGAAGCTAC CCATCAGGAATGAGAAACAGGC XM_221376rOSTb TATTCCATCCTGGTTCTGGCAGT CGTTGTCTTGTGGCTGCTTCTT XM_238546rSHP CTATTCTGTATGCACTTCTGAGCCC GGCAGTGGCTGTGAGATGC NM_057133hVillin CAGCTAGTGAACAAGCCTGTAGAGGAGC CCACAGAAGTTTGTGCTCATAGGC NM_007127ahGAPDH Assay-by-DesignTM ID - Hs99999905_m1

(Applied Biosystems)NM_002046

6FAM–GCGCCTGGTCACCAGGGCTGCTTTT – NFQarASBT ACCACTTGCTCCACACTGCTT CGTTCCTGAGTCAACCCACAT U07183

Probe - 6FAM - CTTGGAATGCCCCTTTGCCTCT-TAMRA

ahOSTa AGATTGCTTGTTCGCCTCC TCACCACTTGGGGATCATTT NM_152672Probe - 6FAM - CTCAAGTGATGAATTGCCACCTCCTCATACTGG-TAMRA

ahOSTb CAGGAGCTGCTGGAAGAGAT GACCATGCTTATAATGACCACCA NM_178859Probe - 6FAM - CGTGTGGAAGATGCATCTCCCTGGAATCATTC-TAMRA

aPrimer sets for rat and human Taqmans Gene analysis.

r, rat genes; h, human genes.

A.A. KHAN ET AL.244


221

Quantitative real time PCR (qRT-PCR) for therat and human genes of interest was performedusing primer sequences listed in Table 1 by twodetection systems, SYBR Green or Taqmans

analysis according to the availability of primersets. All primer sets were analysed using BLASTnto ensure primer specificity for the gene of interest(http://www.ncbi.nlm.nih.gov/BLAST/). For theSYBR Green, �50ng of cDNAwas used in a totalreaction mixture of 20ml. For the Taqmans

analysis �250ng of cDNA was used in a totalreaction mixture of 10ml. The PCR conditionswere similar to those described in an earlier report[30]. All samples were analysed in duplicates in384-well plates using ABI7900HT from AppliedBiosystems. Appropriate controls, consisting ofwater (with water instead of total mRNA, whichhas been subjected to the reverse transcriptionprotocol) and the mRNA control (isolated mRNAwhich has not been subjected to reverse transcrip-tion protocol) were subjected to qRT-PCR todetermine potential primer dimer formation andcontamination of DNA in the isolated samples,respectively. None of the primers showed dimerformation. In addition, total RNA from thesamples for the preparation of cDNA appearedto be free of DNA contamination. Dissociationcurves showed a single homogenous product. Thecomparative threshold cycle (CT) method [34] wasused for relative quantification, where CT isinversely related to the abundance of mRNAtranscripts in the initial sample. The mean CT ofthe duplicate measurements was used to calculatethe difference between the CT for the gene ofinterest and that of the reference gene (villin forintestine and GAPDH for liver) (DCT), which wascompared with the corresponding DCT of thesolvent control (DDCT). Data are expressed as foldinduction or repression of the gene of interestaccording to the formula 2�(DDCT).

Immunolocalization of OSTa and OSTb in ratintestine and liver

The rat intestine was washed with 0.9% salineand cut into small pieces. The intestinal tissuewas filled with Tissue Tek (Sakura FinetekEurope, The Netherlands), then quickly frozenin cold isopentane (kept at �801C) and storedat �801C. Sections of 5 mm were cut in a cryostat

(Lieca CM 3050) at �201C and placed on super-frost plus slides (Menzel, Braunchweig, Germany).Indirect immunofluorescence detection was per-formed using Osta and Ostb antibodies accordingto the protocol described previously [11]. In brief,tissue sections were fixed with acetone cooled to�201C for 10min. Nonspecific binding sites wereblocked with 1% bovine serum albumin (BSA) inphosphate buffered saline containing 0.05% TritonX 100. Primary antibodies were diluted in theblocking buffer, Osta (m315) (1:200) and Ostb(mB90) (1:150), and incubated with the sections for2h at room temperature. Subsequently, the sec-tions were incubated with the secondary antibody(Alexa Flour-488) at a dilution of 1:50 in blockingbuffer for 1h at room temperature.

Data analysis

All values were expressed as themean7SD. All data(fold-induction and DDCT) were analysed by pairedStudent’s t-test using SPSS Version 16 for significantdifferences between the means. The value po0.05was considered as significant.

Results

Expression of rASBT, rOSTa and rOSTb in ratintestine and liver

The mRNA expression of rASBT, rOSTa andrOSTb genes was clearly detectable, not only inrat ileum but also in the jejunum and colon byqRT-PCR (Figure 1). Expressions of rASBT,rOSTa and rOSTb mRNA were significantlyhigher in rat ileum (average threshold cycles(CT) 23 for rASBT, 17 for rOSTa and 16.5 forrOSTb) compared with those for the jejunum(29 for rASBT, 20 for rOSTa and rOSTb) and colon(30 for rASBT, 24 for rOSTa and 22 for rOSTb).There was no difference between the CT values inthe tissue and those in the slices at the start of theincubation. The gradient in expression of rOSTa,based on the DCT values relative to villin(jejunum:ileum:colon5 1:3.8:0.2), was differentfrom that of rOSTb (jejunum:ileum:colon5 1:8:0.9)and rASBT (jejunum: ileum:colon5 1:130:4)(Figure 1). In rat liver, the average thresholdcycles (CT) for rOSTa (30) and rOSTb (33) were



222

much higher than in intestine. These distributionswere further confirmed at the protein level byimmunohistochemistry (Figure 2). In the ratintestine, both rOSTa and rOSTb were detected atthe basolateral membrane of the epithelial cells inall regions of the intestine (Figure 2). As expected,the highest expression was detected in ileum and alow but clearly detectable expression wasobserved in the colon and to a lesser extent inthe jejunum. In addition, a decreasing expressionfrom the tip of villus to the crypts was found. Inthe rat liver, rOSTa-rOSTbwas visibly detectable atthe basolateral membrane of the BEC of the largerbile ducts and only a low expression was observedat the basolateral membrane of the hepatocyte.

Regulation of rOSTa and rOSTb in rat intestineand liver by bile acids

The CT values of rOSTa and rOSTb genes were notaffected during the preparation of slices and similarCT values were found in the slices at the start of theincubation and in freshly isolated tissue (data notshown). However, the expression of rOSTa andrOSTb genes was significantly altered duringincubation of slices at 371C, but the effects differedin different segments of the rat intestine and liverslices (Figure 3A, B). Incubation of rat jejunumslices for 12h, either in the absence or presence of

various solvents, did not alter the expression ofrOSTa but rOSTb expression was significantlyinduced. In rat ileal slices, the expression of bothrOSTaand rOSTbwere significantly elevated (1.5- to2-fold) (Figure 3A). In rat colon slices, the expressionof both rOSTa and rOSTb was significantly dec-reased (3-fold) during incubation (Figure 3A). In ratliver slices, the mRNA expression of the rOSTawasnot altered, whereas rOSTbwas significantly down-regulated during 24h of incubation (4-fold) regard-less of the solvent used (Figure 3B).

The FXR ligand, CDCA, moderately induced(1.5- to 2-fold) the expression of rOSTa andrOSTb in the jejunum, ileum and liver, comparedwith solvent treated control slices (Figures 4A,B,D). The induction of rOSTa and rOSTb wasdramatically higher in the colon, amounting to25-fold for rOSTa and 45-fold for rOSTb (Figure 4C).In contrast, incubation of rat intestine (jejunum,ileum and colon) and liver slices with LCA, anFXR ligand, with affinity towards VDR [35],exhibited VDR dependent regulation of CYP3Aisozymes [36], displayed different effects on rOSTaand rOSTb genes. LCA significantly decreased theexpression of rOSTaand rOSTb in the ileum (Figure4B), and rOSTa expression in the rat jejunumwithout affecting rOSTb expression (Figure 4A). Inrat colon, LCA showed a strong, significant up-regulation (up to 10-fold) of the rOSTb genewithout significantly affecting the rOSTa gene(Figure 4C). In liver slices, a small but significant(1.5-fold) up-regulation of the rOSTa expressionwas found in the presence of LCA, whereas rOSTbexpression was decreased (Figure 4D). Further-more, both CDCA and LCA significantly inducedthe SHP expression (�2-fold induction) in slices ofall regions of the rat intestine and liver (for theeffect of CDCA on ileum, see Figure 6B; data notshown for other tissues). This observation on theup-regulation of SHP was expected for FXRligands upon incubation with bile salts, andconfirms that the FXR pathway was intact in theslices, since these were able to respond to bile saltsas signalling agents of FXR.

Regulation of rOSTa and rOSTb in rat intestineand liver by the VDR ligand

Incubation of rat intestinal slices in the presenceof the VDR ligand, 1,25(OH)2D3, resulted in a

Figure 1. mRNA expression of rASBT, rOSTa and rOSTbtransporters relative to villin expression in intestinal tissue(jejunum, ileum and colon) of the Wistar rat. The averagethreshold cycles (CT) for rASBT in jejunum was 29, in ileum 23and in colon 30.The average CT for rOSTa and rOSTb injejunum was 20 and 20, in ileum 17 and 16.5 respectively, andin colon 24 and 22, respectively. The mRNA expression ofrASBT, rOSTa and rOSTb transporters relative to villin inileum and colon was expressed relative to that in the jejunum,which was set to unity. Each bar represents the results of threeanimals (n5 3)7SD. �po0.05; ��po0.001

A.A. KHAN ET AL.246


223

Figure 2. Indirect immunofluorescence showed that rOSTa and rOSTbwere detected at the basolateral surface of the enterocytesin the jejunum, ileum and colon of the Wistar rat. In the liver, rOSTa and rOSTb proteins are predominantly localized in the bileduct epithelial cells and a low expression was observed in the hepatocytes. Control rat intestinal and liver sections incubatedwithout primary antibodies for rOSTa and rOSTb did not show any fluorescence (results not shown)



224

parallel decrease in expression of rOSTa andrOSTb in jejunum, ileum and colon in dose-adependent manner (Figures 5A, B and C). Further-more, 1,25(OH)2D3 significantly induced theexpression of CYP3A1 (41000-fold induction), aVDR responsive gene in slices of all regions of therat intestine [30]. The up-regulation of CYP3A1 by1,25(OH)2D3 confirmed that the slices were able torespond to the VDR ligand. In contrast, incubationof liver slices in the presence of 100nM

1,25(OH)2D3 did not affect rOSTa and rOSTbexpression (Figure 5D) but at the same timeinduced VDR mRNA expression, as expected(unpublished observation). Rat ileal slices, whenco-incubated with 1,25(OH)2D3 (100nM) and

CDCA (50mM), showed significant down-regula-tion of rOSTa and rOSTb (fold decrease–rOSTa 0.5 and of rOSTb 0.7; po0.05); theobservations were identical to those for1,25(OH)2D3 incubation alone (0.5-fold decreaseof rOSTa and 0.7-fold of rOSTb; po0.05) andcontrasted those for CDCA, which inducedrOSTa and rOSTb (1.5-fold induction of rOSTaand 1.55-fold of rOSTb; po0.05) (Figure 6A).SHP expression was induced by CDCA (foldinduction, 2.2; po0.001) but not by 1,25(OH)2D3

(Figure 6B).

Regulation of rOSTa and rOSTb in rat intestineand liver by the GR and PXR ligands

Incubation of rat intestinal (jejunum, ileum andcolon) and liver slices with the GR/PXR ligand,DEX (1 mM and 50 mM for intestinal slices and50 mM for liver slices), significantly induced therOSTa and rOSTb expression in jejunum,colon and liver (Figures 7A, C, D) but not in theileum (Figure 7B). These results in the intestinalslices were displayed again with BUD (10nM),the specific GR ligand, which induced rOSTaand rOSTb expression in rat jejunum (Figure 7A)and colon (Figure 7C) but not in the ileum(Figure 7B). However, the PXR ligand, PCN(10mM), did not influence the rOSTa andrOSTb expression in all regions of the intestine(Figures 7A, B, C, D). In contrast to DEX, neitherPCN nor BUD (10nM and 100nM) induced rOSTaand rOSTb expression in liver slices during 8h ofincubation (data not shown), whereas BUD(100nM) significantly induced rOSTa expression(fold induction 2.9; po0.05) (Figure 7D) during24h of incubation. Further, to confirm the intact-ness of the GR and PXR response in the ratintestinal (jejunum, ileum and colon) and liverslices, PXR, CYP3A1 and CYP3A9 mRNAexpression were analysed in these samples. TheGR ligands, BUD and DEX, significantly inducedPXR and CYP3A9 mRNA in all the segments ofthe intestine and in liver slices [30]. The PXRligands, PCN and DEX, induced CYP3A1 andCYP3A9 in a region specific manner in ratintestine and liver slices [30]. This observationconfirmed the intactness of the GR and PXRnuclear receptor pathways in the rat intestinal andliver slices.

Figure 3. The effect of incubation at 371C on rat jejunum,ileum, colon (12 h) and liver slices (8 h and 24h) on theexpression of rOSTa and rOSTb genes. The mRNA expressionof rOSTa and rOSTb genes relative to villin (intestine) andGAPDH (liver) was quantified by real-time PCR andexpressed with respect to the control slices without incubation(0 h) for each of the intestinal segments, which were set tounity. Results are expressed as mean7SD of 4–5 rats.�po0.05; ��po0.001

A.A. KHAN ET AL.248


225

Expression and regulation of hOSTa, hOSTb inthe human ileum and liver

The mRNA expression of hOSTa and hOSTbrelative to GAPDH in the ileum was 2- to 3-foldhigher than that in human liver, which showed alow expression. The expression of hOSTa andhOSTb mRNA in ileum slices was induced orremained unaltered upon incubation, with orwithout the solvents for 24 h (average CT at 0 h,26.0 for both hOSTa and hOSTb and at 24 h, 25.0for hOSTa and 24.0 for hOSTb) (Figure 8A).CDCA induced hOSTa in ileum slices 6- to 7-fold,but the effect on hOSTb expression was smaller,only a 2.5-fold induction was observed, and wasconsistently observed in all the human ileumdonors (Figure 8B). LCA, but not 1,25(OH)2D3

moderately induced the hOSTa and hOSTb

expression in each of the five human ileum sliceexperiments (2- to 3-fold induction), but thelevels failed to reach statistical significance dueto the larger variation existing among the humanileum donor samples (Figures 8B and C). DEXand BUD induced hOSTa and hOSTb expressionin all but one of the human ileum donors (Figure8D). CYP3A4 expression, a VDR, PXR and GRresponsive gene was significantly induced inthese samples by 1,25(OH)2D3, LCA, DEX andBUD but not by CDCA [30]. Furthermore, CDCAand LCA significantly induced SHP expression(unpublished observations), confirming the intact-ness of the PXR, VDR, GR and FXR pathways inthe ileum slices.

The incubation conditions significantlydecreased the expression (2-fold) of the hOSTa

Figure 4. rOSTa and rOSTb genes are induced by FXR ligands. Rat intestine slices (jejunum (A), ileum (B) and colon (C)) weretreated with CDCA (50 mM) and LCA (5mM and 10 mM) for 12h, and liver slices (D) were treated with 100mM of CDCA and 50mM ofLCA for 24h. The mRNA expression of rOSTa and rOSTb genes relative to villin (intestine) and GAPDH (liver) was quantified byreal-time PCR and expressed with respect to the solvent treated controls, which were set to unity. Results are expressed asmean7SD of 4–5 rats. �po0.05; ��po0.001



226

Figure 5. The VDR ligand, 1,25(OH)2D3 decreases the expression of rat rOSTa and rOSTb genes in jejunum (A), ileum (B),colon (C) and liver (D) slices. Rat jejunum, ileum and colon slices were treated with 5 nM, 10nM and 100nM of 1,25(OH)2D3 for12h. Rat liver slices were treated with 100 nM of 1,25(OH)2D3 for 24 h. The mRNA expression of rOSTaand rOSTb genes relative tovillin (intestine) and GAPDH (liver) were quantified by real-time PCR and expressed with respect to the solvent treated controls,which were set to unity. Results are expressed as mean7SD of 4–5 rats. �po0.05; ��po0.001

Figure 6. The VDR ligand, 1,25(OH)2D3, decreases the expression of rat rOSTa and rOSTb genes in ileum, also in the presence ofFXR ligand, CDCA (A), 1,25(OH)2D3 did not affect the induction of SHP by CDCA in ileum slices (B). Rat ileum slices weretreated with 100 nM of 1,25(OH)2D3, 50mM of CDCA and 100nM of 1,25(OH)2D3150 mM of CDCA for 12 h. The mRNA expressionof rOSTa and rOSTb and short heterodimer protein (SHP) genes relative to villin were quantified by real-time PCR and expressedwith respect to solvent treated controls, which were set to unity. Results are expressed as mean7SD of 4–5 rats. �po0.05;��po0.001

A.A. KHAN ET AL.250


227

in human liver slices (CT at 0 h, 27.0 and at 24 h,28.0), whereas hOSTb expression was signifi-cantly elevated (2-fold) (CT at 0 h, 32.0 and at 24 h,31.0) (Figure 9A); these changes were not affectedby the type of solvent used. Incubation of humanliver slices with CDCA strongly induced hOSTa(15-fold induction) and hOSTb (110-fold induc-tion) expression. LCA moderately induced hOS-Ta and hOSTb expression (2.5-fold and 3.5-foldrespectively; po0.05) (Figure 9B). 1,25(OH)2D3

exerted only a minor decrease in hOSTa andhOSTb expression in 3 out of 4 livers (Figure 9C).DEX significantly decreased hOSTa expression

and induced hOSTb expression in 3 out of 5 livers(Figure 9D). The intactness of the VDR, PXR, FXRand GR pathways in the slices was confirmed byincreased CYP3A4 [30], SHP and PXR expression(unpublished observations).

Discussion

In this study, precision-cut intact tissue slices ofrat intestine (jejunum, ileum and colon), and ratliver, and human ileum and liver were used toinvestigate the species, organ and region depen-

Figure 7. The GR ligands, dexamethasone (DEX) and budesonide (BUD), but not the PXR ligand, pregnane 16-a carbonitrile(PCN) induce the expression of rat rOSTa and rOSTb genes in jejunum (A), colon (C), but not in ileum (B) and liver (D) slices.Rat jejunum, ileum and colon slices were treated with 1 mM and 50mM of DEX, 10 nM of BUD, and 10 mM of PCN for 12h. Ratliver slices were treated with 50mM of DEX, 10 nM and 100nM of BUD, and 10mM of PCN for 24h. The mRNA expression ofrOSTa and rOSTb genes relative to villin (intestine) and GAPDH (liver) were quantified by real-time PCR and expressedwith respect to solvent treated controls, which were set to unity. Results are expressed as mean7SD of 4–5 rats.�po0.05; ��po0.001



228

dent regulation of the basolateral bile acid half

transporters, OSTa and OSTb by FXR, VDR, PXR

and GR ligands at the level of mRNA and the

data are summarized in Table 2. As shown by

both qRT-PCR and immunohistochemistry (Figures

1 and 2), rOSTa and rOSTb were expressed in all

regions of the rat small intestine and colon of Wistar

rats, with the highest expression in ileum, where

most of the bile acids are actively reabsorbed [4].

Although the absolute expression of these genes

cannot be determined by the applied qRT-PCR

technique, the relative expression of these genes

along the length of the intestine can be assessed.

The expression patterns of rOSTa and rOSTb in the

rat intestine paralleled that of rASBT as reported

earlier in the mouse [12], the Sprague-Dawley rat

and man [11], and their concomitant presence

supports the hypothesis that they are both involved

in the facilitation of bile acid absorption. The ratio

of their expression in ileum relative to that in

jejunumwas higher inWistar rats (3.8-fold for OSTaand 8-fold for OSTb, when normalized for villin

expression) (Figure 1) than the 2-fold difference

reported for Sprague-Dawley rats [11]. The rOSTaand rOSTb are expressed at the basolateral surface

of the ileal enterocyte with a decreasing gradient of

expression from the villus tip to the crypts in the

Wistar rats, which is similar to the earlier reports in

the mouse and the Sprague-Dawley rats [11,37]. In

the livers of Wistar rats, rOSTa and rOSTb proteins

Figure 8. The effect of incubation time (24 h) and the solvent controls on the expression of human organic solute transporter,hOSTa and hOSTb genes in human ileum slices (A), The mRNA expression of hOST a and hOST b genes relative to villin wasquantified by real-time PCR and expressed with respect to the control slices before incubation, which were set to unity. The FXRligands, CDCA and LCA, induced (B), the VDR ligand, 1,25(OH)2D3 (C) did not induce, the GR/PXR ligand, DEX and the GRligand, BUD and (D) induced hOSTa and hOSTb gene expression in all the experiments but failed to reach statistical significance.Human ileum slices were treated with 10 to 100nM of 1,25(OH)2D3, 50mM of CDCA, 1 mM and 50 mM of DEX and 1mM of BUD for24h. The mRNA expression of hOSTa and hOSTstb genes relative to villin were quantified by real-time PCR and expressed withrespect to solvent treated controls, which were set to unity. Results are expressed as mean7SD of 4–5 human ileum donors.��po0.001

A.A. KHAN ET AL.252


229

were found to be expressed in detectable intensitiesat the basolateral membranes of the BEC (Figure 2).

Furthermore, rOSTa and rOSTb proteins were alsodetected, albeit at lower intensities, at the basolateral

Figure 9. The effect of incubation time (24 h) and the solvent controls on the expression of human organic solute transporter(hOST)a and hOSTb genes in human liver slices (A), The mRNA expression of hOSTa and hOSTb genes relative to GAPDH werequantified by real-time PCR and expressed with respect to solvent treated controls, which were set to unity. The FXR ligands,CDCA and LCA induced (B) and the VDR ligand, 1,25(OH)2D3 (C) did not affect the expression hOSTa and hOSTb genes. The GR/PXR ligand, DEX (D) significantly decreased the expression of hOSTa, but induced hOSTb gene in three out of five livers. Humanliver slices were treated with 100nM of 1,25(OH)2D3, 100mM of CDCA, 50mM of LCA and 50mM of DEX for 24h. mRNA expressionof hOSTa and hOSTb genes relative to GAPDH were quantified by real-time PCR and expressed with respect to solvent treatedcontrols, which was set to unity. Results are expressed as mean7SD of 4–5 human liver donors. �po0.05; ��po0.001

Table 2. Summary of the effects of VDR, FXR, PXR and GR ligands on the OSTa and OSTb expression in rat and human intestineand liver; n5 4–5 rats or 3–5 human ileum and liver donors

Ligand(s) Nuclear receptor Rat Human

Intestine Liver Ileum Liver

Jejunum Ileum Colon

rOSTa rOSTb rOSTa rOSTb rOSTa rOSTb rOSTa rOSTb hOSTa hOSTb hOSTa hOSTb

1,25(OH)2D3 VDR k k k k k k 2 2 2 2 k 2CDCA FXR/VDR m m m m m m m am m m m mLCA FXR/VDR k 2 k k 2 m m am m m m mDEX PXR/GR am am am 2 am am m am 2 am k bmPCN PXR 2 2 2 2 2 2 2 2 ND ND ND NDBUD GR m am 2 2 am am m am 2 am ND ND

induction; krepression; 2 no induction.amInduction in all experiments but with high variation between the experiments.bmInduction in three out of five experiments.ND, not done.



230

membranes of the hepatocytes, as documented inearlier reports [11]. However, their functional sig-nificance in hepatocytes has not been proven to date.

Previously, it was shown that both rat andhuman intestinal and liver slices adequatelyreflect the regulation of drug metabolizingenzymes and transporters as observed in vivo[27,38], and VDR, PXR, GR and FXR pathwaysremained intact [30]. The quality of total RNAisolated from fresh tissue (rat and human) and the0h slices prior to incubation was similar and nochange was observed during the period of coldstorage and slicing in the average CT for rOSTa,rOSTb, rVDR, rFXR and rPXR genes, as well as thesignature genes of the various nuclear receptors.Viability (ATP levels) and housekeeping genes(villin and GAPDH) remained constant during theincubation (data not shown). The expression ofrOSTa and rOSTbmRNAwere moderately alteredduring incubation of rat intestinal and liver slices.In rat jejunum, the expression of rOSTb wassignificantly elevated after 12h of incubation. Incontrast, rat liver slices showed a significantdecrease in the expression of rOSTb withoutaffecting rOSTa expression. However, in the ratileum, rOSTa and rOSTb expression was signifi-cantly increased and in rat colon, rOSTa andrOSTb expression was significantly decreased.These changes in rOSTa and rOSTb expression indifferent segments of the rat intestine and liverduring incubation of the slices suggest that theexpression of the rOSTa and rOSTb genes isnormally regulated in vivo by endogenous factorswhich seem to be absent in the culture medium orby endogenously generated factors whose avail-ability is altered during incubation of the slices.

As reported earlier [15,16,19], CDCA, a highaffinity FXR ligand, was found to induce OSTa andOSTb genes in rat and human ileum and liver slices(Figures 4B, 4D, 8B, 9B). The induction of hOSTaand hOSTb genes in human ileum (6- to 7-fold) andliver (15- and 110-fold) slices by CDCA was muchstronger than that reported earlier in human ileumbiopsies incubated for 4h only, and in humanhepatoma cell lines, Huh 7 and HepG2 [15]. Theseresults show that the rat rOSTa and rOSTb genes,similar to human and mouse OSTaand OSTb genes[15,16] are responsive to CDCA in intact cells.

The presence of detectable amounts of rOSTaand rOSTb mRNA and protein (Figures 1 and 2)

and rFXR mRNA, not only in the ileum, but alsoin the jejunum and colon of the rat intestine [30],and the reported induction of Osta and Ostb genesby CDCA in cecum and colon of Slc10a2�/� mouseby Frankenberg et al. [16] prompted us to investi-gate the regulation of rat rOSTaand rOSTb genes inthe rat jejunum and colon by the FXR ligand,CDCA. Similar to what was observed for the ratileum, the rOSTa and rOSTb genes were alsosignificantly induced by CDCA in rat jejunumand colon (Figure 4A, C). This shows that, althoughthe basal expression pattern of rOSTa and rOSTbgenes varied widely along the length of the ratintestine, the half transporters were responsive tothe FXR stimulus, albeit to a different extent in allregions of the intestine. These results also show thatbile salts, despite being present at high concentra-tions in both jejunum and ileum lumen in vivo, donot play a decisive role in the basal expression ofrOSTa and rOSTb in the small intestine. In the ratcolon, the response of the rOSTa and rOSTbpromoters to CDCA appeared to be remarkablyhigher than in ileum, while the expression of FXR incolon was similar to ileum [30]. Based on theseresults, it is speculated that bile acids play a role inthe regulation of their own absorption by increasingtheir basolateral excretion in the intestine. Thedifference in the CDCA-induced response of rOSTaand rOSTb between ileum and colon might be dueto a higher intracellular concentration of CDCA inthe colon which might be the result of a differentbalance between uptake, excretion and/ormetabolism.

Further, the role of the nuclear receptors, GRand VDR in the regulation of rOSTa and rOSTbgenes is investigated by incubating rat jejunum,ileum, colon and liver, human ileum and liverslices with GR and VDR ligands. DEX was foundto significantly induce rOSTa and rOSTb expres-sion in rat jejunum, colon and liver, but themoderate induction of rOSTa and rOSTb expres-sion in rat ileum slices was found to be notsignificant (Figures 7A–D). In addition, in humanileum slices, both hOSTa and hOSTb geneexpression was induced by DEX (Figure 8D). Inhuman liver slices, DEX significantly decreasedthe expression of hOSTa but induced hOSTbexpression (Figure 9D). These results are the firstto show that rat and human OSTa and OSTbgenes are regulated by DEX in intestine and liver.

A.A. KHAN ET AL.254


231

The induction of OSTa and OSTb genes by DEXin rat intestine and liver, and human ileum islikely to be attributed to GR and not to PXR, sinceBUD, a specific GR ligand, also induced theexpression of OSTa and OSTb genes. The PXRligand, PCN, failed to alter rOSTa and rOSTb inrat intestinal slices. Furthermore GR ligandsinduce the trans-acting factor, LRH-1 (A.A.Khan et al, unpublished results), which isreported to be essential for the basal expressionof OSTa and OSTb [18]. However, whether theeffects of the GR ligands are indirectly mediatedthrough induction of HNF4a and LRH-1, ordirectly mediated through a potential GRE inthe OSTa and OSTb genes needs to be ascer-tained. These results on the induction of OSTaand OSTb by GR ligands further explain thedecreased loss of bile acids in the feaces andincreased bile acid absorption in the patientswith Crohn’s disease treated with BUD and DEX.It was reported that these patients have inducedASBT expression [22]. Furthermore, induction ofASBT was found in human ileum slices treatedwith GR ligands (A.A. Khan et al., unpublishedresults) with subsequent induction of OSTa andOSTb (Figure 8D). Thus, GR ligands simulta-neously increase ASBT, OSTa and OSTb expres-sion in human ileum slices.

In addition, our data also provide evidence onthe involvement of the VDR in the regulation ofrat rOSTa and rOSTb genes. 1,25(OH)2D3 exertedan inhibitory effect on the expression of rOSTaand rOSTb genes in rat jejunum, ileum and colonslices in a dose-dependent manner (Figure 5A–C)but had no effect in liver slices (Figure 5D). In thehuman ileum, hOSTa and hOSTb genes were notsignificantly altered by 1,25(OH)2D3 treatment,whereas in the human liver slices, hOSTaexpressionwas significantly decreased in all four livers, andthree out of four livers exhibited a 50% decreasein the expression of hOSTb (Figure 9C). Hence,the role of VDR on the regulation of the OSTgenes is different for hOSTa and hOSTb genes inhumans and appeared to differ among tissuesand in different species. The involvement of theVDR was further investigated with anothernatural VDR ligand, LCA, with affinity towardsFXR [35,39]. LCA was found to decreasethe expression of rOSTa and rOSTb genessignificantly in rat ileum (Figure 4B). However,

in rat liver, LCA induced rOSTa expressionwithout affecting the rOSTb expression(Figure 4D). This inductive effect of LCA on rOSTain rat liver was in contrast to that of 1,25(OH)2D3,

but paralleled that of CDCA suggesting that LCAacted as a FXR ligand [39]. However, LCA showedopposite results in rat jejunum and colon. In the ratjejunum, LCA significantly down-regulated rOSTawithout affecting rOSTb, whereas in rat colon, LCAsignificantly induced rOSTb without affecting therOSTa expression. These mixed results suggest thatLCA affects the expression of rOSTa and rOSTbgenes via both VDR and FXR, giving rise toinhibition and induction, respectively. The differenteffects of LCA on the rOSTa and rOSTb genes in ratintestine and liver are difficult to interpret butsuggest that the FXR-mediated effects predominatein rat colon and liver, whereas the VDR-mediatedeffects predominate in jejunum and ileum. For therat liver, this may be explained by the higherexpression of FXR compared with VDR in compar-ison with the intestine [30]. In human liver slices,LCA significantly induced the hOSTa and hOSTbexpression, similar to that of CDCA (Figure 9B),however, LCA induced hOSTa and hOSTb expres-sion in all the human ileum donors but failed toreach statistical significance (Figure 8B), suggestingthat the FXR regulation predominates in humans,which is in line with the lack of VDR-mediatedeffect by 1,25(OH)2D3 (Figure 8C). The results oninduction of hOSTaand hOSTb by LCA and CDCAin human livers are in line with those reported byZollner et al. [40] in human cholestatic livers. Basedon these results, it might be speculated that duringcholestasis, bile acids might play a role in the rescuephenomenon by inducing the OSTa/OSTb trans-porter present in the basolateral membranes ofhuman hepatocytes as was also suggested forMRP3 [41]. Together OSTa/OSTb and MRP3 playa protective role by increasing the bile acid effluxinto the blood from the hepatocytes. Furthermore,the different effects of LCA on the OSTa versusthe OSTb expression in rat jejunum, ileumand colon, and in human liver are noteworthybecause it is reported that the functional bile acidbasolateral transporter is a heterodimer of OSTaand OSTb proteins [10,42,43]. These results ne-cessitate further studies to investigate the effectof LCA on the formation of the functional OSTa-OSTb transporter.



232

To mimic the in vivo situation in which1,25(OH)2D3 was shown to increase the flux ofbile acids into the rat ileocytes by inducingrASBT [21], rat ileum slices were co-incubatedwith both 1,25(OH)2D3 and CDCA. 1,25(OH)2D3

completely abolished the CDCA-mediatedinduction of OSTa and OSTb (Figure 6A) despitethe presence of an intact FXR response, shown bythe induced rSHP expression (Figure 6B). Alto-gether, the results led to the postulate of anegative VDRE in the promoters of the rat rOSTaand rOSTb genes, as reported earlier for theparathyroid and CYP7A1 genes [44,45], thatoverrides the FXR-dependent positive regulationof rOSTa and rOSTb genes by CDCA. However,indirect effects of 1,25(OH)2D3 on the expressionof rOSTa and rOSTb genes cannot be ruled out.Further studies are needed to ascertain thishypothesis.

In conclusion, this study showed the inductionof hOSTa and hOSTb genes by the FXR ligand,CDCA, in intact human ileum and liver tissue,and confirmed the earlier reports of humanileum biopsies and HepG2 cells [15]. Inductionof rat rOSTa and rOSTb gene expression byCDCA in rat jejunum, ileum, colon and liversuggests that the rOSTa and rOSTb promoters areresponsive to FXR ligand, observations that aresimilar to the mouse and human. Furthermore,the rat but not human OSTa and OSTb genesare negatively regulated by the VDR ligand,1,25(OH)2D3. This data suggest that the toxicbile salt, LCA acts as a VDR ligand on ratrOSTa and rOSTb genes rather than as anFXR-ligand in jejunum and ileum, but acts asan FXR-ligand in the rat colon and liver, andin human ileum and liver. This study reportshere, for the first time, that the rat and humanOSTa and OSTb genes are not only positivelyregulated by FXR, but also positively regulatedby GR ligands. In conclusion, apart fromFXR, also VDR and GR ligands, which wereimplicated in the regulation of ASBT expres-sion in rat and human intestine and liver,regulate the mRNA expression of the OSTaand OSTb genes, as summarized in Table 2.However, the changes in expression of thesetwo half transporters is often not identical andthe physiological consequences remains to beelucidated.

Acknowledgements

The authors thank Dr Ned Ballatori (Rochester,New York, USA) for the generous gift of the ratrOSTa and rOSTb antibodies, Dr Vincent B.Nieuwenhuijs (University Medical Center,Groningen) for providing the human ileumtissue, and Mrs A. M. A. van Loenen-Weemaesfor her excellent technical assistance with theimmunohistochemical staining. This work wassupported in part by the Canadian Institutes forHealth Research, MOP89850.

References

1. Kullak-Ublick GA, Becker MB. Regulation of drugand bile salt transporters in liver and intestine.Drug Metab Rev 2003; 35: 305–317.

2. Dawson PA, Haywood J, Craddock AL, et al.Targeted deletion of the ileal bile acid transportereliminates enterohepatic cycling of bile acids inmice. J Biol Chem 2003; 278: 33920–33927.

3. Weinberg SL, Burckhardt G, Wilson FA. Taurocholatetransport by rat intestinal basolateral membranevesicles. Evidence for the presence of an anion ex-change transport system. J Clin Invest 1986; 78:44–50.

4. Shneider BL. Expression cloning of the ilealsodium-dependent bile acid transporter. J PediatrGastroenterol Nutr 1995; 20: 233–235.

5. Sun AQ, Ananthanarayanan M, Soroka CJ,Thevananther S, Shneider BL, Suchy FJ. Sortingof rat liver and ileal sodium-dependent bile acidtransporters in polarized epithelial cells. Am JPhysiol 1998; 275: G1045–G1055.

6. Lazaridis KN, Tietz P, Wu T, Kip S, Dawson PA,LaRusso NF. Alternative splicing of the ratsodium/bile acid transporter changes its cellularlocalization and transport properties. Proc NatlAcad Sci USA 2000; 97: 11092–11097.

7. Inokuchi A, Hinoshita E, Iwamoto Y, Kohno K,Kuwano M, Uchiumi T. Enhanced expression ofthe human multidrug resistance protein 3 by bilesalt in human enterocytes. A transcriptionalcontrol of a plausible bile acid transporter. J BiolChem 2001; 276: 46822–46829.

8. Rius M, Hummel-Eisenbeiss J, Hofmann AF,Keppler D. Substrate specificity of human ABCC4(MRP4)-mediated cotransport of bile acids andreduced glutathione. Am J Physiol GastrointestLiver Physiol 2006; 290: G640–G649.

9. Zelcer N, van de Wetering K, de Waart R, et al.Mice lacking Mrp3 (Abcc3) have normal bile salttransport, but altered hepatic transport of endo-genous glucuronides. J Hepatol 2006; 44: 768–775.

A.A. KHAN ET AL.256


233

10. Wang W, Seward DJ, Li L, Boyer JL, Ballatori N.Expression cloning of two genes that togethermediate organic solute and steroid transport inthe liver of a marine vertebrate. Proc Natl Acad SciUSA 2001; 98: 9431–9436.

11. Ballatori N, Christian WV, Lee JY, et al. OSTalpha-OSTbeta: a major basolateral bile acid and steroidtransporter in human intestinal, renal, and biliaryepithelia. Hepatology 2005; 42: 1270–1279.

12. Dawson PA, Hubbert M, Haywood J, et al. Theheteromeric organic solute transporter alpha-beta,Ostalpha-Ostbeta, is an ileal basolateral bile acidtransporter. J Biol Chem 2005; 280: 6960–6968.

13. Rao A, Haywood J, Craddock AL, Belinsky MG,Kruh GD, Dawson PA. The organic solutetransporter alpha-beta, Ostalpha-Ostbeta, isessential for intestinal bile acid transport andhomeostasis. Proc Natl Acad Sci USA 2008; 105:3891–3896.

14. Ballatori N, Fang F, Christian WV, Li N,Hammond CL. Ostalpha-Ostbeta is required forbile acid and conjugated steroid disposition in theintestine, kidney, and liver. Am J Physiol Gastro-intest Liver Physiol 2008; 295: G179–G186.

15. Landrier JF, Eloranta JJ, Vavricka SR, Kullak-Ublick GA. The nuclear receptor for bile acids,FXR, transactivates human organic solute trans-porter-alpha and -beta genes. Am J PhysiolGastrointest Liver Physiol 2006; 290: G476–G485.

16. Frankenberg T, Rao A, Chen F, Haywood J,Shneider BL, Dawson PA. Regulation of themouse organic solute transporter alpha-beta,Ostalpha-Ostbeta, by bile acids. Am J PhysiolGastrointest Liver Physiol 2006; 290: G912–G922.

17. Okuwaki M, Takada T, Iwayanagi Y, et al. LXRalpha transactivates mouse organic solute trans-porter alpha and beta via IR-1 elements sharedwith FXR. Pharm Res 2007; 24: 390–398.

18. Lee YK, Schmidt DR, Cummins CL, Choi M,Peng L, Zhang Y, et al. Liver receptor homolog-1regulates bile acid homeostasis but is not essentialfor feedback regulation of bile acid synthesis.Mol Endocrinol 2008; 22: 1345–1356.

19. Boyer JL, Trauner M, Mennone A, et al. Upregula-tion of a basolateral FXR-dependent bile acidefflux transporter OSTalpha-OSTbeta in cholesta-sis in humans and rodents. Am J Physiol Gastro-intest Liver Physiol 2006; 290: G1124–G1130.

20. Zollner G, Wagner M, Moustafa T, et al. Coordi-nated induction of bile acid detoxificationand alternative elimination in mice: role of FXR-regulated organic solute transporter-alpha/betain the adaptive response to bile acids. Am J PhysiolGastrointest Liver Physiol 2006; 290: G923–G932.

21. Chen X, Chen F, Liu S, et al. Transactivation of ratapical sodium-dependent bile acid transporterand increased bile acid transport by 1alpha,25-dihydroxyvitamin D3 via the vitamin Dreceptor. Mol Pharmacol 2006; 69: 1913–1923.

22. Jung D, Fantin AC, Scheurer U, Fried M, Kullak-Ublick GA. Human ileal bile acid transportergene ASBT (SLC10A2) is transactivated by theglucocorticoid receptor. Gut 2004; 53: 78–84.

23. Nowicki MJ, Shneider BL, Paul JM, Heubi JE.Glucocorticoids upregulate taurocholate transportby ileal brush-border membrane. Am J Physiol1997; 273: G197–G203.

24. Chen F, Ma L, Dawson PA, et al. Liver receptorhomologue-1 mediates species- and cell line-specific bile acid-dependent negative feedbackregulation of the apical sodium-dependent bileacid transporter. J Biol Chem 2003; 278:19909–19916.

25. Neimark E, Chen F, Li X, Shneider BL. Bile acid-induced negative feedback regulation of thehuman ileal bile acid transporter. Hepatology2004; 40: 149–156.

26. Li H, Chen F, Shang Q, et al. FXR-activatingligands inhibit rabbit ASBT expression via FXR-SHP-FTF cascade. Am J Physiol Gastrointest LiverPhysiol 2005; 288: G60–G66.

27. van de Kerkhof EG, de Graaf IA, de Jager MH,Meijer DK, Groothuis GM. Characterization of ratsmall intestinal and colon precision-cut slices asan in vitro system for drug metabolism andinduction studies. Drug Metab Dispos 2005; 33:1613–1620.

28. Rots MG, Elferink MG, Gommans WM, et al. Anex vivo human model system to evaluate specifi-city of replicating and non-replicating genetherapy agents. J Gene Med 2006; 8: 35–41.

29. Olinga P, Merema MT, Hof IH, et al. Effect of coldand warm ischaemia on drug metabolism inisolated hepatocytes and slices from human andmonkey liver. Xenobiotica 1998; 28: 349–360.

30. Khan AA, Chow ECY, Van Loenen-Weemaes A,Porte RJ, Pang KS, Groothuis GMM. Comparisonof effects of VDR versus PXR, FXR and GRligands on the regulation of CYP3A isozymes inrat and human intestine and liver. Eur J Pharm Sci2009; 37: 115–125.

31. de Kanter R, Monshouwer M, Meijer DK,Groothuis GM. Precision-cut organ slices as atool to study toxicity and metabolism of xenobio-tics with special reference to non-hepatic tissues.Curr Drug Metab 2002; 3: 39–59.

32. van de Kerkhof EG, Ungell AL, Sjoberg AK, et al.Innovative methods to study human intestinaldrug metabolism in vitro: precision-cut slicescompared with Ussing chamber preparations.Drug Metab Dispos 2006; 34: 1893–1902.

33. van de Kerkhof EG, de Graaf IA, Ungell AL,Groothuis GM. Induction of metabolismand transport in human intestine: validation ofprecision-cut slices as a tool to study induction ofdrug metabolism in human intestine in vitro. DrugMetab Dispos 2008; 36: 604–613.



234

34. Schmiedlin-Ren P, Benedict PE, Dobbins 3rd WO,Ghosh M, Kolars JC, Watkins PB. Cultured adult ratjejunal explants as a model for studying regulationof CYP3A. Biochem Pharmacol 1993; 46: 905–918.

35. Makishima M, Lu TT, Xie W, et al. Vitamin Dreceptor as an intestinal bile acid sensor. Science2002; 296: 1313–1316.

36. Matsubara T, Yoshinari K, Aoyama K, et al. Roleof vitamin D receptor in the lithocholic acid-mediated CYP3A induction in vitro and in vivo.Drug Metab Dispos 2008; 36: 2058–2063.

37. Shneider BL, Dawson PA, Christie DM, Hardikar W,Wong MH, Suchy FJ. Cloning and molecularcharacterization of the ontogeny of a rat ilealsodium-dependent bile acid transporter. J Clin Invest1995; 95: 745–754.

38. Olinga P, Elferink MG, Draaisma AL, et al.Coordinated induction of drug transporters andphase I and II metabolism in human liver slices.Eur J Pharm Sci 2008; 33: 380–389.

39. Parks DJ, Blanchard SG, Bledsoe RK, et al. Bileacids: natural ligands for an orphan nuclearreceptor. Science 1999; 284: 1365–1368.

40. Zollner G, Marschall HU, Wagner M, Trauner M.Role of nuclear receptors in the adaptive response to

bile acids and cholestasis: pathogenetic and thera-peutic considerations. Mol Pharm 2006; 3: 231–251.

41. Teng S, Piquette-Miller M. Hepatoprotective roleof PXR activation and MRP3 in cholic acid-induced cholestasis. Br J Pharmacol 2007; 151:367–376.

42. Sun AQ, Balasubramaniyan N, Xu K, et al.Protein-protein interactions and membrane loca-lization of the human organic solute transporter.Am J Physiol Gastrointest Liver Physiol 2007; 292:G1586–G1593.

43. Li N, Cui Z, Fang F, Lee JY, Ballatori N.Heterodimerization, trafficking and membranetopology of the two proteins, Ost alpha and Ostbeta, that constitute the organic solute and steroidtransporter. Biochem J 2007; 407: 363–372.

44. Sepulveda VA, Weigel NL, Falzon M. Prostatecancer cell type-specific involvement of the VDRand RXR in regulation of the human PTHrP genevia a negative VDRE. Steroids 2006; 71: 102–115.

45. Han S, Chiang JY. Mechanism of Vitamin Dreceptor inhibition of cholesterol 7alpha-hydroxy-lase gene transcription in human hepatocytes.Drug Metab Dispos 2009; 37: 469–478.

A.A. KHAN ET AL.258


235

236

APPENDIX A3 Khan AA, Chow EC, Porte RJ, Pang KS and Groothuis GM (2011) The role of lithocholic acid in the regulation of bile acid detoxification, synthesis, and transport proteins in rat and human intestine and liver slices. Toxicol In Vitro 25:80-90

The role of lithocholic acid in the regulation of bile acid detoxication, synthesis,and transport proteins in rat and human intestine and liver slices

Ansar A. Khan a, Edwin C.Y. Chowb, Robert J. Porte c, K. Sandy Pang b, Geny M.M. Groothuis a,⇑a Pharmacokinetics, Toxicology and Targeting, Department of Pharmacy, University of Groningen, Ant. Deusinglaan 1, 9713 AV Groningen, The NetherlandsbDepartment of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, 144 College Street, Toronto, ON M5S 3M2, CanadacDepartment of Hepatobiliary Surgery and Liver Transplantation, University Medical Center Groningen (UMCG), University of Groningen, Hanzeplein 1, 9700 RBGroningen, The Netherlands

a r t i c l e i n f o

Article history:Received 22 March 2010Accepted 26 September 2010Available online 1 October 2010

Keywords:Lithocholic acidVDRFXRPXRGRIntestinal slicesLiver slicesCytochrome P450TransportersBile acidInduction

a b s t r a c t

The effects of the secondary bile acid, lithocholic acid (LCA), a VDR, FXR and PXR ligand, on the regulationof bile acid metabolism (CYP3A isozymes), synthesis (CYP7A1), and transporter proteins (MRP3, MRP2,BSEP, NTCP) as well as nuclear receptors (FXR, PXR, LXRa, HNF1a, HNF4a and SHP) were studied in ratand human precision-cut intestine and liver slices at the mRNA level. Changes due to 5 to 10 lM ofLCA were compared to those of other prototype ligands for VDR, FXR, PXR and GR. LCA induced rCYP3A1and rCYP3A9 in the rat jejunum, ileum and colon, rCYP3A2 only in the ileum, rCYP3A9 expression in theliver, and CYP3A4 in the human ileum but not in liver. LCA induced the expression of rMRP2 in the colonbut not in the jejunum and ileum but did not affect rMRP3 expression along the length of the rat intes-tine. In human ileum slices, LCA induced hMRP3 and hMRP2 expression. In rat liver slices, LCA decreasedrCYP7A1, rLXRa and rHNF4a expression, induced rSHP expression, but did not affect rBSEP or rNTCPexpression; whereas in the human liver, a small but significant decrease was found for hHNF1a expres-sion. These data suggests profound species differences in the effects of LCA on bile acid transport, synthe-sis and detoxification. An examination of the effects of prototype VDR, PXR, GR and FXR ligands showedthat these pathways are all intact in precision cut slices and that LCA exerted VDR, PXR and FXR effects.The LCA-induced altered enzymes and transporter expressions in the intestine and liver would affect thedisposition of drugs.

� 2010 Elsevier Ltd. All rights reserved.

1. Introduction

Lithocholic acid (LCA) is a toxic secondary monohydroxy bileacid formed by the bacterial biotransformation (7a-dehydroxyla-tion) of the primary bile acid, chenodeoxycholic acid (CDCA) inthe terminal part of the small intestine (Danielsson and Gustafsson,1981; Hirano et al., 1981). LCA is reported to be carcinogenic inthe intestine and cholestatic in the liver of animals and man (Javitt,1966; Fisher et al., 1971; Narisawa et al., 1974), and is detoxifiedby cytochrome P450 (CYP) enzymes in the intestine and the liverof humans (CYP3A4) and rats (CYP3A1, CYP3A2, CYP3A9, CYP2C6,CYP2C11 and CYP2D1) to 6a- and 6b-hydroxy metabolites, respec-tively (Araya andWikvall, 1999; Deo and Bandiera, 2008), and con-jugated by sulfotransferase (Hofmann, 2004). 3-Keto-5b-cholanicacid (3KCA) was identified as the major LCA metabolite with hu-man recombinant CYP3A4 (Bodin et al., 2005), and found to bindVDR (Adachi et al., 2005).

Because LCA is predominantly formed in the terminal part ofthe small intestine, ileal mucosal cells are exposed to very highconcentrations of LCA. However, most of the studies on LCA bio-transformation were performed in liver microsomes of differentspecies and comparable data is not available for intestine. Further-more, the LCA-mediated regulation of the CYP isozymes involvedin its metabolism is not completely understood in the intestineand the liver. Some reports showed that the effects are concentra-tion-dependent (Adachi et al., 2005) and route-dependent in vivo(Owen et al., 2010). Makishima et al. (2002), Wolf (2002), andStaudinger et al. (2001) independently showed that LCA and3KCA can bind and transactivate the vitamin D receptor (VDR),the pregnane X receptor (PXR) and the farnesoid X receptor(FXR) (Adachi et al., 2005; Nehring et al., 2007). Hence, it is hypoth-esized that LCA and its metabolites may coordinately regulate bileacid detoxification, synthesis and transporter proteins in the intes-tine and the liver possibly via the PXR,VDR, and FXR. In addition tothe involvement of the PXR and glucocorticoid receptor (GR) in theregulation of CYP3A isoforms, the role of VDR in the regulation ofCYP3A isozymes in the detoxification of LCA in human and ratintestinal cell lines and human fetal intestine explants is well

0887-2333/$ - see front matter � 2010 Elsevier Ltd. All rights reserved.doi:10.1016/j.tiv.2010.09.011

⇑ Corresponding author. Tel.: +31 50 363 7523; fax: +31 50 363 3247.E-mail address: [email protected] (G.M.M. Groothuis).

Toxicology in Vitro 25 (2011) 80–90

Contents lists available at ScienceDirect

Toxicology in Vitro

journal homepage: www.elsevier .com/locate / toxinvi t

237

recognized (Catherine Theodoropoulos et al., 2003; Fukumori et al.,2007; Schmiedlin-Ren et al., 1997; Thummel et al., 2001). More re-cently, we also confirmed the involvement of VDR, as well as thoseof PXR, FXR and GR in the regulation of CYP3A isoforms in preci-sion-cut slices of rat and human intestine and liver (Chow et al.,2009b; Khan et al., 2009b; Xu et al., 2006), and in the Caco-2 cells(Fan et al., 2009). Matsubara et al. (2008) alluded that the induc-tion of CYP3A isoforms was associated mostly with VDR and muchless so with FXR and PXR. These nuclear receptors also play a rolein the regulation of transporters, namely, NTCP, ASBT, BSEP, MRP2,3, and 4, and Osta–Ostb in the enterohepatic cycle of bile acids andmaintenance of the bile acid pool (Ananthanarayanan et al., 2001;Frankenberg et al., 2006; Inokuchi et al., 2001; Kast et al., 2002;Landrier et al., 2006; McCarthy et al., 2005).

The regulation of enzymes and transporters involved in bile acidhomeostasis had been studied in the liver of rodents after LCAadministration (Beilke et al., 2008; Owen et al., 2010). In man,however, no direct data is available, though the role of LCA wasindirectly studied in human cholestatic livers (Zollner et al.,2007, 2006). In these in vivo studies, it is difficult to assess andcontrol the exposure of the different tissues to LCA and it is virtu-ally impossible to discriminate between direct effects of LCA fromthose of the LCA metabolites, cholestasis or other potential con-founding factors. Recently, distinctly different effects of the admin-istration route of LCA (intraperitoneal vs. oral) on the regulation ofenzymes and transporters involved in bile acid homeostasis in theintestine and liver were demonstrated in mice (Owen et al., 2010),but no data is available for the human and rat. Therefore we con-ducted a systematic study to investigate the direct effects of LCAon the regulation of bile acid detoxification enzymes and trans-porters in the rat and human intestine and liver, especially onCYP7A1, the bile acid synthetic enzyme, in rat and human livers,and the nuclear receptors/transcription factors involved in the reg-ulation of these proteins at the level of mRNA by exposing preci-sion-cut organ slices to different concentrations of LCA.Previously, this in vitro model was shown to be a valuable modelto study regulation of genes of interest by ligands for several NRin liver (Graaf et al., 2007; Jung et al., 2007; Olinga et al., 2008)and intestine (Khan et al., 2009a,b; Martignoni et al., 2006; vande Kerkhof et al., 2005) under identical conditions. Further, wecompared the LCA-mediated effects with those induced by othernuclear receptor specific ligands: CDCA for FXR, PCN for PXR,DEX for GR and PXR, and budesonide (BUD) for GR.

2. Materials and methods

2.1. Materials

Lithocholic acid and chenodeoxycholic acid were purchasedfrom Calbiochem, San Diego, CA, dexamethasone was from Genfarmabv, Maarssen. Pregnenolone-16a carbonitrile, budesonide and thesolvents: ethanol, methanol and dimethylsulfoxide were pur-chased from Sigma–Aldrich Chemical Co. (St. Louis, MO); gentami-cin sulfate and Williams medium E with glutamax-I andamphotericin B (fungizone)-solution were obtained from Gibco(Paisley, UK). D-Glucose, HEPES were procured from ICN Biomedi-cals, Inc. (Eschwege, Germany). University of Wisconsin organpreservation solution (UW) was obtained from DuPont CriticalCare, Waukegab, Illinois, USA. Low gelling temperature agarosewas purchased from Sigma–Aldrich (St. Louis, MO). RNAeasy minicolumns were obtained from Qiagen, Hilden, Germany. Randomprimers (500 lg/ml), MgCl2 (25 mM), RT buffer (10�), PCR nucleo-tide mix (10 mM), AMV RT (22 U/ll) and RNasin (40 U/ll); werepurchased from Promega Corporation, Madison WI, USA. SYBRGreen and Taqman Master Mixes (2�) were purchased from Ap-

plied Biosystems, Warrington, UK, Abgene Westbrug and Eurogen-tech, respectively. All primers were purchased from Sigma–Genosys by order on demand. All reagents and materials used wereof the highest purity that was commercially available.

2.2. Animals

Male Wistar (HsdCpb:WU) rats weighing about 230–250 g werepurchased from Harlan (Horst, The Netherlands) and were allowedto acclimatize for 7 days before experimentation. Rats were housedin a temperature and humidity controlled room on a 12 h light/dark cycle with food (Harlan Chow No. 2018, Horst, The Nether-lands) and tap water ad libitum. The experimental protocols wereapproved by the Animal Ethical Committee of the University ofGroningen.

2.3. Human liver and ileum tissue

The research protocols were approved by the Medical EthicalCommittee of the University Medical Center, Groningen, with in-formed consent of the patients. Pieces of human liver tissue wereobtained from patients undergoing partial hepactectomy for theremoval of carcinoma or from redundant parts of donor liversremaining after split liver transplantation, as described previously(Olinga et al., 2008). Human liver donor (n = 5) characteristics areas reported earlier (Khan et al., 2009b). Further, two additional hu-man livers were used for LCA experiments and their donor charac-teristics (human livers HL6 and HL7) are given in Table 3. Thehuman ileum was obtained as part of the surgical waste afterresection of the ileocolonic part of the intestine in colon carcinomapatients and the donor characteristics are similar to those reportedearlier (Khan et al., 2009b).

2.4. Preparation of slices

2.4.1. Rat and human intestinal slicesRat intestinal and human ileum slices (200–300 lm thick) were

prepared as published before (Khan et al., 2009a,b; van de Kerkhofet al., 2005, 2006). The precision-cut slices were stored in carbo-genated ice-cold KHB prior to the start of the experiment, whichusually varies from 1 to 3 h from sacrificing the rat and for humanlivers 2–3 h post surgery.

2.4.2. Rat and human liver slicesHuman and rat liver slices (200–300 lm thick) were prepared

as described earlier (Khan et al., 2009b; Olinga et al., 1998), fromcylindrical cores of liver tissue (8 mm) using the Krumdieck tissueslicer. The slices were stored in ice-cold UW solution on ice prior tothe start of the experiment, which usually varies from 1 to 3 h fromsacrificing the rat and for human livers 2–3 h post surgery.

2.5. Incubation of rat and human intestinal slices

Precision-cut slices from the rat intestine (jejunum, ileum andcolon) and human ileum were incubated individually in 12-wellsterile tissue culture plates (Grenier bio-one GmbH, Frickenhausen,Austria) containing 1.3 ml Williams medium E supplemented withD-Glucose to a final concentration of 25 mM, gentamicin sulfate,50 lg/ml amphotericin/fungizone, 250 lg/ml and saturated withcarbogen at 37 �C, continuously gassed with carbogen and shakenat 80 rpm. Rat intestinal slices were incubated with LCA (final con-centrations 5 and 10 lM), CDCA (final concentration, 50 lM), DEX(final concentrations, 1 and 50 lM) and PCN (final concentration,10 lM) added as a 100� concentrated stock solution in methanol(LCA and CDCA) and DMSO (DEX and PCN), and incubated for12 h. Human ileum slices were incubated with LCA (final

A.A. Khan et al. / Toxicology in Vitro 25 (2011) 80–90 81

238

concentration 10 lM) and CDCA (final concentration 50 lM) addedas a 100x concentrated stock solution in methanol and incubatedfor 8 and 24 h. Control slices from rat intestine and human ileumwere incubated in supplemented Williams medium E with 1%methanol or DMSO without inducers. From a single rat or humantissue sample, six (rat intestine) or three (human intestine) repli-cate slices were subjected to each experimental condition. Afterthe incubation these replicate slices were harvested, pooled andsnap-frozen in liquid nitrogen to obtain sufficient total RNA forqRT-PCR analysis. Samples were stored in �80 �C freezer untilRNA isolation. These experiments were replicated in 3–5 rats andwith human ileum samples from 3 to 5 donors.

2.6. Incubation of rat and human liver slices

Rat and human liver slices were incubated individually in six-well sterile tissue culture plates (Grenier bio-one GmbH, Fricken-hausen, Austria) containing 3.2 ml Williams medium E supple-mented with D-Glucose to a final concentration of 25 mM,gentamicin sulfate (50 lg/ml) and saturated with carbogen at37 �C, continuously gassed with carbogen and shaken at 80 rpm.Rat liver slices were incubated with LCA (50 lM), DEX (50 lM),BUD (10 and 100 nM) and PCN (10 lM). Control slices were incu-bated in supplementedWilliamsmedium E with vehicle (methanolor DMSO) without inducers for 8 and 24 h. Human liver slices wereincubated with LCA and DEX (50 lM). Control slices were incu-bated in supplemented Williams medium E with 1% methanol orDMSO without inducers for 24 h. From a single rat/single humanliver donor, three replicate slices were subjected to identical incu-bation conditions. At the end of the incubation, these replicateslices were harvested, pooled and snap-frozen in liquid nitrogento obtain sufficient total RNA for quantitative real time PCR(qRT-PCR) analysis. Samples were stored in �80 �C freezer untilRNA isolation. These experiments were replicated in 3–5 rats andwith liver samples from 4 to 5 human liver donors.

2.7. RNA isolation and qRT-PCR

Total RNA from the rat and human intestine and liver sampleswas isolated with RNAeasy mini columns from Qiagen by followingmanufacturer’s instruction. The ratio of absorbance measured at260/280 and 260/230 using a Nanodrop ND100 spectrophotometer(Wilmington, DE USA) was always above 1.8 for all the samples.The yield of mRNA was similar for the control slices, the solventcontrols, and the slices exposed to the ligands. The total RNA(2 lg/50 ll) was reverse-transcribed into template cDNA accord-

ing to the earlier published method (Khan et al., 2009b). qRT-PCRwas performed for the rat and human genes using primer se-quences listed in Tables 1 and 2, respectively, using SYBR Greendetection system as reported earlier by Khan et al. (2009b). Primersequences used for CYP3A1, CYP3A2 and CYP3A9 analysis were asreported earlier by Mahnke et al. (1997). All primer sets wereanalyzed using BLASTn to ensure primer specificity for the geneof interest (http://www.ncbi.nlm.nih.gov/BLAST/). Furthermore appro-priate controls were analyzed for all the primer sets to determinedimer formation of the primer and homogeneity of the PCR prod-ucts. The comparative threshold cycle (CT) method was used forrelative quantification of the mRNA. CT is inversely related to theabundance of mRNA transcripts in the initial sample. The meanCT of the duplicate measurements was used to calculate the differ-ence in CT for gene of interest and the reference gene (villin forintestine and GAPDH for liver) (DCT), which was compared to theDCT of the corresponding solvent control (DDCT). Data are ex-pressed as fold induction or repression of the gene of interestaccording to the formula 2� DDCTð Þ. No significant differences wereobserved in the expression of genes of interest between controlincubations with and without the solvents (methanol and DMSO),therefore all control incubation data was analyzed as one experi-mental group.

2.8. Statistics

All experiments were performed in 3–5 rats and in 5–7 humantissue samples. Values were expressed as mean ± SEM. Data wereanalyzed by the paired Student’s t-test or Mann–Whitney U-testto detect the effect of the ligands. The Student’s t-test was usedto analyze the rat data where the error distribution was found tobe normal with equal variance, whereas the non-parametricMann–Whitney U-test was used for experiments where non-equalerror distribution and high variance were observed (e.g. expressionof CYP3A1 and CYP3A2 genes in Wistar rats and all genes in humantissues). Statistical analysis was performed on fold induction aswell as on DDCT with similar results. A P value <0.05 was consid-ered as significant.

3. Results

3.1. Regulation of rCYP3A isozymes by LCA in rat intestine and liverslices

Incubation of rat intestinal slices (jejunum, ileum and colon)with LCA induced the expression of rCYP3A1 along the length of

Table 1Oligonucleotides for quantitative real-time PCR, rat genes (SYBR Green analysis).

Gene Forward primer (50–30) Reverse primer (50–30)

rVillin GCTCTTTGAGTGCTCCAACC GGGGTGGGTCTTGAGGTATTrGAPDH CTGTGGTCATGAGCCCCTCC CGCTGGTGCTGAGTATGTCGrCYP3A1 GGAAATTCGATGTGGAGTGC AGGTTTGCCTTTCTCTTGCCrCYP3A2 AGTAGTGACGATTCCAACATAT TCAGAGGTATCTGTGTTTCCTrCYP3A9 GGACGATTCTTGCTTACAGG ATGCTGGTGGGCTTGCCTTCrCYP7A1 CTGTCATACCACAAAGTCTTATGTCA ATGCTTCTGTGTCCAAATGCCrBSEP TGGAAAGGAATGGTGATGGG CAGAAGGCCAGTGCATAACAGArNTCP CTCCTCTACATGATTTTCCAGCTTG CGTCGACGTTCGTTCCTTTTCTTGrMRP2 CTGGTGTGGATTCCCTTGG CAAAACCAGGAGCCATGTGCrMRP3 ACACCGAGCCAGCCATATAC TCAGCTTCACATTGCCTGTCrSHP CTATTCTGTATGCACTTCTGAGCCC GGCAGTGGCTGTGAGATGCrHNF1a CTCCTCGGTACTGCAAGAAACC TTGTCACCCCAGCTTAAGACTCTrHNF4a CCAGCCTACACCACCCTGGAGTT TTCCTCACGCTCCTCCTGAArLXRa TGCAGGACCAGCTCCAAGTA GAATGGACGCTGCTCAAGTCrLRH-1 GCTGCCCTGCTGGACTACAC TGTAGGGCACATCCCCATTCrPXR GATGATCATGTCTGATGCCGCTG GAGGTTGGTAGTTCCAGATGCTGrFXR CCAACCTGGGTTTCTACCC CACACAGCTCATCCCCTTT

r, rat.

82 A.A. Khan et al. / Toxicology in Vitro 25 (2011) 80–90

239

the intestine, showing a very high induction in the jejunum (400-fold at 10 lM LCA; P < 0.05) and ileum (550-fold at 10 lM LCA;P < 0.05), and a moderate induction in the colon (3.5-fold at10 lM of LCA; P < 0.05) (Fig. 1A). LCA induced rCYP3A2 in the ratileum slices but not for the jejunum and colon (Fig. 1B). Inductionof rCYP3A2 in the rat ileum slices by LCA was found to be signifi-cant at 5 lM (5–40-fold; P < 0.05). At 10 lM of LCA, rCYP3A2induction was even higher but also highly variable, with valuesranging from 6- to 124-fold and failing to reach statistical signifi-cance. Furthermore, LCA induced rCYP3A9 modestly in jejunum,ileum and colon slices (2–3-fold; P < 0.001) with a slightly highereffect in the colon slices (Fig. 1C).

In contrast to the intestinal slices, the expression of rCYP3A1,rCYP3A2 and rCYP3A9 mRNA in the rat liver slices was not affectedby LCA during 8 h of incubation. However, when liver slices wereexposed to LCA (50 lM) for 24 h, rCYP3A9 expression was inducedby 2-fold, whereas rCYP3A1 and rCYP3A2 expression remainedunaltered (Fig. 2). As expected, the PXR ligands dexamethasone(DEX) and pregnenolone-16a carbonitrile (PCN) significantlyinduced the expression of rCYP3A1 (100-fold) and rCYP3A9 (5–8-fold; P < 0.001), but not rCYP3A2 (Fig. 2). Budesonide (BUD), asynthetic GR ligand significantly induced rCYP3A9 expression (2–3-fold; P < 0.001), decreased rCYP3A2 expression, and did not alterrCYP3A1 expression (Fig. 2). These results with PCN, DEX and BUDshow that the PXR and GR mediated pathways are intact in rat liverslices.

3.2. Expression and regulation of CYP3A4 in human ileum and liverslices

CYP3A4 expression was stable during control incubation of thehuman ileum slices for 8 h, but was decreased in human ileum andliver slices after 24 h of incubation (data not shown). Incubation ofhuman ileum slices with LCA (10 lM) significantly inducedCYP3A4 expression (9- and 5-fold induction during 8 and 24 h,respectively; P < 0.05) (Fig. 3). Incubation of human liver sliceswith LCA (50 lM) induced CYP3A4 mRNA expression in four of se-ven livers, and slightly reduced CYP3A4 mRNA in the other threelivers (Fig. 3 and Table 3).

3.3. Expression and regulation of rMRP2 and rMRP3 in rat intestine

In rat intestine, rMRP2 and rMRP3 transporters are expressed inreciprocal gradients along the length of the intestine, with rMRP2mRNA expression showing a decreasing gradient from the jejunumtowards the colon, and rMRP3 expression showed an increasinggradient from the jejunum to the colon (Fig. 4), as reported earlier(Chow et al., 2009b). During control incubations of rat jejunum,ileum and colon slices in Williams medium E without ligands,rMRP2 expression was significantly increased in jejunum andileum, but decreased in colon slices with incubation time (datanot shown). The expression of rMRP3 was, however, significantlyincreased in jejunum, ileum as well as in colon slices during control

Table 2Oligonucleotides for quantitative real-time PCR, human genes (SYBR Green and Taqman� analysis).

Gene Forward primer (50–30) Reverse primer (50–30)

hVillin CAGCTAGTGAACAAGCCTGTAGAGGAGC CCACAGAAGTTTGTGCTCATAGGChGAPDH ACCCAGAAGACTGTGGATGG TCTAGACGGCAGGTCAGGTChCYP3A4 GCCTGGTGCTCCTCTATCTA GGCTGTTGACCATCATAAAAGhCYP7A1 GCTGTTGTCTATGGCTTATTCTT GCCCAGGTATGGAATTAATCCAhBSEP CAGTTCCCTCAACCAGAACAT TTTGATCATTTCGCTCTCGATGhNTCP CTCAAATCCAAACGGCCACAAT CACACTGCACAAGAGAATGATGATChMRP2 CGGACAGCATCATGGCTTCT ACTCCTTCCTTGGCCAAGTTGhMRP3 GTCCGCAGAATGGACTTGAT TCACCACTTGGGGATCATTThSHP TGAAAGGGACCATCCTCTTCA CAATGTGGGAGGCGGCThHNF1a CAGAAAGCCGTGGTGGAGAC GACTTGACCATCTTCGCCACAhHNF4a CCTGGAATTTGAGAATGTGCAG AGGTTGGTGCCTTCTGATGGhLXRa CCCTTCAGAACCCACAGAGATC GCTCGTTCCCCAGCATTTThPXR CCCAGCCTGCTCATAGGTTC GGGTGTGCTGAGCATTGATGhFXR AGAGATGGGAATGTTGGCTGA GCATGCTGCTTCACATTTTTTChGAPDH Assay-on-Demand™ ID – Hs99999905_m1

Probe sequence (50FAM–30NFQ) – GCGCCTGGTCACCAGGGCTGCTTTT

h, human.

Table 3Summary of the effects of LCA on the expression genes in human livers; n = 4–7 human liver donors; criteria for induction and repression are 1.5- and 0.7-fold, respectively.

Human livers HL1 HL2 HL3 HL4 HL5 HL6 HL7 Mean SEM PGender Female N/A Male N/A Female Female FemaleAge 54 N/A 65 N/A 72 64 42ATP pmol/lg of protein ± SD *10.4 ± 1.5 *5.7 ± 1.9 *12.1 ± 1.0 11.1 ± 0.9 *3.3 ± 1.2 *9.7 ± 1.8 NDVDR (DCT) 11.7 16.2 14.8 16.2 NDE NDE NDGene

M CYP3A4 0.6 0.6 1.8 0.5 2.2 3.2 2.0 1.54 0.38 0.175M CYP7A1 M M 0.3 0.5 M 0.1 1.9 0.90 0.25 0.683M SHP M 0.7 0.7 M 2.6 3.1 M 1.40 0.38 0.312; HNF1a M M 0.3 M M ND M 0.78 0.10 0.042M HNF4a M 0.4 0.2 0.4 2.4 ND 0.4 0.80 0.34 0.523M LXRa 0.6 0.7 0.4 ND M M ND 0.77 0.19 0.166M PXR 0.7 0.3 1.7 ND 1.5 0.4 ND 0.93 0.30 0.794M FXR 0.6 M 0.5 ND M M ND 0.86 0.16 0.336M BSEP 0.4 M 1.7 M 0.7 0.2 M 0.84 0.19 0.413M NTCP 0.3 0.30 M 0.1 2.3 0.1 2.2 0.86 0.36 0.712M MRP2 0.5 M 0.5 M M M 1.5 1.03 0.16 0.867

HL – human liver; ND – not done; NDE – not detectable; N/A – not available; M – no significant effect; – significant repression; ‘‘�” data is taken from Khan et al. (2009b); allvalues are expressed as fold induction with respect to their solvent incubated controls.


240

incubation (data not shown). LCA (10 lM) induced the expressionof rMRP2 compared to the control incubations in colon slices butnot in jejunum and ileum slices (Fig. 5A) nor rMRP3 expressionalong the length of the intestine (Fig. 5B). In contrast, CDCA signif-icantly decreased the expression of rMRP2 in jejunum and ileumslices but induced rMRP2 in colon slices (Fig. 5A and B), whereasCDCA increased the rMRP3 expression only in ileum slices butdid not affect the rMRP3 expression in jejunum or colon (Fig. 5Aand B). DEX significantly induced the rMRP2 expression in the jeju-num and colon slices and decreased the expression of rMRP3 injejunum and ileum but not in colon slices (Fig. 5A and B). Similarto DEX, PCN significantly induced the rMRP2 expression in thejejunum and colon slices (Fig. 5A) but did not affect the rMRP3expression along the length of the rat intestine (Fig. 5B).

3.4. Expression and regulation of hMRP2 and hMRP3 in human ileumslices

In the human ileum slices, the hMRP2 expression was signifi-cantly increased during control incubation for 8 h and returnedto control values at 24 h, whereas hMRP3 was increased beyond24 h. LCA (10 lM) induced hMRP3 mRNA expression by 4-foldafter 8 h of incubation and hMRP2 expression by 4-fold after24 h of incubation as compared to the solvent treated controls(Fig. 6A and B). CDCA did not affect the expression of hMRP2 and

hMRP3 in human ileum slices during 8 h of incubation but uponprolonged (24 h) exposure of human ileum slices to CDCA, hMRP3but not hMRP2 expression was induced (Fig. 6A and B). DEX in-duced hMRP2 expression in all the tested human ileum sampleswithout affecting hMRP3 expression after 24 h incubation(Fig. 6A and B).

3.5. Expression and regulation of the bile acid synthesis enzyme,transporters and nuclear receptors in rat liver slices

The expression of rCYP7A1 mRNA in rat liver slices was highlysensitive to incubation. rCYP7A1 mRNA expression was decreasedby 90% during 8 h of incubation, and upon 24 h incubation, rCY-P7A1 mRNA was barely detectable (data not shown). Incubationof rat liver slices with LCA (50 lM) for 8 h significantly decreasedthe rCYP7A1 expression when compared to control incubatedslices (Fig. 7A). Furthermore, LCA induced rSHP and decreasedrHNF1a, rLXRa and rLRH-1 expression without affecting therHNF4a expression after 8 h of incubation (Fig. 8A and B). Pro-longed exposure of rat liver slices to LCA for 24 h significantly de-creased rHNF4a expression (Fig. 8B). LCA decreased the rPXR andrFXR mRNA expression (Fig. 8A and B). DEX but not PCN signifi-cantly decreased the rCYP7A1 expression with concomitant induc-tion of rSHP (Figs. 7A and 8A). Furthermore, DEX but not PCNinduced the rPXR expression in liver slices upon 8 h of incubation

Fig. 1. Rat jejunum, ileum and colon tissue-slices were exposed to LCA (5 and 10 lM) for 12 h after which total RNA was isolated and mRNA expression of rCYP3A1 (A),rCYP3A2 (B) and rCYP3A9 (C) were evaluated by qRT-PCR. After normalizing for villin expression, the results were compared to that of 12 h incubated control slices of thesame segment. Results showed mean ± SEM of 3–5 rats; in each experiment, and six slices were incubated per condition. Significant differences towards the controlincubations are indicated with *P < 0.05, and **P < 0.001. ‘‘�”denotes induction of rCYP3A1 and rCYP3A2 in all experiments, but failed to reach statistical significance due tohigh variation between the experiments, ND – not detectable.


241

(Fig. 8A), whereas, both DEX and PCN significantly decreased theexpression of rLXRa, rPXR, rFXR, rHNF1a, rHNF4a and rLRH-1upon 24 h of incubation (Fig. 8B).

In the rat liver slices, the expression of rBSEP and rNTCP mRNAwas decreased during control incubation (data not shown). LCA(50 lM) did not affect rBSEP and rNTCP expression (Fig. 7A andB), whereas DEX but not PCN induced rNTCP and rBSEP expression(Fig. 7A and B). Furthermore, the induction of rBSEP by DEX wascompletely abolished upon 24 h incubation (Fig. 7B). During incu-bation of rat liver slices, rMRP2 expression was decreased and

rMRP3 expression was increased (data not shown). LCA decreasedthe expression of rMRP3 without affecting the expression of rMRP2in liver slices upon 8 h incubation, but induced rMRP2 expressionupon 24 h incubation (Fig. 7A and B). DEX and PCN induced therMRP2 but not the rMRP3 expression (Fig. 7A and B).

3.6. Expression and regulation of the bile acid synthesis enzyme,transporters and nuclear receptors in human liver slices

In the human liver slices, the expression of most genes includ-ing hMRP2 and hMRP3 and hCYP7A1 was constant during controlincubations for 24 h (Table 3); FXR effects are usually associated

Fig. 2. Rat liver slices were exposed to LCA (10–50 lM) for 8 and 24 h; and with DEX (50 lM), PCN (10 lM) and BUD (10 and 100 nM) for 24 h, after which total RNA wasisolated and mRNA expression of rCYP3A1, rCYP3A2 and rCYP3A9 was evaluated by qRT-PCR. After normalizing for rGAPDH expression, the results were expressed as fold-induction and compared with the 8 and 24 h incubated control slices. Results showed mean ± SEM of 3–5 rats; three slices were incubated per condition in each experiment.Significant differences towards the control incubations are indicated with *P < 0.05, **P < 0.001 and ***P < 0.0001. ‘‘�”denotes induction of rCYP3A9 in all experiments, butfailed to reach statistical significance due to high variation between the experiments.

Fig. 3. Slices from human ileum and liver were exposed to 10 and 50 lM of LCA for8 and 24 h, respectively, after which total RNA was isolated and mRNA expressionof hCYP3A4 was evaluated by qRT-PCR. Results were expressed as fold-inductionafter normalizing with villin for ileum and hGAPDH for liver, and compared withthe control incubated slices for the same length of time, which was set to unity.Results showed mean ± SEM of four human ileum and seven liver donors; in eachexperiment three ileum and liver slices were incubated per condition. Significantdifferences towards the control incubations are indicated with *P < 0.05. ‘‘�”denotesinduction of hCYP3A4 in four of seven experiments.

Jejunum Ileum Colon0

1

2

3

4

rMRP2rMRP3

10

15

20

mR

NA

exp

ress

ion

of r

MR

P2

and

rM

RP

3 / v

illin

re

lati

ve t

o je

junu

m in

rat

inte

stin

e

**

*

****

Fig. 4. mRNA expression of rMRP2 and rMRP3 transporters relative to villinexpression in intestinal tissue (jejunum, ileum and colon) of the Wistar rat. ThemRNA expression of rMRP2 and rMRP3 transporters relative to villin in ileum andcolon was expressed relative to that in the jejunum, which was set to unity. Eachbar represents the results of three animals ± SEM. Significant differences betweenileum and colon compared to jejunum are indicated with *P < 0.05 and **P < 0.001.


242

with decreased hCYP7A1 expression via elevated SHP expression.The effects of LCA (50 lM) on the expression of bile acid synthesisenzyme and transporters, and the transcription factors regulatingtheir expression in human liver slices were quite variable amongthe individual livers and therefore the data is given for each indi-vidual liver in Table 3 as fold induction with respect to the solventincubated controls. This high variation does not seem to be causedby differences in viability of the livers (as judged by ATP concentra-tion and morphology), nor does it seem to be related to the type ofdonor (transplantation or partial hepatectomy), or to the expres-sion level of hVDR, hFXR or hPXR. The expression levels of theseNRs varied up to 30-fold between the livers for hFXR and up to16-fold for hPXR (results not shown), whereas hVDR was low butdetectable (CT 33–39) in four livers and undetectable (CT < 40) intwo livers. In each individual liver, a fold induction of >1.5 is con-sidered as up regulation and a fold induction of <0.7 is consideredas down regulation. Furthermore, the expression of a gene is con-sidered as induced or down regulated, if it is induced or repressedin 50% of the human livers, and the others being non-responsive.

In contrast to the findings in rat liver slices, incubation of hu-man liver slices with LCA did not consistently increase CYP3A4expression (higher in four and lower in three livers) (Table 3),whereas DEX showed a strong upregulation of CYP3A4 expressionin all the human livers (Table 4). In addition LCA did not have a

consistent effect on hCYP7A1 (decrease in three of seven livers),hSHP expression (induction in only two of seven livers), hHNF1aexpression (reduced in three of five livers), hLXRa (decreased inthree of five livers) and hHNF4a (decreased in four of six livers)(Table 3). DEX induced hHNF4a expression in three of four livers,but hLXRa expression was not affected by DEX (Table 4). The effectof LCA on the expression of hBSEP, hNTCP, hPXR, hFXR, hMRP2 andhMRP3 was neither significant nor consistent (Table 3). DEX signif-icantly induced hBSEP and moderately induced hPXR expression inall the livers, and induced hNTCP in four of five livers, but had noeffect on hMRP2 and hMRP3 expression (Table 4).

4. Discussion

In this report, rat and human precision-cut intestinal and liverslices were used to characterize the role of LCA in the regulationof genes involved in bile acid detoxification, transport and synthe-sis. Our data on the effects of 1,25(OH)2D3 (Khan et al., 2009a,b),BUD, CDCA, PCN and DEX show that VDR, FXR, PXR and GR path-ways are intact in the tissue slices. The observed changes in theexpression of the CYP P450 isozymes and transporters during

Fig. 5. Rat jejunum, ileum and colon tissue-slices were exposed to LCA (5and10 lM), CDCA (50 lM), DEX (1 and 50 lM) and PCN (10 lM) for 12 h afterwhich total RNA was isolated and mRNA expression of rMRP2 (A) and rMRP3 (B)were evaluated by qRT-PCR. Results were expressed as fold-induction afternormalizing with villin expression and compared to the control incubated slicesof the same segment for 12 h, which was set to 1. Results showed mean ± SEM of 3–5 rats; in each experiment, six slices were incubated per condition. Significantdifferences compared to the control incubations are indicated with *P < 0.05. ‘‘�”denotes induction of rMRP2 in all experiments, but failed to reach statisticalsignificance due to large variation between the experiments.

Fig. 6. Human ileum slices were exposed to LCA (10 lM), CDCA (50 lM) and DEX (1and 50 lM) for 8 and 24 h after which total RNA was isolated and mRNA expressionof hMRP2 and hMRP3 (A and B) were evaluated by qRT-PCR. Results were expressedas fold-induction after normalizing with villin expression and compared to thecontrol incubated slices for 8 and 24 h, which was set to 1. Results showedmean ± SEM of 4–5 human ileum donors. In each experiment, three ileum sliceswere incubated per condition. Significant differences compared to the controlincubations are indicated with *P < 0.05. ‘‘�”denotes induction of hMRP2 in allexperiments, but failed to reach statistical significance due to large variationbetween the experiments.


243

control incubations indicate that apparently the basal expression isnormally maintained by ligands that are absent in the culture med-ium. The pattern of LCA-mediated induction of rCYP3A1 and rCY-P3A2, and CYP3A4 in the rat and the human intestine,respectively (Figs. 1A–C and 3) resembles that of the VDR ligand,1,25(OH)2D3, and was clearly different from those of FXR, PXR orGR ligands as reported earlier by us (Khan et al., 2009b) and others(Fukumori et al., 2007), confirming the role of VDR in the regula-tion of CYP3A isozymes by LCA in the rat and human intestine.However, the higher induction of rCYP3A1 mRNA by LCA in therat ileum compared to the colon cannot be explained by differ-ences in VDR expression, as VDR was shown to be higher in colon(Khan et al., 2009b), thus other factors such as the presence of acti-vators/repressors may also play a role. The induction of rCYP3A9by LCA in the rat intestine is likely mediated via PXR, as the en-zyme was induced by other PXR ligands, PCN and DEX, but notby 1,25(OH)2D3, the VDR ligand, or the CDCA, FXR ligand (Khanet al., 2009b). The high induction of rCYP3A9 in the colon is consis-tent with the higher expression of PXR for induction (Khan et al.,2009b).

In human ileum slices, LCA was observed to induce CYP3A4expression (Fig. 3). However, the nuclear receptors (NRs) involvedin the induction of CYP3A4 by LCA from our studies is inconclusivesince CYP3A4 is induced also by PXR, GR and VDR ligands(Fukumori et al., 2007; Khan et al., 2009b). The involvement ofVDR rather than PXR as the nuclear receptor responsible for LCA-mediated CYP3A4 induction was suggested by Matsubara et al.(2008), who showed that the regulation of human CYP3A4 byLCA in HepG2 cells is specifically mediated by VDR and not byPXR upon addition of siRNA to VDR and PXR. Moreover, Adachiet al. (2005) and Ishizawa et al. (2008) showed that LCA-mediatedeffects were mostly associated with VDR and not PXR, and wasmodest with FXR.

In the rat liver slices, LCA did not affect rCYP3A1 and rCYP3A2mRNA expression (Fig. 2), results congruent with those observedpreviously with the VDR ligand, 1,25(OH)2D3 (Khan et al., 2009b).The absence of a VDR-mediated induction of rCYP3A isozymes inliver slices can be attributed to the low levels of VDR in rat liverand explained by the localization of VDR in the bile duct epithelialcells and not hepatocytes, as reported earlier by Gascon-Barre et al.(2003), and conformed to results in our studies (Khan et al., 2010),

Fig. 7. Slices from rat liver were exposed to LCA (50 lM), DEX (50 lM) and PCN(10 lM) for 8 and 24 h, after which total RNA was isolated and mRNA expression ofrCYP7A1, rNTCP, rBSEP, rMRP2 and rMRP3 were evaluated for (A) 8 h and (B) 24 hincubations by qRT-PCR. Results were expressed as fold-induction after normalizingwith rGAPDH and compared with the control slices that were incubated for 8 and24 h, which was set to unity. Results showed mean ± SEM of 3–5 rats; three sliceswere incubated per condition in each experiment. Significant differences comparedto the control incubations are indicated with *P < 0.05 and **P < 0.001. ‘‘#” indicatesrCYP7A1 is not detectable in samples incubated for 24 h. Note: the data for rPXRinduction in livers slices for 8 h is used from our recent publication (Khan et al.,2009b).

Fig. 8. Slices from rat liver were exposed to LCA (50 lM), DEX (50 lM) and PCN(10 lM) for 8 and 24 h, after which total RNA was isolated and mRNA expression ofrFXR, rLXRa, rPXR, rSHP, rHNF1a, rHNF4a, and rLRH-1 was evaluated for 8 h (A) and24 h (B) incubations by qRT-PCR. Results are expressed as fold-induction afternormalizing with rGAPDH and compared with the control incubated slices for 8 and24 h, which was set to unity. Results showed mean ± SEM of 3–5 rats; three sliceswere incubated per condition in each experiment. Significant differences comparedto the control incubations are indicated with *P < 0.05 and **P < 0.001.


244

since the CYP3A expression is primarily in hepatocytes. However,the LCA-induced rCYP3A9 expression upon 24 h of incubationwas similar to those from the PXR ligands, PCN and DEX (Fig. 2),suggesting a PXR response prevailing at longer times of incubation.This delayed response in the induction of rCYP3A9 by LCA suggestthat this effect might not be directly mediated by LCA, but by itsmetabolite, 3KCA, since it had been shown that LCA itself is a poorPXR ligand and needs to be activated to 3KCA for PXR binding(Makishima et al., 2002; Staudinger et al., 2001), a notion also sug-gested to exist for the mouse by Owen et al. (2010).

In contrast to observations in the rat liver but consistent withthose in human ileum, LCA induced the CYP3A4 expression in hu-man liver slices of four of seven liver donors (Fig. 3). This induction,in principle, could be explained by the observed abundance inexpression of VDR and in human vs. rat hepatocytes (Gascon-Barreet al., 2003). But the induction of CYP3A4 did not correlate with theVDR expression in these livers (Table 3), and it is unlikely that theLCA mediated the induction of CYP3A4 in these four livers via theVDR. Other nuclear receptors such as the PXR with its ligands, DEX(Table 4) and rifampicin (Olinga et al., 2008), would explain thisinduction data. Another aspect that contribute to the difficulty indata interpretation is the variability in the effects observed withLCA, since the interindividual variation in enzyme activity involvedin the metabolism of LCA by the sulfotransferases (Hofmann, 2004)and CYP3A4 (Lamba et al., 2002a,b) could result in variations in theeffective exposure to LCA or its metabolite, 3KCA.

When we studied the effect of LCA on the regulation of thebasolateral half transporters, OSTa–OSTb (Ballatori et al., 2008;Dawson et al., 2005) in intestinal slices concomitantly, we wereable to show decreased expression of rOSTa and rOSTb in the ratileum, and induced rOSTa and rOSTb in the rat colon and liverand human ileum and liver (Khan et al., 2009a). Decreased expres-sion of rOSTa and rOSTb was also found in the intestine of LCA fedmice (Owen et al., 2010). Since rMRP2 and rMRP3, transportersimportant for the apical excretion of monovalent and conjugatedbile acids across the apical and basolateral membranes, respec-tively, of enterocytes (Brady et al., 2002; Cherrington et al., 2002;Hirohashi et al., 1998, 2000; Zelcer et al., 2006), the ascendingexpression of rMRP3 and descending abundance of rMRP2 alongthe length of the rat intestine (Fig. 4), together with the basolaterallocalization of rOSTa–OSTb in the ileum (Ballatori et al., 2005) sug-gest that bile acid transport in the small intestine favors ilealabsorption, not withstanding the ileal abundance of rASBT (Chenet al., 2006), whereas in the colon, net transport is more towardsthe lumen. The finding of unchanged rMRP3 expression in rat jeju-num, ileum and colon slices but induced rMRP2 expression in co-

lon slices (Fig. 5A and B) and decreased rOSTa–rOSTb in ratileum with LCA treatment (Khan et al., 2009a) tend to promotethe luminal excretion of bile acids. Although the VDR ligand,1,25(OH)2D3 also induced rMRP2 without affecting rMRP3 expres-sion (Khan et al., unpublished observation), we cannot concludewhether the effect of LCA on rMRP2 is mediated by VDR, PXR orFXR, as DEX, PCN and CDCA also induced rMRP2 expression inthe rat colon (Fig. 5A). In the mouse intestine, mMrp2 was reducedand mMRP3 was not significantly changed by LCA (Owen et al.,2010), whereas in colon, mMrp3 was induced by 1,25(OH)2D3

(McCarthy et al., 2005), suggesting species differences in the regu-lation of MRP3. In the rat, LCA favors its own detoxication byinducing rMRP2 but not rMRP3 expression, thereby promoting api-cal efflux into the lumen of the colon (Fig. 5A and B). In contrast,CDCA, the primary bile acid, stimulates absorption of bile salts byinduction of rMRP3 and OSTa–OSTb expression and repression ofrMRP2 expression in rat jejunum and ileum (Fig. 5A and B), favour-ing the reclamation of bile acids in the small intestine. Also in thehuman intestine, LCA increases the luminal excretion of BAs byinducing hMRP2 expression, whereas CDCA favors the basolateraltransport of BAs by inducing hMRP3 expression in ileum slices(Fig. 6A and B), findings which are consistent with the earlier re-ports (Inokuchi et al., 2001). Since CDCA did not affect hMRP2expression in human ileum slices, the LCA effects are unlikely tobe mediated by FXR.

In addition to the evaluation of the effects of LCA on enzymesand transporters in rat and human intestine and colon, the effectof LCA on rat and human CYP7A1, the rate limiting enzyme in bileacid synthesis and NTCP, BSEP, MRP2 and MRP3, the bile acidtransporters, and the NR/transcription factors involved in the reg-ulation of these proteins showed that in rat liver slices, LCA de-creased the rCYP7A1 expression as observed with 1a,25-dihydroxyvitamin D3 treatment in the rat (Chow et al., 2009a)and LCA treatment in the mouse (Owen et al., 2010) in vivo. Con-comitantly, rSHP was induced in the rat liver, an expected responsefor an FXR ligand, and further observed with CDCA (Khan et al.,unpublished observations). Furthermore, LCA affected the rSHP-independent pathways of rCYP7A1 regulation by decreasing theexpression of rHNF1a, rHNF4a, rLXRa and rLRH-1 (Fig. 8A andB), factors that are essential for the expression of rCYP7A1 (Abra-hamsson et al., 2005; del Castillo-Olivares and Gil, 2000a,b; Geieret al., 2008; Lehmann et al., 1997). However, LCA effects are unli-kely to be related to PXR since PCN, the PXR ligand, failed to alterthe expression of rCYP7A1 and rSHP. The effects of LCA on rCYP7A1seem to decrease with increasing incubation time, suggesting thatmetabolism of LCA furnishes less efficient FXR agonists. The LCA-

Table 4Summary of the effects of dexamethasone on the expression genes in human livers; n = 4–5 human liver donors; criteria for induction and repression are 1.5- and 0.7-fold,respectively.

Human livers HL1 HL2 HL3 HL4 HL5 Mean SEM PGender Female N/A Male Female FemaleAge 54 N/A 65 72 64ATP pmol/lg of protein ± SD *10.4 ± 1.5 *5.7 ± 1.9 *12.1 ± 1.0 *3.3 ± 1.2 *9.7 ± 1.8VDR (DCT) 11.7 16.19 14.8 NDE NDEGene

DEX " CYP3A4 17.6 4.0 15.0 1.7 9.1 9.52 3.05 0.023" HNF1a M M 1.6 1.7 ND 1.35 0.20 0.079" HNF4a 1.9 M 6.5 3.9 ND 3.31 1.24 0.071" PXR M M 2.3 M 1.6 1.5 0.21 0.043" BSEP 8.7 2.3 15.2 3.3 3.6 6.61 2.40 0.048" NTCP 6.5 1.5 4.2 2.3 M 3.04 1.03 0.083M MRP2 M 1.9 0.6 M M 1.2 0.22 0.387M MRP3 0.5 M 2.0 ND 0.5 0.95 0.35 0.861

HL – human liver; ND – not done; NDE – not detectable; N/A – not available; M – no effect; – significant induction or induction in P50% of the livers; ‘‘�” data is taken fromKhan et al. (2009b); all values are expressed as fold induction with respect to their solvent incubated controls.


245

induced FXR effects on the repression of bile acid synthesis maytake precedence over the PXR effects such as rCYP3A9 induction.Furthermore, we found that LCA, unlike CDCA, decreased theexpression of rFXR and rPXR in rat liver slices (Fig. 8A) (Khanet al., unpublished observations), an observation reminiscent ofthe reported VDR antagonism on the FXR (Honjo et al., 2006). Thus,in addition to decreasing the expression of rCYP7A1, LCA also de-creased the rFXR expression, probably by a feedback loop mediatedby the decreased expression of rHNF1a, (Fig. 8A and B), which isrequired for its basal expression (Lou et al., 2007). The LCA-depen-dent rSHP induction and concomitant repression of rPXR is consis-tent with results found in human hepatocytes and in mice on theSHP-mediated repression of PXR (Ourlin et al., 2003); the observa-tion is in contrast to the increased expression of both SHP and PXRfound in mice fed with CDCA and GW4064 (Jung et al., 2006).

In human liver slices, effects of LCA on the NRs and CYP3A4were highly variable. The decrease in hHNF1a, hHNF4a and hLXRawas observed only in three of five of the tested human livers(Table 3 and Fig. 8A and B). Unlike in rat liver slices, LCA did notaffect the hMRP2 expression in human livers (Fig. 7A and B,Table 3). In addition, the LCA-mediated effects on the expressionof hSHP, hBSEP and hNTCP in human livers were not consistent,whereas the CDCA effects were consistent with an intact FXR path-way (Khan et al., unpublished observation). Hence, it is concludedthat LCA does not act as an FXR ligand in the human liver, as alsoreported by others (Ananthanarayanan et al., 2001; Jung et al.,2007). These results suggest that the cholestatic effects of LCAare partly mediated by direct effect of LCA itself on the regulationof hBSEP and not hMRP2. Furthermore, DEX induced both hNTCP(Table 4), and rNTCP (Fig. 8A and B), likely via the GR as predictedby an earlier report (Eloranta et al., 2006). Hence, the GR pathwayis intact in human liver slices. DEX also induced both hBSEP andrBSEP (Table 4 and Fig. 8A), an observation that is reported forthe first time.

In conclusion, LCA plays an important role in the feed forwardregulation of its detoxification pathways in the rat and humanintestine by inducing CYP3A isozymes, thereby increasing itsmetabolism, as was also found in the mouse in vivo (Owen et al.,2010). In addition, LCA increases the luminal efflux of conjugated(toxic) bile acids via rMRP2 into the colon, while simultaneouslypreserving the primary bile acid pool by inducing the expressionof rOSTb in the colon (Khan et al., 2009a) and rMRP3 in the ileum.Distinct species differences were observed for the effects of LCA inthe rat and human liver. In the rat liver, LCA decreases bile acidsynthesis and excretion but its effects in the human liver wereinconsistent and need further investigation. Thus, LCA was foundto be a promiscuous ligand that can interact with FXR, VDR andPXR in the regulation of bile acid synthesis, metabolism and trans-port in the rat intestine and liver and the human intestine. This al-tered expression of transporters and CYP3A enzymes may alsohave consequences for the disposition of drugs, especially in situ-ations when LCA is increased such as during cholestasis.

Acknowledgments

The authors thank Dr. Vincent B. Nieuwenhuijs (UniversityMedical Center, Groningen) for providing the human ileum tissue.

This work was supported by the Canadian Institutes for HealthResearch, MOP89850; Edwin C.Y. Chow is a recipient of the Alexan-der Graham Bell NSERC fellowship, Canada.

References

Abrahamsson, A., Gustafsson, U., Ellis, E., Nilsson, L.M., Sahlin, S., Bjorkhem, I.,Einarsson, C., 2005. Feedback regulation of bile acid synthesis in human liver:

importance of HNF-4alpha for regulation of CYP7A1. Biochem. Biophys. Res.Commun. 330, 395–399.

Adachi, R., Honma, Y., Masuno, H., Kawana, K., Shimomura, I., Yamada, S.,Makishima, M., 2005. Selective activation of vitamin D receptor by lithocholicacid acetate, a bile acid derivative. J. Lipid Res. 46, 46–57.

Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D.J.,Suchy, F.J., 2001. Human bile salt export pump promoter is transactivated bythe farnesoid X receptor/bile acid receptor. J. Biol. Chem. 276, 28857–28865.

Araya, Z., Wikvall, K., 1999. 6Alpha-hydroxylation of taurochenodeoxycholic acidand lithocholic acid by CYP3A4 in human liver microsomes. Biochim. Biophys.Acta 1438, 47–54.

Ballatori, N., Christian, W.V., Lee, J.Y., Dawson, P.A., Soroka, C.J., Boyer, J.L.,Madejczyk, M.S., Li, N., 2005. OSTalpha–OSTbeta: a major basolateral bile acidand steroid transporter in human intestinal, renal, and biliary epithelia.Hepatology 42, 1270–1279.

Ballatori, N., Fang, F., Christian, W.V., Li, N., Hammond, C.L., 2008. Ost{alpha}–Ost{beta} is required for bile acid and conjugated steroid disposition in theintestine, kidney, and liver. Am. J. Physiol. Gastrointest. Liver Physiol. 295,G179–G186.

Beilke, L.D., Besselsen, D.G., Cheng, Q., Kulkarni, S., Slitt, A.L., Cherrington, N.J., 2008.Minimal role of hepatic transporters in the hepatoprotection against LCA-induced intrahepatic cholestasis. Toxicol. Sci. 102, 196–204.

Bodin, K., Lindbom, U., Diczfalusy, U., 2005. Novel pathways of bile acid metabolisminvolving CYP3A4. Biochim. Biophys. Acta 1687, 84–93.

Brady, J.M., Cherrington, N.J., Hartley, D.P., Buist, S.C., Li, N., Klaassen, C.D., 2002.Tissue distribution and chemical induction of multiple drug resistance genes inrats. Drug Metab. Dispos. 30, 838–844.

Catherine Theodoropoulos, C.D., Delvin, Edgard, Menard, Daniel, Gascon-Barre,Marielle, 2003. Calcitriol regulates the expression of the genes encoding thethree key vitamin D3 hydroxylases and the drug – metabolizing enzymesCYP3A4 in the human fetal intestine. Clin. Endocrinol. 58, 1–3.

Chen, X., Chen, F., Liu, S., Glaeser, H., Dawson, P.A., Hofmann, A.F., Kim, R.B.,Shneider, B.L., Pang, K.S., 2006. Transactivation of rat apical sodium-dependentbile acid transporter and increased bile acid transport by 1alpha,25-dihydroxyvitamin D3 via the vitamin D receptor. Mol. Pharmacol. 69, 1913–1923.

Cherrington, N.J., Hartley, D.P., Li, N., Johnson, D.R., Klaassen, C.D., 2002. Organdistribution of multidrug resistance proteins 1, 2, and 3 (Mrp1, 2, and 3) mRNAand hepatic induction of Mrp3 by constitutive androstane receptor activators inrats. J. Pharmacol. Exp. Ther. 300, 97–104.

Chow, E.C., Maeng, H.J., Liu, S., Khan, A.A., Groothuis, G.M., Pang, K.S., 2009a.1Alpha,25-dihydroxyvitamin D(3) triggered vitamin D receptor and farnesoid Xreceptor-like effects in rat intestine and liver in vivo. Biopharm. Drug Dispos.30, 457–475.

Chow, E.C., Sun, H., Khan, A.A., Groothuis, G.M., Pang, K.S., 2009b. Effects of1alpha,25-dihydroxyvitamin D3 on transporters and enzymes of the ratintestine and kidney in vivo. Biopharm. Drug Dispos. 31, 91–108.

Danielsson, H., Gustafsson, J., 1981. Biochemistry of bile acids in health and disease.Pathobiol. Annu. 11, 259–298.

Dawson, P.A., Hubbert, M., Haywood, J., Craddock, A.L., Zerangue, N., Christian, W.V.,Ballatori, N., 2005. The heteromeric organic solute transporter alpha–beta,Ostalpha–Ostbeta, is an ileal basolateral bile acid transporter. J. Biol. Chem. 280,6960–6968.

del Castillo-Olivares, A., Gil, G., 2000a. Alpha 1-fetoprotein transcription factor isrequired for the expression of sterol 12alpha-hydroxylase, the specific enzymefor cholic acid synthesis. Potential role in the bile acid-mediated regulation ofgene transcription. J. Biol. Chem. 275, 17793–17799.

del Castillo-Olivares, A., Gil, G., 2000b. Role of FXR and FTF in bile acid-mediatedsuppression of cholesterol 7alpha-hydroxylase transcription. Nucleic Acids Res.28, 3587–3593.

Deo, A.K., Bandiera, S.M., 2008. Biotransformation of lithocholic acid by rat hepaticmicrosomes: metabolite analysis by liquid chromatography/massspectrometry. Drug Metab. Dispos. 36, 442–451.

Eloranta, J.J., Jung, D., Kullak-Ublick, G.A., 2006. The human Na+-taurocholatecotransporting polypeptide gene is activated by glucocorticoid receptor andperoxisome proliferator-activated receptor-gamma coactivator-1alpha, andsuppressed by bile acids via a small heterodimer partner-dependentmechanism. Mol. Endocrinol. 20, 65–79.

Fisher, M.M., Magnusson, R., Miyai, K., 1971. Bile acid metabolism in mammals. I.Bile acid-induced intrahepatic cholestasis. Lab Invest. 25, 88–91.

Fan, J., Liu, S., Du, Y., Morrison, J., Shipman, R., Pang, K.S., 2009. Up-regulation oftransporters and enzymes by the vitamin D receptor ligands, 1alpha, 25-dihydroxyvitamin D3 and vitamin D analogs, in the Caco-2 cell monolayer. J.Pharmacol. Exp. Ther. 330, 389–402.

Frankenberg, T., Rao, A., Chen, F., Haywood, J., Shneider, B.L., Dawson, P.A., 2006.Regulation of the mouse organic solute transporter alpha–beta, Ostalpha–Ostbeta, by bile acids. Am. J. Physiol. Gastrointest. Liver Physiol. 290, G912–G922.

Fukumori, S., Murata, T., Taguchi, M., Hashimoto, Y., 2007. Rapid and drasticinduction of CYP3A4 mRNA expression via vitamin D receptor in humanintestinal LS180 cells. Drug Metab. Pharmacokinet. 22, 377–381.

Gascon-Barre, M., Demers, C., Mirshahi, A., Neron, S., Zalzal, S., Nanci, A., 2003. Thenormal liver harbors the vitamin D nuclear receptor in nonparenchymal andbiliary epithelial cells. Hepatology 37, 1034–1042.

Geier, A., Martin, I.V., Dietrich, C.G., Balasubramaniyan, N., Strauch, S., Suchy, F.J.,Gartung, C., Trautwein, C., Ananthanarayanan, M., 2008. Hepatocyte nuclear


246

factor-4alpha is a central transactivator of the mouse Ntcp gene. Am. J Physiol.Gastrointest. Liver Physiol. 295, G226–G233.

Graaf, I.A.M.D., Groothuis, G.M., Olinga, P., 2007. Precision-cut tissue slices as a toolto predict metabolism of novel drugs. Expert Opin. Drug Metab. Toxicol. 3, 879–898.

Hirano, S., Masuda, N., Oda, H., 1981. In vitro transformation of chenodeoxycholicacid and ursodeoxycholic acid by human intestinal flora, with particularreference to the mutual conversion between the two bile acids. J. Lipid Res. 22,735–743.

Hirohashi, T., Suzuki, H., Ito, K., Ogawa, K., Kume, K., Shimizu, T., Sugiyama, Y.,1998. Hepatic expression of multidrug resistance-associated protein-likeproteins maintained in eisai hyperbilirubinemic rats. Mol. Pharmacol. 53,1068–1075.

Hirohashi, T., Suzuki, H., Takikawa, H., Sugiyama, Y., 2000. ATP-dependent transportof bile salts by rat multidrug resistance-associated protein 3 (Mrp3). J. Biol.Chem. 275, 2905–2910.

Hofmann, A.F., 2004. Detoxification of lithocholic acid, a toxic bile acid: relevance todrug hepatotoxicity. Drug Metab. Rev. 36, 703–722.

Honjo, Y., Sasaki, S., Kobayashi, Y., Misawa, H., Nakamura, H., 2006. 1,25-dihydroxyvitamin D3 and its receptor inhibit the chenodeoxycholic acid-dependent transactivation by farnesoid X receptor. J. Endocrinol. 188, 635–643.

Inokuchi, A., Hinoshita, E., Iwamoto, Y., Kohno, K., Kuwano, M., Uchiumi, T., 2001.Enhanced expression of the humanmultidrug resistance protein 3 by bile salt inhuman enterocytes. A transcriptional control of a plausible bile acidtransporter. J. Biol. Chem. 276, 46822–46829.

Ishizawa, M., Matsunawa, M., Adachi, R., Uno, S., Ikeda, K., Masuno, H., Shimizu, M.,Iwasaki, K., Yamada, S., Makishima, M., 2008. Lithocholic acid derivatives act asselective vitamin D receptor modulators without inducing hypercalcemia. J.Lipid Res. 49, 763–772.

Javitt, N.B., 1966. Cholestasis in rats induced by taurolithocholate. Nature 210,1262–1263.

Jung, D., Mangelsdorf, D.J., Meyer, U.A., 2006. Pregnane X receptor is a target offarnesoid X receptor. J. Biol. Chem. 281, 19081–19091.

Jung, D., Elferink, M.G., Stellaard, F., Groothuis, G.M., 2007. Analysis of bile acid-induced regulation of FXR target genes in human liver slices. Liver Int. 27, 137–144.

Kast, H.R., Goodwin, B., Tarr, P.T., Jones, S.A., Anisfeld, A.M., Stoltz, C.M., Tontonoz, P.,Kliewer, S., Willson, T.M., Edwards, P.A., 2002. Regulation of multidrugresistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane Xreceptor, farnesoid X-activated receptor, and constitutive androstane receptor.J. Biol. Chem. 277, 2908–2915.

Khan, A.A., Chow, E.C., Porte, R.J., Pang, K.S., Groothuis, G.M., 2009a. Expression andregulation of the bile acid transporter, OSTalpha–OSTbeta in rat and humanintestine and liver. Biopharm. Drug Dispos. 30, 241–258.

Khan, A.A., Chow, E.C., van Loenen-Weemaes, A.M., Porte, R.J., Pang, K.S., Groothuis,G.M., 2009b. Comparison of effects of VDR versus PXR, FXR and GR ligands onthe regulation of CYP3A isozymes in rat and human intestine and liver. Eur. J.Pharm. Sci. 37, 115–125.

Khan, A.A., Dragt, B.S., Porte, R.J., Groothuis, G.M., 2010. Regulation of VDRexpression in rat and human intestine and liver – consequences for CYP3Aexpression. Toxicol. In Vitro 24, 822–829.

Lamba, J.K., Lin, Y.S., Schuetz, E.G., Thummel, K.E., 2002a. Genetic contribution tovariable human CYP3A-mediated metabolism. Adv. Drug Deliv. Rev. 54, 1271–1294.

Lamba, J.K., Lin, Y.S., Thummel, K., Daly, A., Watkins, P.B., Strom, S., Zhang, J.,Schuetz, E.G., 2002b. Common allelic variants of cytochrome P4503A4 and theirprevalence in different populations. Pharmacogenetics 12, 121–132.

Landrier, J.F., Eloranta, J.J., Vavricka, S.R., Kullak-Ublick, G.A., 2006. The nuclearreceptor for bile acids, FXR, transactivates human organic solute transporter-alpha and -beta genes. Am. J. Physiol. Gastrointest. Liver Physiol. 290, G476–G485.

Lehmann, J.M., Kliewer, S.A., Moore, L.B., Smith-Oliver, T.A., Oliver, B.B., Su, J.L.,Sundseth, S.S., Winegar, D.A., Blanchard, D.E., Spencer, T.A., Willson, T.M., 1997.Activation of the nuclear receptor LXR by oxysterols defines a new hormoneresponse pathway. J. Biol. Chem. 272, 3137–3140.

Lou, G., Li, Y., Chen, B., Chen, M., Chen, J., Liao, R., Zhang, Y., Wang, Y., Zhou, D., 2007.Functional analysis on the 50-flanking region of human FXR gene in HepG2 cells.Gene 396, 358–368.

Mahnke, A., Strotkamp, D., Roos, P.H., Hanstein, W.G., Chabot, G.G., Nef, P., 1997.Expression and inducibility of cytochrome P450 3A9 (CYP3A9) and othermembers of the CYP3A subfamily in rat liver. Arch. Biochem. Biophys. 337, 62–68.

Makishima, M., Lu, T.T., Xie, W., Whitfield, G.K., Domoto, H., Evans, R.M., Haussler,M.R., Mangelsdorf, D.J., 2002. Vitamin D receptor as an intestinal bile acidsensor. Science 296, 1313–1316.

Martignoni, M., de Kanter, R., Grossi, P., Saturno, G., Barbaria, E., Monshouwer, M.,2006. An in vivo and in vitro comparison of CYP gene induction in mice usingliver slices and quantitative RT-PCR. Toxicol. In Vitro 20, 125–131.

Matsubara, T., Yoshinari, K., Aoyama, K., Sugawara, M., Sekiya, Y., Nagata, K.,Yamazoe, Y., 2008. Role of vitamin D receptor in the lithocholic acid-mediatedCYP3A induction in vitro and in vivo. Drug Metab. Dispos. 36, 2058–2063.

McCarthy, T.C., Li, X., Sinal, C.J., 2005. Vitamin D receptor-dependent regulation ofcolon multidrug resistance-associated protein 3 gene expression by bile acids. J.Biol. Chem. 280, 23232–23242.

Narisawa, T., Magadia, N.E., Weisburger, J.H., Wynder, E.L., 1974. Promoting effect ofbile acids on colon carcinogenesis after intrarectal instillation of N-methyl-N0-nitro-N-nitrosoguanidine in rats. J. Natl. Cancer Inst. 53, 1093–1097.

Nehring, J.A., Zierold, C., DeLuca, H.F., 2007. Lithocholic acid can carry out in vivofunctions of vitamin D. Proc. Natl. Acad. Sci. USA 104, 10006–10009.

Olinga, P., Merema, M.T., Hof, I.H., De Jager, M.H., De Jong, K.P., Slooff, M.J., Meijer,D.K., Groothuis, G.M., 1998. Effect of cold and warm ischaemia on drugmetabolism in isolated hepatocytes and slices from human and monkey liver.Xenobiotica 28, 349–360.

Olinga, P., Elferink, M.G., Draaisma, A.L., Merema, M.T., Castell, J.V., Perez, G.,Groothuis, G.M., 2008. Coordinated induction of drug transporters and phase Iand II metabolism in human liver slices. Eur. J. Pharm. Sci. 33, 380–389.

Ourlin, J.C., Lasserre, F., Pineau, T., Fabre, J.M., Sa-Cunha, A., Maurel, P., Vilarem, M.J.,Pascussi, J.M., 2003. The small heterodimer partner interacts with the pregnaneX receptor and represses its transcriptional activity. Mol. Endocrinol. 17, 1693–1703.

Owen, B.M., Milona, A., van Mil, S., Clements, P., Holder, J., Boudjelal, M., Cairns, W.,Parker, M., White, R., Williamson, C., 2010. Intestinal detoxification limits theactivation of hepatic pregnane X receptor by lithocholic acid. Drug Metab.Dispos. 38, 143–149.

Schmiedlin-Ren, P., Thummel, K.E., Fisher, J.M., Paine, M.F., Lown, K.S., Watkins, P.B.,1997. Expression of enzymatically active CYP3A4 by Caco-2 cells grown onextracellular matrix-coated permeable supports in the presence of 1alpha,25-dihydroxyvitamin D3. Mol. Pharmacol. 51, 741–754.

Staudinger, J.L., Goodwin, B., Jones, S.A., Hawkins-Brown, D., MacKenzie, K.I., LaTour,A., Liu, Y., Klaassen, C.D., Brown, K.K., Reinhard, J., Willson, T.M., Koller, B.H.,Kliewer, S.A., 2001. The nuclear receptor PXR is a lithocholic acid sensor thatprotects against liver toxicity. Proc. Natl. Acad. Sci. USA 98, 3369–3374.

Thummel, K.E., Brimer, C., Yasuda, K., Thottassery, J., Senn, T., Lin, Y., Ishizuka, H.,Kharasch, E., Schuetz, J., Schuetz, E., 2001. Transcriptional control of intestinalcytochrome P-4503A by 1alpha,25-dihydroxy vitamin D3. Mol. Pharmacol. 60,1399–1406.

van de Kerkhof, E.G., de Graaf, I.A., de Jager, M.H., Meijer, D.K., Groothuis, G.M., 2005.Characterization of rat small intestinal and colon precision-cut slices as anin vitro system for drug metabolism and induction studies. Drug Metab. Dispos.33, 1613–1620.

van de Kerkhof, E.G., Ungell, A.L., Sjoberg, A.K., de Jager, M.H., Hilgendorf, C., deGraaf, I.A., Groothuis, G.M., 2006. Innovative methods to study human intestinaldrug metabolism in vitro: precision-cut slices compared with using chamberpreparations. Drug Metab. Dispos. 34, 1893–1902.

Wolf, G., 2002. Intestinal bile acids can bind to and activate the vitamin D receptor.Nutr. Rev. 60, 281–283.

Xu, Y., Iwanaga, K., Zhou, C., Cheesman, M.J., Farin, F., Thummel, K.E., 2006. Selectiveinduction of intestinal CYP3A23 by 1alpha, 25-dihydroxyvitamin D3 in rats.Biochem. Pharmacol. 72, 385–392.

Zelcer, N., van de Wetering, K., de Waart, R., Scheffer, G.L., Marschall, H.U., Wielinga,P.R., Kuil, A., Kunne, C., Smith, A., van der Valk, M., Wijnholds, J., Elferink, R.O.,Borst, P., 2006. Mice lacking Mrp3 (Abcc3) have normal bile salt transport, butaltered hepatic transport of endogenous glucuronides. J. Hepatol. 44, 768–775.

Zollner, G., Wagner, M., Moustafa, T., Fickert, P., Silbert, D., Gumhold, J.,Fuchsbichler, A., Halilbasic, E., Denk, H., Marschall, H.U., Trauner, M., 2006.Coordinated induction of bile acid detoxification and alternative elimination inmice: role of FXR-regulated organic solute transporter-alpha/beta in theadaptive response to bile acids. Am. J. Physiol. Gastrointest. Liver Physiol. 290,G923–G932.

Zollner, G., Wagner, M., Fickert, P., Silbert, D., Gumhold, J., Zatloukal, K., Denk, H.,Trauner, M., 2007. Expression of bile acid synthesis and detoxification enzymesand the alternative bile acid efflux pump MRP4 in patients with primary biliarycirrhosis. Liver Int. 27, 920–929.


247

248

APPENDIX A4 Chow EC, Sun H, Khan AA, Groothuis GM and Pang KS (2010) Effects of 1,25-dihydroxyvitamin D3 on transporters and enzymes of the rat intestine and kidney in vivo. Biopharm Drug Dispos 31:91-108


Published online 9 December 2009 in Wiley InterScience

(www.interscience.wiley.com) DOI: 10.1002/bdd. 694

Effects of 1a,25-Dihydroxyvitamin D3 on Transportersand Enzymes of the Rat Intestine and Kidney In Vivo

Edwin C. Y. Chowa, Huadong Suna, Ansar A. Khanb, Geny M. M. Groothuisb, and K. Sandy Panga,�aDepartment of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, CanadabPharmacokinetics, Toxicology and Targeting, Department of Pharmacy, University of Groningen, The Netherlands

ABSTRACT: 1a,25-Dihydroxyvitamin D3 (1,25(OH)2D3), the natural ligand of the vitamin Dreceptor (VDR), was found to regulate bile acid related transporters and enzymes directly andindirectly in the rat intestine and liver in vivo. The kidney is another VDR-rich target organ in whichVDR regulation on xenobiotic transporters and enzymes is ill-defined. Hence, changes in proteinand mRNA expression of nuclear receptors, transporters and enzymes of the rat intestine andkidney in response to 1,25(OH)2D3 treatment (0 to 2.56 nmol/kg/day intraperitoneally in corn oilfor 4 days) were studied. In the intestine, protein and not mRNA levels of Mrp2, Mrp3, Mrp4 andPepT1 in the duodenum and proximal jejunum were induced, whereas Oat1 and Oat3 mRNAweredecreased in the ileum after 1,25(OH)2D3 treatment. In the kidney, VDR, Cyp24, Asbt and Mdr1amRNA and protein expression increased significantly (2- to 20-fold) in 1,25(OH)2D3-treated rats,and a 28-fold increase of Cyp3a9 mRNA but not of total Cy3a protein nor Cyp3a1 and Cyp3a2mRNA was observed, implicating that VDR played a significant, renal-specific role in Cyp3a9induction. Additionally, renal mRNA levels of PepT1, Oat1, Oat3, Osta, and Mrp4, and proteinlevels of PepT1 and Oat1 were decreased in a dose-dependent manner, and the �50% concomitantreduction in FXR, SHP, HNF-1a and HNF-4amRNA expression suggests the possibility of cross-talkamong the nuclear receptors. It is concluded that the effects of 1,25(OH)2D3 changes are tissue-specific, differing between the intestine and kidney which are VDR-rich organs. Copyright r 2009John Wiley & Sons, Ltd.

Key words: 1a,25-dihydroxyvitamin D3; vitamin D receptor; intestine; colon; kidney; transpor-ters; enzymes; nuclear receptors; Asbt; Mrp; PepT1; Oat; Mdr1a; P-gp; cytochromeP450 enzymes; Cyp24 and Cyp3a9

Introduction

Vitamin D, the inert precursor of the active ligand,1a,25-dihydroxyvitamin D3 [1,25(OH)2D3], hasbeen used widely as a nutraceutical in theprevention of cancer and prolongation of long-evity [1–4]. Much is known about the molecular

Glossary: 1,25(OH)2D3, 1a,25-dihydroxyvitamin D3; Asbt/ASBT, rat/human apical sodium dependent bile acid trans-porter; Cyp/CYP, rat/human cytochrome P450 enzyme; FXR,farnesoid X receptor; Gapdh, rat glyceraldehyde-3-phosphatedehydrogenase; HNF, hepatocyte nuclear factor; LRH-1, liverreceptor homolog-1; LXRa, liver X receptor alpha; Mdr1a, ratmultidrug resistance protein 1a or P-glycoprotein (P-gp); Mrp,rat multidrug resistance-associated protein; NADPH, nicoti-namide adenine dinucleotide phosphate; Oat, rat organicanion transporter; Oct, rat organic cation transporter; Ost, ratorganic solute transporter; PepT, oligopeptide transporter;PMSF, phenylmethylsulfonyl fluoride; SHP, short heterodimerpartner; Sult2a1/SULT2A1, rat/human hydroxysteroid sulfo-transferase; TBS-T, Tris-buffered saline with 0.1% Tween 20;VDR, vitamin D receptor.

*Correspondence to: Leslie L. Dan Faculty of Pharmacy,University of Toronto, 144 College Street, Toronto, Ontario,Canada M5S 3M2.E-mail: [email protected]

Received 16 July 2009Revised 2 October 2009

Accepted 5 November 2009Copyright r 2009 John Wiley & Sons, Ltd.

249

actions of vitamin D on the regulation of calciumand phosphorus homeostasis and its indirectfeedback on the parathyroid hormone [5]. Theactivation of vitamin D requires both the con-secutive metabolism by the liver and the kidney toform 25-hydroxyvitamin D3 then 1a,25-dihydroxy-vitamin D3, the ligand of the vitamin D receptor(VDR) [6,7]. The toxic bile acid, lithocholic acid, isalso a VDR ligand that activates the VDR, albeit atmM rather than the nM concentration required for1,25(OH)2D3 [8,9]. VDR is present abundantly inthe rat intestine and kidney [10], but is present atmuch lesser amounts in the liver, where VDR isfound mostly in the stellate cells, Kupffer cells,endothelial cells and cholangiocytes and nothepatocytes [11]. In contrast, in the human liver,VDR is expressed in hepatocytes at low levelin addition to expression in non-parenchymalcells [12,13].

There are increasingly more in vitro and in vivostudies investigating the effects of 1,25(OH)2D3

on enzymes and transporters within first-passorgans, the liver and the intestine. 1,25(OH)2D3

was shown to regulate calcium homeostasis[14,15] and to be involved in the regulation oftransporters and enzymes [12,16–23]. The activa-tion of VDR by 1,25(OH)2D3 was reported to up-regulate the human cytochrome P450 enzyme,CYP3A4, and the hydroxysteroid sulfotransfer-ase (SULT2A1), and drug transporters such as themultidrug resistance protein (MDR1 or P-gp) andthe multidrug resistance associated proteins(MRP2 and MRP4) in Caco-2 cell studies[23–26]. In vivo, the VDR transactivated themurine Mrp3 [21] and the rat apical sodiumdependent bile acid transporter (Asbt) [16]. Inaddition, rat intestinal Cyp3a1 was observed tobe up-regulated by 1,25(OH)2D3 treatment bothin vivo and in vitro [17–19]. Interestingly, VDRactivation was able to blunt the liver X receptor(LXRa) signaling in HepG2 cells [27] and couldalso antagonize the activities of the farnesoid Xreceptor (FXR) [28], suggesting that cross-talkinteractions between these bile acids-relatednuclear receptors could lead to changes intransporters and enzymes in the liver. However,these effects are difficult to identify in vivo due toconfounding effects and inter-organ interactions.In our previous study, it was found that ratstreated with 1,25(OH)2D3 in vivo showed direct

VDR and FXR effects in the intestine and indirectFXR effects in the liver [18]. Induction of the ilealAsbt by 1,25(OH)2D3 via VDR [16] led to increasedbile acid absorption that resulted in increasedintestinal fibroblast growth factor 15 (FGF15).These triggered various secondary, FXR-relatedor non-related effects that led to down-regulationof the cholesterol metabolizing enzyme, Cyp7a1,in the rat liver [18]. The composite findingssuggest the importance of VDR in the regulationof not only intestinal Asbt and Cyp3a enzymesbut also secondary FXR-effects, resulting inreduction of Cyp7a1 in the liver in vivo [18].

The small intestine and the kidney are twomajor target organs of the VDR [5]. The kidneyplays a central role in the formation of1,25(OH)2D3. VDR mediates the regulation ofcalcium absorption in the intestine and reabsorp-tion in the kidney, with 1,25(OH)2D3 controllinglevels of the calcium-binding proteins, calbindinsD9K and D28K, and the calcium ion channels,transient receptor potential vanilloid type 5(TRPV5) and type 6 (TRPV6) [29–32]. In addition,1,25(OH)2D3 plays a major role in phosphate andsulfate homeostasis since the Type II renalsodium-dependent inorganic phosphate trans-porter [33] and the sodium-sulfate cotransporter[34] are targets of the VDR. For the feedbackcontrol of 1,25(OH)2D3 levels in the body, the1,25(OH)2D3-liganded VDR increases the cata-bolic enzyme, Cyp24, thereby increasing themetabolism of 1,25(OH)2D3 to the inactive meta-bolite, 1a,24,25-trihydroxyvitamin D3, to decreaseintracellular levels of 1,25(OH)2D3 in the kidney[5]. Taken together, the composite informationsuggests that 1,25(OH)2D3 and VDR play animportant role in the regulation of transportersand enzymes in the intestine and kidney.

However, the relative changes in target genesfor drug disposition by 1,25(OH)2D3 in theintestine and kidney, tissues which exhibit highVDR levels, have not been compared. This studyinvestigated the dose-dependent effects of1,25(OH)2D3 (from 0.64 to 2.56 nmol/kg/day)on intestinal and renal transporters and enzymesand similar changes for VDR-target genes in theintestine and kidney were expected due to theirabundance in these tissues. These higher chosendoses in the rat are estimated, through pharma-cokinetic analyses, to produce comparable blood

E. C. Y. CHOW ET AL.92


250

levels of 1,25(OH)2D3 to those in men who aregiven slightly lower 1,25(OH)2D3 doses, as aresult of the higher clearance of 1,25(OH)2D3

(4.6x) in the rat [35–39]. It was shown that Asbt, aVDR-targeted gene in the intestine, was also atarget in the kidney. However, opposite changeswere also observed. The oligopeptide transporter,PepT1, protein was increased in the intestine,whereas PepT1 and PepT2 and Osta, as well asthe expression of organic anion transporters(Oat1 and Oat3) were down-regulated by1,25(OH)2D3 in the kidney. The results inferpossibilities of cross-talk or secondary effects ofthe nuclear receptors in the kidney.

Materials and Methods

The active form of vitamin D, 1,25(OH)2D3, inpowder form was procured from Sigma-AldrichCanada (Mississauga, ON, Canada). Antibodieswere obtained from various sources: Cyp24 (H-87)from Santa Cruz Biotechnology (Santa Cruz, CA);anti-Mrp2 (ALX-801-016-C250), from Alexis Bio-chemicals, San Diego, CA; anti-Pgp (C219), fromAbcam, Cambridge, MA; anti-GAPDH (14C10),from Cell Signaling Technology, Danvers, MA;anti-VDR (MA1-710) was purchased from ThermoFisher Scientific Inc., Rockford, IL; anti-Cyp3a2(458223), from BD Biosciences, Mississauga, ONand OAT11-A was from Alpha Diagnostic Intl.Inc., San Antonio, TX. Other antibodies were kindgifts from various investigators: anti-PepT1(Dr Wolfgang Sadee, Ohio State University,Columbus, Ohio); anti-Asbt (Dr Paul A. Dawson,Wake Forest University School of Medicine, NC);anti-Mrp3 (Dr Yuichi Sugiyama, University ofTokyo, Japan); anti-Mrp4 (Dr John D. Schuetz, StJude Children’s Research Hospital, TN). All otherreagents were purchased from Sigma-AldrichCanada (Mississauga, ON, Canada) and FisherScientific (Mississauga, ON, Canada).

Induction study of 1; 25ðOHÞ2D3 in rats in vivo

The 1,25(OH)2D3, in anhydrous ethanol solution,was analyzed spectrophotometrically at 265 nm(UV-1700, Shimadzu Scientific Instruments, MD)and diluted in corn oil (Sigma-Aldrich, ON) forinjection. Male Sprague-Dawley rats (260–280 g;

n5 4 in each group; from Charles River, StConstant, QC) were injected intraperitoneallywith 0, 0.64, 1.28 and 2.56 nmol/kg/day of1,25(OH)2D3 in 1ml/kg corn oil for 4 days. Ratswere given water and food ad libitum andmaintained under a 12:12 h light and dark cyclein accordance to animal protocols approved bythe University of Toronto (ON, Canada). At 24 hfollowing the end of the last 1,25(OH)2D3 treat-ment, the rats were anesthetized with an intra-peritoneal injection of ketamine and xylazine (90and 10mg/kg, respectively). The portal vein wascannulated and flushed with 50ml of ice-coldsaline. The small intestine was removed andplaced on ice, and divided into eight segments[segment 1 (S1) is the duodenum, spanning fromthe pyloric ring to the ligament of Treitz; segment2 (S2) is the proximal jejunum segment of equallength that is immediately distal to the ligamentof Treitz. The remaining small intestine was thendivided into six segments of equal length (S3 toS8, with S8 representing the ileum proximalto the ileocecal junction)] [16]. Each segmentwas everted and placed into a test tube contain-ing 1 mM phenylmethylsulfonyl fluoride (PMSF)in physiological saline solution prior to scrapingof the enterocytes by a tissue-scraper [40]. Thecolon, taken as a 10 cm section adjacent to theileocecal junction, was removed of fecal mattersvia flushes of saline solution containing 1mM

PMSF; the tissue was everted, placed into a testtube containing 1 mM PMSF in saline and scrapedfor removal of the cells. The kidneys were alsoharvested, cut into small pieces. All tissue sampleswere snap-frozen with liquid nitrogen, and storedat �801C until further analysis.

Preparation of subcellular fractions

Enterocytes. The method of preparation of sub-cellular fractions had been described previouslyin detail [18]. Briefly, frozen mucosal scrapings(50–100mg of tissue) were mixed with 1 ml ofTris-HCl (0.1 M, pH 7.4) buffer containing 1%protease inhibitor cocktail (Sigma-Aldrich, ON)and homogenized on ice and then sonicated for10 s. Samples were centrifuged at 1000� g at 41Cfor 10min and the resulting supernatant wastransferred to a new tube and spun again at

1a,25-DIHYDROXYVITAMIN D3 ON RAT RENTAL AND INTESTINAL TRANSPORTERS AND ENZYMES 93


251

21000� g at 41C for 1h to yield the pellet (crudemembrane fraction). The crude membrane fractionwas used for Western blot analyses of intestinaltransporters.

Kidney. One whole kidney was homogenized (1:5w/v) in homogenizing buffer (250mM sucrose,10mM HEPES and 10mM Tris-HCl, pH 7.4) mixedwith 1% protease inhibitor cocktail (Sigma-Aldrich, ON) as described previously [18].Differential centrifugation was employed toobtain nuclear membrane, crude membrane andcrude cytosolic fractions for Western blot ana-lyses. Briefly, the kidney homogenate was cen-trifuged at 9000� g for 10min at 41C. The pelletor the nuclear fraction was resuspended withnuclear buffer, as described previously [18]. Thesupernatant was then spun at 33000� g for60min at 41C. The resultant supernatant orcytosol and the membrane fraction, resuspendedwith the resuspension buffer (50mM mannitol,20mM HEPES, 20mM Trizma base, pH 7.4), weremixed with 1% protease inhibitor cocktail (Sig-ma-Aldrich, ON).

The method of Lowry et al. [41] was used tomeasure the protein concentration using bovineserum albumin as the standard. Samples werethen stored at �801C until Western blot analysis.

Immunoblotting

Similar to the procedure of Chow et al. [18],samples were loaded and separated by 7.5% or10% SDS-polyacrylamide gels and transferredonto nitrocellulose membranes (Amersham Bio-sciences, Piscataway, NJ). Membranes wereblocked with 5% (w/v) skim milk in Tris-buffered saline (pH 7.4) with 0.1% Tween 20(TBS-T) (Sigma-Aldrich, ON), washed with TBS-T,and incubated with primary antibody solutionovernight at 41C. The membrane was washedagain, followed by incubation with secondaryantibody. After the second incubation, the mem-branes were washed and bands were visualizedusing chemiluminescence reagents from Amer-sham Biosciences (Piscataway, NJ) and quantifiedby scanning densitometry (NIH Image software;http://rsb.info.nih.gov/nih-image/). To correct forprotein loading error, the band intensity of thetarget protein of each sample was normalized

against the house keeping protein, villin, forintestinal samples and glyceraldehyde-3-phosphatedehydrogenase (Gapdh) for kidney samples.

Quantitative real-time polymerase chain reaction(qPCR)

Scrapedenterocytes fromrepresentative segments:S1 forduodenum, S2 andS7 forproximal anddistaljejunum, respectively, and S8 for the ileum, as wellas the colon and the kidney were homo-genized with TRIzol (50–100mg/ml). Total RNAwas isolated using the TRIzol extraction method(Sigma-Aldrich, ON) according to the manufac-turer’s protocol, with modifications. The totalRNA of each sample was then quantified by UVspectrometry measured at 260nm and the puritywas checked by 260nm/280nm and 260nm/230nm ratio (X1.8). 1.5mg of total RNAwas usedto synthesize cDNA using the High CapacitycDNA Reverse Transcription Kit (Applied Biosys-tems Canada, ON) on the Applied Biosystem 2720Thermal Cycler. Real-time quantitative polymer-ase chain reaction (qPCR)was performedwith twodetection systems (SYBR Green or Taqman assay),depending on the availability of primer sets.Information on theprimerswasdescribed inChowet al. [18] and shown in Table 1. BLAST analysiswas run for the primer sets to ensure primerspecificity for the gene of interest (http://www.ncbi.nlm.nih.gov/BLAST/). Aliquots of75 ng of cDNA were mixed with 1 mM of forwardand reverse primers, and 1� Power SYBR GreenPCRMaster Mix (Applied Biosystems) to performPCR analysis. Amplification and detection wereperformed using the ABI 7500 system at thedefault thermal cycle setting: 951C for 10min,and 40 cycles of 951C for 15 s and 601C for 1min,followed by the dissociation curve. All target genemRNA data were normalized to villin in theintestine and Gapdh in the kidney by using ABISequence Detection software version 1.4 to obtaincritical threshold cycle (CT) values. Fold expres-sion is represented as 2�(DDCT) for relative mRNAquantification.

Statistical analysis

Protein and mRNA data were expressed asmean7standard deviation. The two-tailedStudent’s t-test and the Mann-Whitney U test



252

were used to compare differences betweenvehicle control and treatment groups. For in-testinal and colon mRNA and protein analyses,the vehicle-treated S1 sample (value set as unity)was used for the normalization of other vehicle-and 1,25(OH)2D3-treated samples in other seg-ments and colon. For renal mRNA and proteinanalyses, the vehicle-treated sample was set asthe control (value set as unity), and was usedfor comparison with those of other treatmentsamples. A value of p less than 0.05 was set as thesignificant level.

Results

Distribution of enzymes and transporters inthe small intestine and colon and effects of1; 25ðOHÞ2D3

The distribution patterns of mRNA and proteinof the nuclear receptors, transporters and en-zymes in the small intestine, if previouslyunknown, were first examined under controlconditions and compared with the amountpresent in the colon. Then the segments withthe greatest abundance were chosen to examine

changes in transporter and enzyme expression by1,25(OH)2D3 since both mRNA and proteinexpressions were present.

Distribution of VDR in small intestine, colon,liver and kidney

Lower VDR mRNA levels in the kidney and liverwere found when compared with that of thesmall intestine (S1); the highest mRNA levelexisted in colon (Figure 1). However, there wasno difference in VDR protein levels in the smallintestine, colon and kidney, whereas the VDRprotein level in the liver was only 14% that of S1(Figure 1).

Distribution of HNF-1a in small intestine andcolon and effects of 1; 25ðOHÞ2D3

The mRNA expression of HNF-1a was very lowand was evenly distributed in the small intestine;the levels were 2.2-fold higher in the colon(Figure 2). Generally, 1,25(OH)2D3 treatmenthad no effect on HNF-1a along the length of thesmall intestine and colon although a minorsignificant decrease (15%) was observed in theileum at 1.28 nmol/kg dose.

Table 1. Rat primer sets for quantitative real-time PCR

Gene bank number Forward (50- 30 sequence) Reverse (50- 30 sequence)

Gapdh XR_007996 CGCTGGTGCTGAGTATGTCG CTGTGGTCATGAGCCCTTCCMrp2 NM_012833 CTGGTGTGGATTCCCTTGG CAAAACCAGGAGCCATGTGCMrp3 NM_080581 ACACCGAGCCAGCCATATAC TCAGCTTCACATTGCCTGTCMrp4 NM_133411 GCCCTTACCCAGCTGCTGA CAGAATCCAGAGAGCCTCTTTTACAOat1 NM_017224 ATGCCTATCCACACCCGTGC GGCAAAGCTAGTGGCAAACCOat3 BC081777 TGAGAAGTGTCTCCGCTTCG CTGTAGCCAGCGCCACTGAGAsbt NM_017222 TCAGTTTGGAATCATGCCTCTCA ACAGGAATAACAAGCGCAACCAPepT1a NM_057121 Applied Biosystems, Canada (Cat# Rn00589098_m1)PepT2 NM_031672 GGACCTTCCGAAGCGACAA GCGATGAGATGCTTTGGATATTTOst-ab NM_001107087 TGTCATCCTGACCGCCCT AAGCGATCTGCCCGCTGOst-b XM_001076555 TATTCCATCCTGGTTCTGGCAGT CGTTGTCTTGTGGCTGCTTCTTMdr1a AY582535 GGAGGCTTGCAACCAGCATTC CTGTTCTGCCGCTGGATTTCCyp3a1 NM_013105 GGAAATTCGATGTGGAGTGC AGGTTTGCCTTTCTCTTGCCCyp3a2 XM_573414 AGTAGTGACGATTCCAACATAT TCAGAGGTATCTGTGTTTCCTCyp3a9 U60085 GGACGATTCTTGCTTACAGG ATGCTGGTGGGCTTGCCTTCCyp24 NM_201635 GCATGGATGAGCTGTGCGA AATGGTGTCCCAAGCCAGCVDR NM_017058 ACAGTCTGAGGCCCAAGCTA TCCCTGAAGTCAGCGTAGGTFXR NM_021745 AGGCCATGTTCCTTCGTTCA TTCAGCTCCCCGACACTTTTSHP BC088117 CCTTGGCTAGCTGGGTACCA GTCCCAAGGAGTACGCATACCTLRH-1 NM_021742 GCTGCCCTGCTGGACTACAC TGTAGGGCACATCCCCATTCHNF-1a X54423 CTCCTCGGTACTGCAAGAAACC TTGTCACCCCAGCTTAAGACTCTHNF-4a EF193392 CCAGCCTACACCACCCTGGAGTT TTCCTCACGCTCCTCCTGAA

aPepT1 primer set is for Taqmans gene expression assay.bOsta primer set includes probe 50 FAM-CAGCCCTCCATTTTCTCCATCTTGGC-TAMRA 30 for Taqmans gene expression assay.



253

Distribution of Cyp24 in small intestine andcolon and effects of 1; 25ðOHÞ2D3

The mRNA expression of Cyp24, a catabolicenzyme that inactivates 1,25(OH)2D3 [32,42],

exhibited an increasing trend, from duodenumto ileum (3.6-fold of S1), and was highest inthe colon (41-fold of S1; Figure 3). However,the mRNA expression of Cyp24 in the intestinewas fairly low (CT value about 27 to 29 in thesmall intestine and �24 in the colon). Cyp24mRNA levels were significantly induced with1,25(OH)2D3 treatment along the length of thesmall intestine, but not in the colon at the highestdose. For the other doses, strong up-regulationwas seen. But the results failed to reach statisticalsignificance due to the high variation observedamong the preparations (1.6 to 90-fold comparedwith control; Figure 3).

Distribution of apical, absorptive transportersin the small intestine and colon and effects of1; 25ðOHÞ2D3

PepT1. The mRNA distribution of the oligopep-tide transporter, PepT1, an absorptive transpor-ter, was evenly distributed in the rat smallintestine, despite a previous report havingsuggested a proximal distribution [43]. ThemRNA of this absorptive transporter was vir-tually absent in the colon (Figure 4A). PepT1mRNAwas mostly unchanged with 1,25(OH)2D3

(Figure 4A). By contrast, PepT1 protein levels in

Figure 1. Distribution of rat VDR mRNA and protein (n5 3 or4 in each group). mRNA and protein distributions of VDR inthe small intestine [duodenum (S1), proximal jejunum (S2),distal jejunum (S7) and ileum (S8)], colon, liver and kidney areshown, normalized to Gapdh expression. y indicates po0.05compared with the level of S1 segment using the two-tailedStudent’s t-test.

Figure 2. Distribution and dose-dependent effects of1,25(OH)2D3 on intestinal HNF-1a mRNA (n5 3 or 4 in eachgroup). � indicates po0.05 compared with vehicle control inthe same segment, whereas y indicates po0.05 compared withthe level of vehicle-control S1 segment using the two-tailedStudent’s t-test.

Figure 3. Distribution and dose-dependent effects of1,25(OH)2D3 on intestinal Cyp24 mRNA (n5 3 or 4 in eachgroup). � indicates po0.05 compared with vehicle control inthe same segment, whereas y indicates po0.05 compared withthe level of vehicle-control S1 segment using the two-tailedStudent’s t-test. #indicates po0.05 compared with vehiclecontrol in the same segment using the Mann-Whitney U test.



254

S1 and S2 segments showed significant inductionat the highest 1,25(OH)2D3 dose (Figure 4B).

Oat1 and Oat3. Unlike PepT1, the mRNA dis-tribution of the organic anion transporters, Oat1

and Oat3, displayed an increasing trend, fromduodenum to ileum (Figures 5A and 5B). ThemRNA expression of Oat1 in the colon was 4-foldhigher compared with that in the duodenumwhile there was no difference for Oat3. A small

Figure 4. Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of PepT1 (n5 3 or 4 in eachgroup). PepT1 mRNA (A) and protein (B), detected at 95 kDa in S1 and S2 segments, are shown with the 1,25(OH)2D3 treatments� indicates po0.05 compared with vehicle control in the same segment, whereas y indicates po0.05 compared with the level ofvehicle-control S1 segment using the two-tailed Student’s t-test.

Figure 5. Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal (A) Oat1 and (B) Oat3 mRNA (n5 3 or 4 in eachgroup). � indicates po0.05 compared with vehicle control in the same segment, whereas y indicates po0.05 compared with thelevel of vehicle-control S1 segment using the two-tailed Student’s t-test.



255

Figure 6. Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal Mdr1a mRNA and P-gp protein (n5 3 or 4 in eachgroup). Mdr1a mRNA (A) and P-gp protein (B), detected at 170 kDa, for S8 are shown. � denotes po0.05 compared with vehiclecontrol in the same segment, whereas y indicates po0.05 compared with the level of vehicle-control S1 segment using the two-tailedStudent’s t-test.

Figure 7. Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Mrp2 (n5 3 or 4 in eachgroup). Mrp2 mRNA (A) and protein distribution (B, C) in the small intestine [duodenum (S1), jejunum (S2-S7), and ileum (S8)]and colon and (D) the inductive changes of Mrp2 protein in S1 and S2, detected at 180 kDa, with 1,25(OH)2D3 treatments areshown. � indicates po0.05 compared with vehicle control in the same segment, whereas y indicates po0.05 compared with thelevel of vehicle-control S1 segment using the two-tailed Student’s t-test.



256

increase in Oat1 mRNA (70%) with 1,25(OH)2D3

treatment in the duodenum and a 2.7-foldincrease in Oat3 mRNA in the colon wereobserved at the highest dose (Figures 5A and5B). However, in the ileum, both Oat1 and Oat3mRNA levels were greatly decreased at all doses(456%); there was a 66% decrease in Oat3mRNA in S7 at the 1.28 nmol/kg dose.

Distribution of apical efflux transporters, Mdr1aand Mrp2 in the small intestine and colon andeffects of 1; 25ðOHÞ2D3

Mdr1a (P-gp). Levels of Mdr1a mRNA displayedan increasing trend, from the duodenum to theileum, as observed by others [44], and the levels

were highest in the colon: S15 S2oS75 S8 oocolon (Figure 6A). 1,25(OH)2D3 failed to alter themRNA expression of intestinal Mdr1a, except fora small decrease (34%) in the S7 segment at thehighest 1,25(OH)2D3 dose (Figure 6A). P-gpprotein expression in the S8 segment (ileum)was the highest, but did not show any demon-strable trend of induction with 1,25(OH)2D3

treatment (Figure 6B).

Mrp2. Unlike Mdr1a, the distribution of Mrp2mRNA and protein was found to decrease fromthe duodenum to ileum, as found earlier [45],then to very low levels in the colon; the mRNAlevels of these transporters were highest in S1and S2 (Figures 7A, 7B and 7C). 1,25(OH)2D3 didnot alter the mRNA levels of Mrp2 among all the

Figure 8. Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Mrp3 (n5 3 or 4 in eachgroup). Mrp3 mRNA (A) and protein (B, C) distribution in the small intestine [duodenum (S1), jejunum (S2-S7) and ileum (S8)]and colon are shown. Inductive changes in Mrp3 protein in S1 and S2, detected at 170 kDa, with the 1,25(OH)2D3 treatments wereobserved (D). � indicates po0.05 compared with vehicle control in the same segment, whereas y indicates po0.05 compared withthe level of vehicle-control S1 segment using the two-tailed Student’s t-test.



257

intestinal segments (Figure 7A) and colon, butthe protein expression of Mrp2 in the S1 and S2segments was significantly induced by1,25(OH)2D3 (Figures 7B and 7D).

Distribution of basolateral efflux transportersin small intestine and colon and effects of1; 25ðOHÞ2D3

Mrp3. The mRNA expression of Mrp3 exhibitedan ascending distribution pattern, increasingfrom the duodenum to ileum, then the colon(Figure 8A). Mrp3 protein expression was high-est at the duodenum, but this drastically droppedwithin the proximal jejunum, with levels gradu-ally increasing towards the ileum (Figures 8B and

8C). However, in the colon, protein levels ofMrp3 were even higher than in the jejunum.1,25(OH)2D3 failed to perturb Mrp3 mRNAlevels, but increased Mrp3 protein levels in bothS1 and S2, especially with higher 1,25(OH)2D3

doses (Figures 8B and 8D).

Mrp4. The mRNA and protein distributions ofMrp4 were similar to those of Mrp3: an ascend-ing distribution pattern, increasing from theduodenum to ileum, was observed for Mrp4mRNA (Figure 9A). A significantly highermRNA level was observed in the colon. Interest-ingly, Mrp4 protein expression was highest in S1,but decreased precipitously in S2, followed by agradual increasing trend towards S8 in the smallintestine (Figures 9B and 9C). Mrp4 protein in the

Figure 9. Distribution and dose-dependent effects of 1,25(OH)2D3 on intestinal mRNA and protein of Mrp4 (n5 3 or 4 in eachgroup). Mrp4 mRNA (A) and protein (B, C) distribution in the small intestine [duodenum (S1), jejunum (S2-S7) and ileum (S8)]and colon are shown. Changes in Mrp4 protein by 1,25(OH)2D3 treatments in S1 and S2 segments were observed (D). Mrp4protein band was detected at 160 kDa. � indicates po0.05 compared with vehicle control in the same segment, whereas y indicatespo0.05 compared with the level of vehicle-control S1 segment using the two-tailed Student’s t-test.



258

colon was quite high and was only 17%lower compared with that of the duodenum.Dose-dependent 1,25(OH)2D3 induction ofMrp4 was observed in the S2 segment(Figures 9B and 9D).

Effect of 1; 25ðOHÞ2D3 on nuclear receptors,enzymes, drug transporters in the kidney

Nuclear receptors. Renal VDR mRNA was signifi-cantly induced about 2-fold at all doses of1,25(OH)2D3 (Figure 10A) while the nuclearVDR protein was significantly induced by 60%at the highest dose (Figure 10B). LRH-1 mRNAwas relatively unchanged (Figure 10A). On theother hand, mRNA levels of other nuclearreceptors, FXR, SHP, and the transcription fac-tors, HNF-4a and HNF-1a, were reduced by 50%to 60% after 1,25(OH)2D3 treatment with thedoses of 1.28 and 2.56 nmol/kg.

Cyps. The mRNA level of Cyp24, the enzymeknown to respond to 1,25(OH)2D3 induction,was 20-fold higher at all 1,25(OH)2D3 doses(Figure 11A), and Cyp24 protein was increasedsignificantly (4-fold) at the highest 1,25(OH)2D3

dose (Figure 11B). Interestingly, Cyp3a9 mRNAexpression was significantly induced 4 28-foldby 1,25(OH)2D3 for all doses (Figure 11A).Cyp3a2 mRNA was reduced (495%; po0.05) atthe highest dose, whereas the decrease in Cyp3a1mRNA was not significant (Figure 11A). TotalCyp3a protein was slightly increased, though thechange was not significant (Figure 11B).

Transporters. The mRNA expression of Oat1 andOat3, basolateral transporters, was much higherthan those in the small intestine (CT values of 17and 20 compared with 29 and 34 in the intestine),and was reduced with 1,25(OH)2D3 treatments(Figure 12A). Osta mRNAwas decreased by 60%

Figure 10. Dose-dependent effects of 1,25(OH)2D3 on changes in (A) mRNA and (B) protein of renal nuclear receptors (n5 3 or 4in each group). Gapdh and VDR bands were detected at 37 and 52 kDa, their molecular weights, respectively. � indicates po0.05compared with vehicle control using the two-tailed Student’s t-test.



259

at the highest dose while the decrease in OstbmRNA was insignificant. The protein expressionof Oat1 was reduced 50% (Figure 12B), whereasno change was observed for Mrp3 mRNA andprotein (Figure 12A and 12B).ThemRNAlevels of the renal reabsorptive apical

transporters, Asbt (4-fold) and P-gp (2–2.5 fold)were significantly increased (Figure 13A). In-creased Asbt protein was observed, and thiscorrelated with the increase in mRNA levels with1,25(OH)2D3 treatment (Figure 13A and 13B),though being significant only at the 1,25(OH)2D3

dose of 0.64 nmol/kg. By contrast, P-gp mRNAinduction was associated with a 2- to 4-foldincrease in protein expression at the higher doses(Figure 13A and 13B). However, down-regulationof PepT1, PepT2 and Mrp4 mRNA expressionwas observed (Figure 13A), while that of Mrp2was unchanged. A significant reduction in PepT1mRNA level was associated with a parallelreduction in protein level. Changes in Mrp2 and

Mrp4 protein in the kidney with 1,25(OH)2D3

treatment were minimal (Figure 13B).

Discussion

In this study, it was demonstrated that transpor-ters and enzymes, known to be regulated by VDRor by non-genomic VDR effects, could beregulated in both the intestine and kidney. Theeffects of VDR appeared to affect kidney trans-porters and enzymes more so than those in theintestine. Moreover, some of the changes werefound to be opposite and tissue-specific. Themodulations found in this study might suggesttissue-specific changes in drug disposition.

In the rat kidney, there was induction of P-gp,localized in renal proximal tubules [46], Asbt,and Cyp3a9, localized in the renal cortex [47],(Figures 11 and 13). Recently, Saeki et al. [48] andZierold et al. [49] showed the presence of a VDRE

Figure 11. Dose-dependent effects of 1,25(OH)2D3 on changes in (A) mRNA and (B) protein of renal cytochrome P450 isozymes(n5 3 or 4 in each group). Gapdh, Cyp24 and Cyp3a bands were detected at 37, 50 and 56 kDa, their molecular weights,respectively. � indicates po0.05 compared with vehicle control using the two-tailed Student’s t-test.



260

in the human multidrug resistance protein(MDR1) and in the rat Cyp3a9 genes, respectively.Thus, induction of rat renal Cyp3a9 and P-gp(Figures 11A and 13B) is most likely via VDRtransactivation. Previous reports on the rat smallintestine showed induction of Asbt in vivo [18],and the increased Asbt in the kidney is likely aresult of VDR activation as well (Figure 13).Previously, we had attributed that the increasedileal Asbt elevated portal bile acid concentrationswith 1,25(OH)2D3 treatment [18]. Presently, it wasfound that renal Asbt was also induced, and thiscould further augment bile acid reabsorption,rendering higher plasma bile acid concentrationsand leading to downstream FXR effects in theliver [18]. Interestingly, Cyp3a9 mRNA in thekidney was induced (Figure 11A) even thoughrenal Cyp3a1 and Cyp3a2 mRNAs (Figure 11A)were not affected by 1,25(OH)2D3, and thisobservation contrasted with the results on the

induction of Cyp3a1 in the intestine and Cyp3a2in the liver in the rat in vivo [18,19] and in ratintestinal slices [17]. The observation suggests thatthe induction of Cyp3a9 isoform is renal-specific.Overall, renal VDR plays an important role in theregulation of renal transporters and enzymes thatare VDR target genes.

In the intestine, induction of PepT1 and Mrpprotein (Figures 4B, 7B, 8B and 9B) in theproximal segments may be related to non-genomic effects of 1,25(OH)2D3 as it was shownto be linked to an active calcium absorptionmechanism triggered by the VDR in the duode-num and proximal jejunum [50]. 1,25(OH)2D3

could increase Ca21 uptake in the rat duodenalintestine, an effect that may be linked to thecAMP-mediated activation of plasma membraneCa21 channels [51]. The increased cAMP levelscould explain elevated protein levels of PepT1[52], Mrp2 [53] and Mrp3 [54] in S1 and S2

Figure 12. Dose-dependent effects of 1,25(OH)2D3 on changes in (A) mRNA and (B) protein of renal basolateral transporters(n5 3 or 4 in each group). Gapdh, Oat1 and Mrp3 bands were detected at 37, 72 and 170kDa, their molecular weights,respectively. � indicates po0.05 compared with vehicle control using the two-tailed Student’s t-test.



261

segments in our study, either by short termregulation or membrane vesicle trafficking.Furthermore, there may be a role of cAMP onMrp4 protein expression with 1,25(OH)2D3 treat-ment since Mrp4 has been shown to transportcAMP and cGMP [55]. Similar observations weremade in the human Caco-2 cell monolayer;incubation with 100 nM of 1,25(OH)2D3 for 43days increased MRP4 protein without a changein mRNA, likely due to the stabilization of MRP4protein with 1,25(OH)2D3 treatment [23].

Similar to the observations for the smallintestine, renal Oat1, Oat3, PepT1 and PepT2(Figures 12 and 13) may also be affected by thenon-genomic effects of 1,25(OH)2D3. In thekidney, 1,25(OH)2D3 and cAMP were needed toup-regulate VDR mRNA and protein expressionto modulate Cyp24 [56]. Others had also found

that treatment with 1,25(OH)2D3 increased theactivity of protein kinase C (PKC) in MadinDarby bovine kidney (MDBK) cells, a normalrenal epithelial cell line derived from bovinekidney [57]. Decreased renal organic aniontransport by Oat1 [58] and Oat3 [59] due toPKC activation was observed in the rat. Thisreasoning may be used to explain the down-regulation of Oat1 and Oat3 mRNA levels in theileum (Figure 5). Additionally, other studiesfound that PepT1 transport was attenuated withincreased cAMP levels that led to PKC activation[60,61]; the same may apply to PepT2 that alsocontains a PKC recognition region [62]. Thesecould explain the decrease in renal PepT1 andPepT2. Therefore, non-genomic effects of1,25(OH)2D3 could regulate transporters in thekidney.

Figure 13. Dose-dependent effects of 1,25(OH)2D3 on changes in (A) mRNA and (B) protein of renal apical transporters (n5 3 or 4in each group). Gapdh, Asbt, PepT1, P-gp, Mrp2 and Mrp4 bands were detected at 37, 48, 95, 170, 180 and 160 kDa, theirmolecular weights, respectively. � indicates po0.05 compared with vehicle control using the two-tailed Student’s t-test.



262

Based on our previous study [18], cross-talkbetween nuclear receptors was not observedfor the rat intestine even though VDR and FXRactivations by 1,25(OH)2D3 and bile acids, res-pectively, were observed. In the liver, cross-talkbetween VDR and other nuclear receptors wasunlikely due to low levels of VDR in hepatocytes[11]. On the other hand, higher levels of VDR andother nuclear receptors are present in the kidney,and are conducive to cross-talk interactions.A reduction in FXR and SHP mRNA levels by1,25(OH)2D3 was observed (Figure 10A), and alsoby Honjo et al. [28] in the VDR-ligand-mediateddecrease of FXR and SHP in the kidney cell line,CV1. This reduction may have conduced to thedown-regulation of Osta mRNA (Figure 12A), aFXR targeted gene. The decrease in Ostb was notsignificant, showing that Osta, was more respon-sive to FXR. This was observed in rats in vivowhere FXR effects in the liver increased the OstamRNA level but not Ostb [18]. However,1,25(OH)2D3, in the absence of bile acids, coulddecrease Osta mRNA directly in rat intestinalslices [20]. Similarly, the inhibition of rat Oat3

(Figure 12A) might be the result of decreasedHNF-1a levels in the 1,25(OH)2D3 treatmentgroups (Figure 10A), inasmuch as HNF-1a wasknown to be involved in the basal expressionof human OAT3 in Caco-2 and HepG2 celllines [63]. Hence, renal VDR could potentiallydown-regulate renal transporters through thedown-regulation of other renal nuclear receptorsor transcription factors, such as FXR andHNF-1a.

The data from this and previous rat in vivostudies [18] are summarized in Table 2.Certainly, the molecular mechanisms by which1,25(OH)2D3 and VDR regulate intestinal andrenal drug transporters and enzymes remainunclear and need to be clarified. The VDR effectson increased Asbt and Cyp24 were similar forboth the intestine and kidney, whereas oppositetrends for Mrp2, Mrp4, PepT1, Osta and Ostbwere observed. VDR induction led to increasedCyp3a1 and Cyp3a2 in the intestine and Cyp3a9for the kidney; P-gp changes were insignificant inthe intestine but were increased markedly in thekidney. This study demonstrates that changes in

Table 2. Comparison of VDR-related changes in mRNA and protein in the rat intestine, kidney and liver after 1,25(OH)2D3

treatment (fold increases) of the rat in vivo for 4 days. Some of the data on the intestine and liver were obtained from Chowet al. [18]

Nuclear receptors,transporters or enzymes

Intestine Kidney Liver

mRNA Protein mRNA Protein mRNA Protein

VDR 2 2 m m m 2FXR 2 N/A k N/A m N/ASHP m N/A k N/A m N/ALXRa N/A N/A N/A N/A m N/AHNF-1a 2 N/A k N/A m N/AHNF-4a N/A N/A k N/A m N/ALRH-1 2 N/A 2 N/A m N/ACyp3a1 m m 2 2 2 2Cyp3a2 k mCyp3a9 2 m 2Cyp24 m N/A m m 2 N/AAsbt 2a ma m m 2 2Mdr1a (P-gp) 2 2a m m m mPepT1 2 m k k N/A N/APepT2 N/A N/A k N/A N/A N/AMrp2 2 m 2 2 2 2Mrp3 2 m 2 2 m 2Mrp4 2 m k 2 2 2Osta ma N/A k N/A m N/AOstb ma N/A k N/A 2 N/AOat1 ka N/A k k N/A N/AOat3 ka N/A k N/A N/A N/A

N/A dictates unavailable; 2 means unchanged.aChanges in the ileum only (S8 segment).



263

transporters and enzymes of the intestine andkidney by 1,25(OH)2D3 treatment are tissue-specific and could alter the pharmacokinetics ofdrugs differentially. This new information furtheropens up more queries. More experiments areneeded to examine possible transcriptional andposttranscriptional regulation mechanisms aswell as to examine changes in drug disposition.

Acknowledgments

This work was supported by the CanadianInstitutes for Health Research, MOP89850.

References

1. Mullin GE, Dobs A. Vitamin D and its rolein cancer and immunity: a prescription forsunlight. Nutr Clin Pract 2007; 22: 305–322.

2. Holick MF. Sunlight and vitamin D for bonehealth and prevention of autoimmune diseases,cancers, and cardiovascular disease. Am J ClinNutr 2004; 80: 1678S–1688S.

3. Schwartz GG, Skinner HG. Vitamin D status andcancer: new insights. Curr Opin Clin Nutr MetabCare 2007; 10: 6–11.

4. Thomas DR. Vitamins in aging, health, andlongevity. Clin Interv Aging 2006; 1: 81–91.

5. Jones G, Strugnell SA, DeLuca HF. Currentunderstanding of the molecular actions ofvitamin D. Physiol Rev 1998; 78: 1193–1231.

6. Feldman D, Pike JW, Glorieux FH. Vitamin D.2nd edn. Elsevier Academic Press: Amsterdam;Boston; 2005.

7. Prosser DE, Jones G. Enzymes involved in theactivation and inactivation of vitamin D. TrendsBiochem Sci 2004; 29: 664–673.

8. Makishima M, Lu TT, Xie W et al. Vitamin Dreceptor as an intestinal bile acid sensor. Science2002; 296: 1313–1316.

9. Nehring JA, Zierold C, DeLuca HF. Lithocholicacid can carry out in vivo functions of vitamin D.Proc Natl Acad Sci USA 2007; 104: 10006–10009.

10. Sandgren ME, Bronnegard M, DeLuca HF.Tissue distribution of the 1,25-dihydroxyvitaminD3 receptor in the male rat. Biochem Biophys ResCommun 1991; 181: 611–616.

11. Gascon-Barre M, Demers C, Mirshahi A,Neron S, Zalzal S, Nanci A. The normal liverharbors the vitamin D nuclear receptor innonparenchymal and biliary epithelial cells.Hepatology 2003; 37: 1034–1042.

12. Khan AA, Chow EC, van Loenen-Weemaes AM,Porte RJ, Pang KS, Groothuis GM. 1a,25-Dihy-droxy vitamin D3 mediates down-regulation of

HNF4a, CYP7A1 and NTCP in human butnot rat liver slices. Drug Metab Dispos 2009:submitted.

13. Han S, Chiang JY. Mechanism of vitamin Dreceptor inhibition of cholesterol 7a-hydroxylasegene transcription in human hepatocytes. DrugMetab Dispos 2009; 37: 469–478.

14. Walters JR, Balesaria S, Khair U, Sangha S,Banks L, Berry JL. The effects of vitamin Dmetabolites on expression of genes for calciumtransporters in human duodenum. J SteroidBiochem Mol Biol 2007; 103: 509–512.

15. Abrams SA, O’Brien KO. Calcium and bonemineral metabolism in children with chronicillnesses. Annu Rev Nutr 2004; 24: 13–32.

16. Chen X, Chen F, Liu S et al. Transactivation of ratapical sodium-dependent bile acid transporterand increased bile acid transport by 1a,25-dihydroxyvitamin D3 via the vitamin D receptor.Mol Pharmacol 2006; 69: 1913–1923.

17. Khan AA, Chow EC, van Loenen-Weemaes AM,Porte RJ, Pang KS, Groothuis GM. Comparisonof effects of VDR versus PXR, FXR and GRligands on the regulation of CYP3A isozymes inrat and human intestine and liver. Eur J PharmSci 2009; 37: 115–125.

18. Chow ECY, Maeng HJ, Liu S, Khan AA,Groothuis GMM, Pang KS. 1a,25-Dihydroxyvi-tamin D3 triggered vitamin D receptor andfarnesoid X receptor-like effects in rat intestineand liver in vivo. Biopharm Drug Dispos 2009; 30:457–475.

19. Xu Y, Iwanaga K, Zhou C, Cheesman MJ, Farin F,Thummel KE. Selective induction of intestinalCYP3A23 by 1a,25-dihydroxyvitamin D3 in rats.Biochem Pharmacol 2006; 72: 385–392.

20. Khan AA, Chow EC, Porte RJ, Pang KS,Groothuis GM. Expression and regulation ofthe bile acid transporter, OSTa-OSTb in rat andhuman intestine and liver. Biopharm Drug Dispos2009; 30: 241–258.

21. McCarthy TC, Li X, Sinal CJ. Vitamin D receptor-dependent regulation of colon multidrug resis-tance-associated protein 3 gene expression bybile acids. J Biol Chem 2005; 280: 23232–23242.

22. Schmiedlin-Ren P, Thummel KE, Fisher JM,Paine MF, Watkins PB. Induction of CYP3A4by 1a,25-dihydroxyvitamin D3 is human cellline-specific and is unlikely to involve pregnaneX receptor. Drug Metab Dispos 2001; 29:1446–1453.

23. Fan J, Liu S, Du Y, Morrison J, Shipman R, PangKS. Up-regulation of transporters and enzymesby the vitamin D receptor ligands, 1a,25-dihy-droxyvitamin D3 and vitamin D analogs, in theCaco-2 cell monolayer. J Pharmacol Exp Ther 2009;330: 389–402.

24. Aiba T, Susa M, Fukumori S, Hashimoto Y. Theeffects of culture conditions on CYP3A4 and



264

MDR1 mRNA induction by 1a,25-dihydroxyvita-min D3 in human intestinal cell lines, Caco-2 andLS180.Drug Metab Pharmacokinet 2005; 20: 268–274.

25. Schmiedlin-Ren P, Thummel KE, Fisher JM,Paine MF, Lown KS, Watkins PB. Expression ofenzymatically active CYP3A4 by Caco-2 cellsgrown on extracellular matrix-coated permeablesupports in the presence of 1a,25-dihydroxy-vitamin D3. Mol Pharmacol 1997; 51: 741–754.

26. Echchgadda I, Song CS, Roy AK, Chatterjee B.Dehydroepiandrosterone sulfotransferase is atarget for transcriptional induction by the vita-min D receptor. Mol Pharmacol 2004; 65: 720–729.

27. Jiang W, Miyamoto T, Kakizawa T et al. Inhibi-tion of LXRa signaling by vitamin D receptor:possible role of VDR in bile acid synthesis.Biochem Biophys Res Commun 2006; 351: 176–184.

28. Honjo Y, Sasaki S, Kobayashi Y, Misawa H,Nakamura H. 1,25-dihydroxyvitamin D3 and itsreceptor inhibit the chenodeoxycholic acid-de-pendent transactivation by farnesoid X receptor.J Endocrinol 2006; 188: 635–643.

29. Dupret JM, Brun P, Perret C, Lomri N,Thomasset M, Cuisinier-Gleizes P. Transcrip-tional and post-transcriptional regulation ofvitamin D-dependent calcium-binding proteingene expression in the rat duodenum by1,25-dihydroxycholecalciferol. J Biol Chem 1987;262: 16553–16557.

30. Hoenderop JG, van der Kemp AW, Hartog Aet al. Molecular identification of the apicalCa21 channel in 1,25-dihydroxyvitamin D3-responsive epithelia. J Biol Chem 1999; 274:8375–8378.

31. den Dekker E, Hoenderop JG, Nilius B, BindelsRJ. The epithelial calcium channels, TRPV5 andTRPV6: from identification towards regulation.Cell Calcium 2003; 33: 497–507.

32. Meyer MB, Zella LA, Nerenz RD, Pike JW.Characterizing early events associated with theactivation of target genes by 1,25-dihydroxyvi-tamin D3 in mouse kidney and intestine in vivo.J Biol Chem 2007; 282: 22344–22352.

33. Taketani Y, Segawa H, Chikamori M et al.Regulation of type II renal Na1-dependentinorganic phosphate transporters by 1,25-dihy-droxyvitamin D3. Identification of a vitaminD-responsive element in the human NAPi-3gene. J Biol Chem 1998; 273: 14575–14581.

34. Dawson PA, Markovich D. Regulation of themouse Nas1 promoter by vitamin D and thyroidhormone. Pflugers Arch 2002; 444: 353–359.

35. Brandi L, Egfjord M, Olgaard K. Pharmacoki-netics of 1,25(OH)2D3 and 1a(OH)D3 in normaland uraemic men. Nephrol Dial Transplant 2002;17: 829–842.

36. Ledger JE, Watson GJ, Ainley CC, Compston JE.Biliary excretion of radioactivity after intravenous

administration of 3H-1,25-dihydroxyvitamin D3

in man. Gut 1985; 26: 1240–1245.37. Barger-Lux MJ, Heaney RP, Dowell S, Chen TC,

Holick MF. Vitamin D and its major metabolites:serum levels after graded oral dosing in healthymen. Osteoporos Int 1998; 8: 222–230.

38. Kissmeyer AM, Binderup L. Calcipotriol (MC903): pharmacokinetics in rats and biologicalactivities of metabolites. A comparative studywith 1,25(OH)2D3. Biochem Pharmacol 1991; 41:1601–1606.

39. Muindi JR, Peng Y, Potter DM et al. Pharmaco-kinetics of high-dose oral calcitriol: results froma phase 1 trial of calcitriol and paclitaxel. ClinPharmacol Ther 2002; 72: 648–659.

40. Johnson BM, Zhang P, Schuetz JD, Brouwer KL.Characterization of transport protein expressionin multidrug resistance-associated protein (Mrp)2-deficient rats. Drug Metab Dispos 2006; 34:556–562.

41. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ.Protein measurement with the Folin phenolreagent. J Biol Chem 1951; 193: 265–275.

42. Healy KD, Zella JB, Prahl JM, DeLuca HF.Regulation of the murine renal vitamin Dreceptor by 1,25-dihydroxyvitamin D3 and cal-cium. Proc Natl Acad Sci USA 2003; 100:9733–9737.

43. Fei YJ, Kanai Y, Nussberger S et al. Expressioncloning of a mammalian proton-coupledoligopeptide transporter. Nature 1994; 368:563–566.

44. Liu S, Tam D, Chen X, Pang KS. P-glycoproteinand an unstirred water layer barring digoxinabsorption in the vascularly perfused rat smallintestine preparation: induction studies withpregnenolone-16a-carbonitrile. Drug Metab Dis-pos 2006; 34: 1468–1479.

45. Mottino AD, Hoffman T, Jennes L, Vore M.Expression and localization of multidrugresistant protein mrp2 in rat small intestine.J Pharmacol Exp Ther 2000; 293: 717–723.

46. Huls M, Kramers C, Levtchenko EN et al.P-glycoprotein-deficient mice have proximaltubule dysfunction but are protected againstischemic renal injury. Kidney Int 2007; 72:1233–1241.

47. Anakk S, Ku CY, Vore M, Strobel HW. Insightsinto gender bias: rat cytochrome P450 3A9.J Pharmacol Exp Ther 2003; 305: 703–709.

48. Saeki M, Kurose K, Tohkin M, Hasegawa R.Identification of the functional vitamin Dresponse elements in the human MDR1 gene.Biochem Pharmacol 2008; 76: 531–542.

49. Zierold C, Mings JA, Deluca HF. 19nor-1,25-dihydroxyvitamin D2 specifically inducesCYP3A9 in rat intestine more strongly than1,25-dihydroxyvitamin D3 in vivo and in vitro.Mol Pharmacol 2006; 69: 1740–1747.



265

50. Marks HD, Fleet JC, Peleg S. Transgenic expres-sion of the human vitamin D receptor (hVDR) inthe duodenum of VDR-null mice attenuates theage-dependent decline in calcium absorption.J Steroid Biochem Mol Biol 2007; 103: 513–516.

51. Massheimer V, Boland R, de Boland AR. Rapid1,25(OH)2-vitamin D3 stimulation of calciumuptake by rat intestinal cells involves a dihy-dropyridine-sensitive cAMP-dependent path-way. Cell Signal 1994; 6: 299–304.

52. Gaildrat P, Moller M, Mukda S et al. A novelpineal-specific product of the oligopeptidetransporter PepT1 gene: circadian expressionmediated by cAMP activation of an intronicpromoter. J Biol Chem 2005; 280: 16851–16860.

53. Roelofsen H, Soroka CJ, Keppler D, Boyer JL.Cyclic AMP stimulates sorting of the canalicularorganic anion transporter (Mrp2/cMoat) to theapical domain in hepatocyte couplets. J Cell Sci1998; 111: 1137–1145.

54. Chandra P, Zhang P, Brouwer KL. Short-termregulation of multidrug resistance-associatedprotein 3 in rat and human hepatocytes. Am JPhysiol Gastrointest Liver Physiol 2005; 288:G1252–G1258.

55. van Aubel RA, Smeets PH, Peters JG, Bindels RJ,Russel FG. The MRP4/ABCC4 gene encodes anovel apical organic anion transporter in humankidney proximal tubules: putative efflux pumpfor urinary cAMP and cGMP. J Am Soc Nephrol2002; 13: 595–603.

56. Yang W, Friedman PA, Kumar R et al.Expression of 25(OH)D3 24-hydroxylase in distalnephron: coordinate regulation by 1,25(OH)2D3

and cAMP or PTH. Am J Physiol 1999; 276:E793–E805.

57. Simboli-Campbell M, Franks DJ, Welsh J.1,25(OH)2D3 increases membrane associatedprotein kinase C in MDBK cells. Cell Signal1992; 4: 99–109.

58. Uwai Y, Okuda M, Takami K, Hashimoto Y,Inui K. Functional characterization of therat multispecific organic anion transporterOAT1 mediating basolateral uptake of anionicdrugs in the kidney. FEBS Lett 1998; 438:321–324.

59. Takeda M, Sekine T, Endou H. Regulation byprotein kinase C of organic anion transportdriven by rat organic anion transporter 3(rOAT3). Life Sci 2000; 67: 1087–1093.

60. Muller U, Brandsch M, Prasad PD, Fei YJ,Ganapathy V, Leibach FH. Inhibition of the H1/peptide cotransporter in the human intestinal cellline Caco-2 by cyclic AMP. Biochem Biophys ResCommun 1996; 218: 461–465.

61. Brandsch M, Miyamoto Y, Ganapathy V,Leibach FH. Expression and protein kinaseC-dependent regulation of peptide/H1 co-transport system in the Caco-2 human coloncarcinoma cell line. Biochem J 1994; 299: 253–260.

62. Daniel H, Herget M. Cellular and molecularmechanisms of renal peptide transport. Am JPhysiol 1997; 273: F1–F8.

63. Kikuchi R, Kusuhara H, Hattori N et al. Regula-tion of the expression of human organic aniontransporter 3 by hepatocyte nuclear factor 1al-pha/beta and DNA methylation. Mol Pharmacol2006; 70: 887–896.



266

267

APPENDIX A5 Maeng HJ, Durk MR, Chow EC, Ghoneim R and Pang KS (2011) 1α,25-Dihydroxyvitamin D3 on intestinal transporter function: studies with the rat everted intestinal sac. Biopharm Drug Dispos 32:112-125


Published online 14 January 2011 in Wiley Online Library

(wileyonlinelibrary.com) DOI: 10.1002/bdd.742

1a,25-Dihydroxyvitamin D3 on Intestinal TransporterFunction: Studies with the Rat Everted Intestinal Sac

Han-Joo Maeng, Matthew R. Durk, Edwin C. Y. Chow, Ragia Ghoneim, and K. Sandy Pang�

Leslie Dan Faculty of Pharmacy, University of Toronto, Toronto, Ontario, Canada M5S 3M2

ABSTRACT: Previous studies have shown that 1a,25-dihydroxyvitamin D3 (1,25(OH)2D3)treatment (2.56 nmol/kg i.p. daily� 4) increased PepT1, Mrp2, Mrp4, Asbt, but not Mdr1/P-gpin the rat small intestine. In this study, the intestinal everted sac technique, together with variousselect probes: mannitol (paracellular transport), glycylsarcosine (PepT1), 5(and 6)-carboxy-20,70-dichlorofluorescein (CDF) diacetate (precursor of CDF for Mrp2), adefovir dipivoxil (precursor ofadefovir for Mrp4) and digoxin (P-gp) was used to examine the functional changes of thesetransporters. After establishing identical permeabilities (Papp) of mannitol for the apical-to-basolateral (A-to-B) and basolateral-to-apical (B-to-A) directions at 20min in 1,25(OH)2D3-treatedvs. vehicle-treated duodenal, jejunal and ileal everted sacs, a significant enhancement of net A-to-Btransport of glycylsarcosine in the duodenum, increased B-to-A transport of CDF and A-to-B and B-to-A transport of adefovir in the jejunum were observed with 1,25(OH)2D3 treatment. However, theA-to-B and B-to-A transport of digoxin in the ileum was unchanged. These changes in transporterfunction in the rat intestinal everted sac corresponded well to changes in proteins that wereobserved previously. This study confirms that the rat intestinal PepT1, Mrp2 and Mrp4, but notP-gp are functionally induced by 1,25(OH)2D3 treatment via the vitamin D receptor (VDR).Copyright r 2011 John Wiley & Sons, Ltd.

Key words: transporters; intestine; everted sac; 1a,25-dihydroxyvitamin D3 (1,25(OH)2D3); vitamin Dreceptor (VDR)

Introduction

Ligand-activated transcription factors, includingthe pregnane X receptor (PXR), constitutiveandrostane receptor (CAR), farnesoid X receptor(FXR), glucocorticoid receptor (GR) and vitaminD receptor (VDR) are among the nuclear receptorsuperfamilies that are critical in the regulationof drug transporters and drug-metabolizingenzymes in the intestine and liver [1]. The rolesof the VDR in calcium and bone homeostasis

have been well established during the pastdecades. But it is only recently that VDR-mediatedregulation of drug transporters and enzymes isbeing investigated. 1a,25-Dihydroxyvitamin D3

[1,25(OH)2D3, calcitriol] [2] and other vitamin Danalogs [3–5] as well as the secondary bile acid,lithocholic acid and its derivatives [5], are knownto bind to the VDR that is expressed abundantlyin the rat intestine [6,7] and kidney [7] to resultin changes in target genes.

In terms of metabolism, the ligand-activatedVDR was found to induce CYP3A4 in the Caco-2[8,9] and LS180 cell [8] monolayers and humanintestinal slices [10]. In the rat intestine, Cyp3a9 [3]and Cyp3a1 [6,10,11] mRNA and total Cyp3a

*Correspondence to: K. Sandy Pang, Faculty of Pharmacy,University of Toronto, 144 College Street, Toronto, Ontario,Canada M5S 3M2. E-mail: [email protected]

Received 24 August 2010Revised 9 November 2010

Accepted 23 November 2010Copyright r 2011 John Wiley & Sons, Ltd.

268

protein [6] were upregulated by 1,25(OH)2D3

treatment. The hydroxysteroid sulfotransferase(SULT2A1) was activated in intestinal cells uponco-transfection with the liganded-VDR [12].In terms of transporters, 1,25(OH)2D3 and litho-cholic acid, both VDR ligands, have led toincreased multidrug resistance protein 1 (MDR1)mRNA levels in the human colorectal adenocarci-noma cell lines, LS174T [13] and Caco-2 cells [9]that abundantly express the VDR, observationsconsistent with the presence of a vitamin Dresponse element in the human MDR1 gene [14].In Caco-2 cells, 1,25(OH)2D3 treatment increasedthe protein expression of MRP2 and MRP4(multidrug resistance-associated protein 2 and 4)[9]. In the mouse, mRNA levels of the multidrugresistance-associated protein 3 (Mrp3) in thecolon were enhanced upon pretreatment with1,25(OH)2D3 [15]. In the rat, 1,25(OH)2D3 tran-scriptionally activated the apical sodium-depen-dent bile acid transporter (Asbt) [16] and increasedprotein expression of members of the multidrugresistance-associated protein (Mrp2, Mrp3 andMrp4) and the oligopeptide transporter 1 (PepT1)without altering the mRNA and protein expres-sion of Mdr1a/P-gp (P-glycoprotein) [6,7] and thebreast cancer resistance protein (Bcrp) (unpub-lished data) in the rat small intestine. Treatmentwith 1a-hydroxyvitamin D3, a precursor of1,25(OH)2D3, also induced mRNA levels of Asbtand Mrp4 in the small intestine of mice [17].

Collectively, these studies suggest that trans-porter and enzyme genes are targets of the VDRand that species differences exist between ro-dents and man in the induction of enzymes andtransporters of the intestine. Unfortunately,changes in mRNA or protein are seldom corre-lated to function. There exist only a few reportscorrelating protein expression and function dueto VDR in cultured cells in vitro. Fan et al. [9]demonstrated that the inductive effect of1,25(OH)2D3 on P-gp and MRP2 protein expres-sion correlated to the increased efflux of digoxinand 5 (and 6)-carboxy-2,7-dichlorofluoresceindiacetate (CDF-DA), respectively, across theCaco-2 cell monolayer. Treatment of the Caco-2cell monolayer with 1,25(OH)2D3 (100 nM) for 3days significantly increased the apparent perme-ability coefficient (Papp) of digoxin in the B-to-Adirection, yielding an increased efflux ratio (EfR,

from 6.8 to 8) and suggesting enhanced P-gpfunctional activity due to VDR activation [9]. Thecellular retention of CDF in the 1,25(OH)2D3-treated Caco-2 cells was significantly decreased(to 60%) due to the higher efflux function ofMRP2 [9]. By contrast, the physiological rele-vance of VDR activation on the function oftransporters and enzymes in drug dispositionin vivo is rarely investigated. Chen et al. [16]showed, pursuant to 1,25(OH)2D3 treatment tothe rat in vivo, that the ileal absorption ofcholylsarcosine, a non-metabolized synthetic bileacid analog, was enhanced in the perfused ratintestinal preparation, an observation consistentwith the elevated mRNA and protein expressionof Asbt.

In this study, the everted rat intestinal sactechnique was used to examine the function ofintestinal transporters after treatment in vivo. Theeverted sac technique, introduced by Wilson andWisemen [18] and further improved with use ofspecific probes for different transporters [19,20], isuseful for the study of drug absorption andpermeation via passive diffusion and/or transpor-ters in the small intestine [20–22]. After establish-ing the integrity of the everted sac preparationwith [14C]mannitol, transport studies were con-ducted with glycylsarcosine (GlySar, a PepT1substrate), digoxin (a P-gp substrate), CDF-DA,precursor of CDF (a Mrp2 substrate) and adefovirdipivoxil, precursor of adefovir (a Mrp4 substrate)in the B-to-A or A-to-B direction in vehicle- and1,25(OH)2D3-treated everted sacs. The segmentchosen for each of the transport studies corre-sponded to the intestinal segment shown pre-viously to exhibit the greatest change in protein ormRNA expression in rats treated with 1,25(OH)2D3

[6,7]. By defining the impact of 1,25(OH)2D3 onintestinal transporters, the importance of VDR inthe induction or inhibition of intestinal transpor-ters could be appraised for drug absorption as wellas drug–drug interactions (DDIs).

Methods

Materials

Radiolabeled [3H]glycylsarcosine (specific activ-ity, 10.9mCi/mmol), [8-3H]adefovir dipivoxil

1a,25-DIHYDROXYVITAMIN D3 ON RAT INTESTINAL TRANSPORTERS 113


269

(specific activity, 5.5mCi/mmol), [3H(G)]digoxin(specific activity, 40mCi/mmol) and [1-14C]man-nitol (specific activity, 51mCi/mmol) were pur-chased from Perkin Elmer Life and AnalyticalSciences (Waltham, MA), respectively. [3H]Di-goxin was purified by HPLC to 499% radio-chemical purity, as described by Liu et al. [23].1,25(OH)2D3 and the non-radiolabeled drugs(glycylsarcosine, adefovir dipivoxil, mannitol,CDF-DA and digoxin) were procured fromSigma-Aldrich Canada (Mississauga, ON, Canada).All other reagents were obtained from Sigma-Aldrich Canada (Mississauga, ON, Canada) andFisher Scientific (Mississauga, ON, Canada).

1,25(OH)2D3 and vehicle (corn oil) treatment inrats

Male Sprague-Dawley rats (260–280 g), pur-chased from Charles River (St Constant, QC),were given water and food ad libitum andmaintained under a 12:12-h light and dark cyclein accordance with animal protocols approved bythe University of Toronto (Canada). 1,25(OH)2D3

was dissolved in anhydrous ethanol, and theconcentration was measured spectrophotometri-cally at 265 nm (UV-1700, Shimadzu ScientificInstruments, MD); then the solution was dilutedto 2.56 nmol/ml with filtered corn oil for intra-peritoneal injection. Rats (n5 4 in each group)were injected intraperitoneally for 0 (vehicle) or2.56 nmol/kg 1,25(OH)2D3 in 1ml/kg corn oil,daily for 4 days.

Everted rat intestinal sac method

The rat everted intestinal sac study was carriedout as described previously [18–21]. Briefly,at 24 h after the last 1,25(OH)2D3 dose, ratswere anesthetized with ketamine and xylazine(90mg/kg and 10mg/kg, respectively) givenby intraperitoneal injection. The small intestinewas removed quickly and placed on ice and cutinto eight segments, as described in publishedreports [6,7]. Segment 1 (S1) represents theduodenum and spans from the pyloric ring tothe ligament of Treitz; segment 2 (S2) refers to theproximal jejunum segment which is immediatelydistal to the ligament of Treitz and of lengthidentical to that for the duodenum. S8 denotesthe ileum segment proximal to the ileocecal

junction. Only the S1, S2, and S8 segments(6 cm in length for the sac preparation) wereused in this study. Once rinsed with saline(0.9% NaCl solution), the intestine was evertedwith a glass rod and one end was tied using silkbraided sutures before filling the sac with 0.3mlof freshly prepared, oxygenated buffer I(117.6mM NaCl, 25mM NaHCO3, 1.2mM MgCl2,1.25mM CaCl2, 11mM glucose and 4.7mM KCl,pH 7.4) [24] or drug-containing buffer I for theA-to-B or B-to-A transport study. The other endof the sac was immediately tied thereafter usingsilk braided sutures, providing a sac of 4 cmlength. The tied ends beyond the sutures werefurther clamped to prevent leakage. Immediatelythereafter, each sac was placed in 5ml ofoxygenated buffer II (117.6mM NaCl, 25mM

NaHCO3, 1.2mM MgCl2, 1.25mM CaCl2, 11mM

glucose and 4.7mM KCl, pH 6.8) [24] or drug-containing buffer II for the transport study in theB-to-A or A-to-B direction, respectively. The sacwas incubated at 371C in a water bath with gentleshaking, with a 95% O2/5% CO2 stream (1 l/min)bubbling through the mucosal (outside or A)solution.

Low concentrations of [3H]glycylsarcosine(10 mM for S1), [3H]digoxin (10 mM for S8),[3H]adefovir dipivoxil (1 mM for S2) and CDF-DA (50 mM for S2) were selected for study toavoid saturation of the transporters. For verifica-tion of the integrity of the everted rat intestinalsac and for paracellular passive diffusion, 100 mMmannitol (with [14C]mannitol) was applied tosacs prepared from S1, S2 and S8. For thetransport study in the B-to-A-direction, 200 mlwas removed from the A compartment andreplaced by buffer II at times of 10, 15, 20, 25and 30min. For the transport study in the A-to-B-direction, the experiment was terminated at thetime of sampling (20min), a time found to exhibitproportionality of uptake rates with time for theprobe. The time-linearity in the A-to-B directionwas first determined for each compound, andwas established with use of multiple sac pre-parations after incubation times at 5, 10, 20, or30min. At each time point, the experiment wasterminated to obtain the contents of the probe inthe sac, donor and receiver compartments, and atleast three sacs were used to provide the meanvalue at each time point.

H.-J. MAENG ET AL.114


270

At the end of the experiment, the total contentsof the mucosal and serosal compartments and thesac tissue were removed for sampling. The sacwas washed in ice-cold buffer II, blotted dry, thencut open, and the serosal fluid inside the sac wasdrained into a pretared glass vial to determinethe weight (translated to volume, assuming adensity of 1) of buffer I remaining in the sac(basolateral side). The volume of the mucosalbath (apical side) was measured by taking thedifference in weight of the mucosal fluid in thecontaining vessel before and after the incubationstudy. Recovery (%) of fluid volume was thencalculated as fluid weight after/before incuba-tion. For evaluation of amount recovery (% dose),samples of the mucosal and serosal fluids and insac lysate were analysed for radioactivity byliquid scintillation counting (Beckman CoulterCanada, Inc., Mississauga, ON, Canada; model6500) using the Ready SafeTM scintillation fluid(Beckman Coulter, Canada). The same volume ofthe initial concentration, the timed-sample andblank buffer was used for liquid scintillationcounting to ensure similar quenching. The sacswere solubilized with 1 N NaOH (5ml) for 2 h at371C, as described by Lafforgue et al. [22]. Knowncounts of these compounds were added to blanksac lysate to ascertain the degree of quenching;none was found. The amount in each compart-ment was estimated by the product of the volumeand the concentration. The total recovery (%) forthe each drug was calculated as below:

Amount recovery ð%Þ

¼sum of amounts in donor; sac; and receiver sides

dose

� 100% ð1Þ

Effect of 1,25(OH)2D3 on CDF-DA and adefovirdivipoxil hydrolysis

Since metabolite efflux and not parent drugefflux was used to appraise transporter functionafter dosing of the precursors, CDF-DA and ade-fovir divipoxil, the effect of 1,25(OH)2D3 treat-ment on CDF-DA (10 mM) hydrolysis to CDF andadefovir divipoxil (1 mM) hydrolysis to adefovir inrat intestinal tissue was first investigated beforean interpretation was made of Mrp2 function,

based on CDF efflux, and Mrp4 function, basedon adefovir efflux. Enterocytes were obtainedfrom scrapings of the intestinal segment. Lysate,in Tris-HCl buffer (50mM, pH 7.4), was preparedfrom enterocytes by sonication by a cell disrup-tor, followed by centrifugation at 9000� g for15min. CDF was incubated with 2mg protein,assayed by the Lowry method [25] at 371C for 10,20 and 30min, and the reaction was stoppedupon the addition of two volumes of ice-coldMeOH, followed by centrifugation at 14000� gfor 10min at 41C. Fluorescence values of thesupernatant obtained from the control and1,25(OH)2D3 treatment groups were measuredand compared.

A similar incubation study was conducted foradefovir divipoxil (1 mM) to examine whether1,25(OH)2D3 had an effect on hydrolysis. Dataobtained from the incubation of adefovir dipi-voxil in enterocyte lysate were fitted to a set ofdifferential equations to reveal km and km{mi},the rate constants for sequential hydrolysis ofbis(POM)-PMEA (or adefovir dipivoxil) tomono(POM)-PMEA, then PMEA, with the pro-gram Scientists (Micromath, St Louis, MO).

Assays

For radiolabeled mannitol, glycylsarcosine anddigoxin, the contents (dpm) recovered in thesample in the donor and receiver compartments,before and after the experiment, were assayed byliquid scintillation counting (Beckman Countermodel 6500, Beckman Coulter, Canada, Missis-sauga, ON). The amount of compound trans-ported into the receiver side was quantified interms of its specific activity and expressed as nmolof drug/g intestine. The sac protein concentrationwas assayed by the Lowry method [25].

HPLC for adefovir dipivoxil, mono(POM)-PMEA and PMEA or adefovir

An aliquot (0.1ml) of the samples obtained fromthe transport study was counted directly,whereas another aliquot was centrifuged, and0.1ml was injected directly onto the HPLC. Themono(POM)-PMEA and PMEA or adefovir wereidentified according to their radioelution times inthe HPLC system published earlier by Annaertet al. [26,27]. The retention times of adefovir



271

dipivoxil and its metabolites, mono(POM)-PMEA and PMEA or adefovir were around 28,19 and 9 min, respectively. Briefly, the com-pounds were separated using a modified reverse-phase HPLC method and each species wasquantified by radioelution. The ShimadzuHPLC system (LC 10AT pump, SIL-10A auto-injector, and SCL-10A system controller) withan Altex 10mM C-18 reverse phase column(4.6mm� 250mm), was used to achieve separationof adefovir dipivoxil and its metabolites. Mobilephase A consisted of 10mM potassium dihydrogenphosphate with 2mM tetrabutylammonium hydro-gen sulfate, adjusted to pH 6 with 1N NaOH;mobile phase B was 100% acetonitrile. A lineargradient program was performed from 5% to 38%acetonitrile over 10min, maintained at the constantproportion of 38% over 20.5min, followed byreturn to the initial condition over the next0.5min and re-equilibration of the column overthe next 9.5min. The HPLC fractional recovery ofeach species was multiplied by the direct count toyield the corrected dpm of the species.

Fluorescence assay for CDF

The stability of CDF-DA in buffer was firstinvestigated in a preliminary study. A minor andnegligible degradation (3%, estimated as the pro-duct, CDF divided by the initial material in CDFequivalent from base hydrolysis) was observed at371C after 30 min incubation with buffer I. Forprevention of sample degradation, mucosal (apical)samples taken at each time point were immediatelystored at –201C. Upon completion of sampling, thecollected samples were thawed over ice, mixed and100ml of sample was transferred into the fluores-cence reader plate and processed. The fluorescenceof CDF in the receiver side (mucosal fluid) wasmeasured by a microplate fluorescence reader at awavelength of lex nm and lemnm (SpectraMaxGemini XS; Molecular Devices, Sunnyvale, CA)according to the method of Tian et al. [28]. Acalibration curve was constructed to assay forfluorescence of CDF formed from CDF-DA. Analiquot (100ml) of 10N NaOH was added to eachCDF-DA standard solution in a final volume of5ml. The maximum fluorescence value wasreached rapidly within 1min of incubation at37 1C with base, suggesting that hydrolysis of

CDF-DA to CDF by base was complete. Thecalibration curve for CDF was constructed overthe concentration range 0.1–10mM from CDF-DA,and was found to be linear (R250.994).

Drug permeability analysis

From the everted rat intestinal sac data, theapparent permeability coefficient (Papp, cm/s)was calculated according to the following equation:

Papp ¼DAR=Dt

Area � 60� C0ð2Þ

where DAR is the amount accumulated in thereceiver side during the time interval, Dt. Area isthe surface area of the mucosal membrane (cm2),and C0 is the initial drug concentration (mM)placed into the donor side. The surface area ofthe mucosa was calculated by correlating theamount of sac protein to the surface area (1mgprotein5 9.955mm2), as described by Barthe et al.[19]. The efflux ratio, EfR is given by the ratio ofPapp in the (B-to-A) to that in the (A-to-B)direction.

EfR ¼Papp;B�to�A

Papp;A�to�Bð3Þ

Statistical analysis

Data were expressed as mean7standard devia-tion. The difference between and among meanswas analysed using the two-tailed Student’s t-testor ANOVA, respectively. A value of po0.05 wasconsidered to be significant.

Results

Effect of 1,25(OH)2D3 on mannitol transport

Mannitol, a probe of paracellular transport, was firststudied to establish the effects of 1,25(OH)2D3 onpassive transport in the everted rat intestinal sacpreparation (Figure 1). The amount (% dose) andvolume recovery (%) at the end of incubation wereclose to 100% (data not shown). The transport ofmannitol in the A-to-B direction for 20min or B-to-Adirection over 30min in everted sacs of S1, S2 and S8segments did not change with 1,25(OH)2D3 treat-ment, evidenced by the virtually identical Papp,A-to-Band Papp,B-to-A for mannitol (values between1.23� 10�6 and 2.89� 10�6 cm/s) (Figure 1).



272

As a result, the calculated EfR for the everted sacsfrom S1, S2 and S8 were near unity for the controland 1,25(OH)2D3-treated groups (Table 2). ThePapp in the S2 segment (proximal jejunum) wasslightly but insignificantly higher compared withthose for the S1 and S8 segments (Table 1, one-way ANOVA). Taken together, the data suggestthat 1,25(OH)2D3 was devoid of influence on the

tight junction between the enterocytes in theeverted sac.

Effects of 1,25(OH)2D3 on active absorptivetransporters: PepT1

PepT1. The linearity of transport with time inthe A-to-B direction for the transport of 10 mM

Figure 1. Effects of 1,25(OH)2D3 vs. vehicle treatment (2.56 nmol/kg daily for 4 days) on the permeability of mannitol (100mM) inrat intestinal sacs (prepared from S1, S2 and S8; n5 3 or 4 sacs). (A) and (B) denote the A-to-B and B-to-A transport of mannitol,respectively, in everted sacs prepared from the duodenum, S1 (left), jejunum, S2 (middle) and ileum, S8 (right). In (B), each datapoint for each time point was the mean of 3 or 4 sacs

Table 1. The apparent permeabilities (Papps) of the compounds defined by the everted rat intestinal sac technique (n53 or 4,7SD)

Drug Treatment Segment Apparent permeability (10�6 cm/s) Efflux ratio EfR

Papp,A-to-B Papp,B-to-A

Mannitol Control S1 1.2370.11 1.3870.50 1.121,25(OH)2D3 1.5270.29 1.4170.43 0.93Control S2 2.8971.86 2.5071.05 0.871,25(OH)2D3 2.3471.10 2.5372.03 1.08Control S8 1.4970.45 1.7370.49 1.171,25(OH)2D3 1.7270.68 1.5970.31 0.93

Glycylsarcosine (GlySar) Control S1 3.4170.86 0.8870.50 0.261,25(OH)2D3 5.5471.04� 0.8570.57 0.15

Adefovir from precursor, adefovir dipivoxil Control S2 0.8170.28 0.5970.33 0.74a

1,25(OH)2D3 1.6870.39� 1.4570.47� 0.86a

CDF from precursor, CDF-DA Control S2 0.3670.03 2.1670.49 5.94a

1,25(OH)2D3 0.4270.22 4.3371.53� 10.2a

Digoxin Control S8 0.5570.16 1.7471.23 3.151,25(OH)2D3 0.6070.07 1.4171.19 2.36

�po0.05 compared to the control groupaApparent EfR for metabolite



273

GlySar, a model substrate of PepT1, wasverified using everted sacs from the duodenum(S1), and recovery of GlySar in the systemwas complete. Figure 2A shows that the absorp-tion of GlySar was linear up to 30min(R25 0.995) and the 20min incubation time waschosen for subsequent A-to-B transport studies.A significant increase in transport (48%) wasobserved with the 1,25(OH)2D3 treatmentcompared with controls (po0.05) (Figure 2B).

By contrast, the B-to-A transport of GlySarwas unchanged (Figure 2B). The Papp valuefor the A-to-B direction increased in the 1,25(OH)2D3-treated group compared with the con-trol group (5.5471.04� 10�6 vs. 3.4170.856�10�6 vs. cm/s, po0.05), whereas the value of Papp

for the B-to-A direction, which was lower incomparison to values for the Papps for the A-to-Bdirection, was unchanged (0.84870.569� 10�6

vs. 0.87670.502� 10�6 cm/s), resulting in a

Figure 2. Effects of 1,25(OH)2D3 vs. vehicle treatment (2.56 nmol/kg daily for 4 days) on the function of PepT1 in the ratduodenum (S1), appraised via the absorption of glycylsarcosine or GlySar (10mM) by the everted sac. (A) Rates of glycylsarcosineabsorbed vs. time in the A-to-B direction; each time point represents the mean of 3 or 4 preparations (left); Glycylsarcosinetransport at 20min for the A-to-B direction (right); and (B) transport in the B-to-A direction (right) with each time pointrepresenting the mean of 3 or 4 preparations for 1,25(OH)2D3- and vehicle-treated rats. Statistically higher absorption (�po0.05)was observed for the treatment group compared with the vehicle control

Table 2. Comparison of changes induced by 1,25(OH)2D3 between functional activities and published protein expression oftransporters

Transporter Segment Change of expression levels induced by 1,25(OH)2D3a Changes in functional activity in everted

intestinal sac induced by 1,25(OH)2D3

mRNA Protein

PepT1 S1 2b mc m(A to B)Mrp2 S2 2 m m(B to A)Mrp4 S2 2 m m(A to B) and (B to A)P-gp S8 2 2 2(B to A)

aData from [7]bUnchangedcInduced



274

slightly lower EfR (Table 1). The data suggeststhe presence of an absorptive transporter that isinduced by 1,25(OH)2D3.

Effects of 1,25(OH)2D3 on active efflux trans-porter: Mrp2, Mrp4 and P-gp

Mrp2. Similar to the base-catalysed reaction,hydrolysis of CDF-DA in rat jejunal enterocytelysate (2 mg protein) occurred rapidly andinstantaneously. The maximum rate of hydrolysiswas reached by the first sampling time (10min),and the metabolic patterns were identical betweenthe control and 1,25(OH)2D3-treated group(p40.05). By contrast, CDF-DA was stable inbuffer I over the 30min of study, and recovery ofmass in the system for the control and treatedgroups exceeded 75% and 85%, respectively(p40.05), pointing to the soundness of the trans-port data to denote changes in transporter func-tion. After the administration of 50mM CDF-DAinto the everted sac prepared from the proximaljejunum (S2), the appearance of the fluorescentCDF, formed intracellularly from esterases andprobe for Mrp2, in the receiver or serosalcompartment for A-to-B transport was unchangedwith 1,25(OH)2D3-treatment (p40.05, apparentPapp of CDF was 0.36 vs. 0.42� 10�6 cm/sand lower than that for mannitol Table 1). Themucosal appearance of the fluorescent CDF forB-to-A transport was significantly higher after1,25(OH)2D3 treatment compared with the controlsbeyond 25min of incubation (po0.05, ANOVA)(Figure 3). As a result, the calculated apparent EfRof CDF was higher in the 1,25(OH)2D3-treatedgroup vs. the control (10.2 vs. 5.94, Table 1).

Mrp4. Since adefovir dipivoxil [bis(POM)-PMEA] is a di-ester prodrug of adefovir, theintended Mrp4 substrate [29], the presence ofmono(POM)-PMEA and adefovir, metabolitesfound in Caco-2 cells and rat Ussing chamber[26,27,30], hydrolysis of adefovir divipoxil wasfirst investigated between the control and1,25(OH)2D3-treated groups with the lysate pre-pared from rat jejunal enterocytes. Adefovirdivipoxil was converted to mono(POM)-PMEArapidly in rat enterocyte lysate at rates that weresimilar for both the control and treated groups(km5 0.61770.091 vs. 0.62270.04min�1 per mg

lysate protein), whereas hydrolysis of the mono(POM)-PMEA to PMEAwas considerably slower(km{mi}: 0.04970.008 vs. 0.04570.007min�1 permg lysate protein, p40.05); the rate constant forPMEA formation was unaltered by 1,25(OH)2D3

treatment.Upon incubation of 1 mM adefovir dipivoxil

with the everted jejunal sac for A-to-B transport,adefovir was found to be the only speciesdetected inside the sac (serosal compartment) at20min. At 30min incubation for B-to-A trans-port, both mono(POM)-PMEA and adefovir weredetected, though with only a negligible amountas mono(POM)-PMEA (o1% total amount in thereceiver side, data not shown). Since efflux ofadefovir into both apical and basolateral direc-tions has been reported for Caco-2 cells [26,27],everted jejunal sac experiments with 1 mM adefo-vir dipivoxil were conducted for both the A-to-Band B-to-A directions after 1,25(OH)2D3 andvehicle treatment to the rat. The time-linearitywas first investigated with 1 mM adefovir dipi-voxil for A-to-B transport in the jejunal sac.The A-to-B appearance rate of adefovir was linearup to 30min (R25 0.973, Figure 4A), and the20min incubation time was chosen in subsequenttransport studies, wherein good recovery (470%)was observed in the transport studies. Theresults showed that 1,25(OH)2D3 treatment led to

Figure 3. Effects of 1,25(OH)2D3 vs. vehicle treatment(2.56 nmol/kg daily for 4 days) on the function of Mrp2 inthe rat jejunum (S2), appraised via the apical efflux of CDFformed from CDF-DA (50mM) which was administered intothe everted sac (each time point represents the mean of n5 7or 8 sacs). Statistically higher efflux (�po0.05), was observedfor the treatment group compared with the vehicle control



275

significantly higher 80% (po0.05) efflux of adefo-vir basolaterally into the serosal side, likely due toenhanced Mrp4 function in the proximal jejunum(Figure 4B). When the B-to-A transport wasexamined with 1mM adefovir dipivoxil, the rateof efflux of adefovir into the mucosal side apicallywas also increased by 1,25(OH)2D3 treatment(po0.05) (Figure 4B). The apparent Papp valuefor adefovir at 20min for A-to-B direction wasincreased significantly in 1,25(OH)2D3-treatedsacs compared with vehicle-treated sacs(1.6870.391�10�6 vs. 0.80670.284� 10�6 cm/s,po0.05), and the apparent Papp value for adefovirfor the B-to-A direction was also enhanced with1,25(OH)2D3 treatment (1.4570.471�10�6 vs.0.59370.327� 10�6 cm/s, po0.05) (Table 1).

P-gp. When the time-linearity of A-to-B transportwith 10 mM digoxin was investigated in the rateverted ileal sac, the net rate of A-to-B transportof digoxin was linear up to 30min (R25 0.969)

(Figure 5A), and there was no difference intransport between the treated and non-treatedgroups (Figure 5B). Recovery exceeded 83% dose.In addition, the B-to-A efflux of 10 mM digoxin byP-glycoprotein into the mucosal side over 30minremained unchanged with 1,25(OH)2D3 treat-ment (Figure 5B). The Papp,B-to-A values weresimilar for the control- and 1,25(OH)2D3 treatedsacs (1.4171.19� 10�6 vs. 1.7471.23� 10�6 cm/s;Table 1) and there was no change in the EfR(3.15 vs. 2.36, Table 1), suggesting that thefunctional activity of P-gp had remained un-changed with VDR treatment. The Papp fordigoxin in the A-to-B direction was lower thanthat of mannitol in the rat everted ileal sac, aspreviously observed by Lacombe et al. [20].However, Papp in the B-to-A direction was similarto that of mannitol. These data conform to thenotion of an apical transporter, P-gp, for thesecretion of digoxin, and the transporter isunperturbed by 1,25(OH)2D3 treatment.

Figure 4. Effects of 1,25(OH)2D3 vs. vehicle treatment (2.56 nmol/kg daily for 4 days) on the function Mrp4 in the rat jejunum(S2), appraised via apical and basolateral efflux of adefovir by the everted sac upon administration of the precursor, adefovirdipivoxil (1mM), into the apical or basolateral compartments (each point is the mean of 3 or 4 sacs). (A) Rates of adefovir efflux vs.time in the A-to-B direction; each time point represents the mean of 3 or 4 preparations (left), and adefovir efflux at 20min for theA-to-B direction (right); (B) transport in the B-to-A direction with each time point representing the mean of 3 or 4 preparations, for1,25(OH)2D3- and vehicle-treated rats (n5 3 or 4 sacs). Statistically higher basolateral and apical efflux (�po0.05) was observedfor the treatment group compared with vehicle control group



276

Discussion

Drug absorption into the systemic circulation iscontrolled by intestinal transporters which arelocalized at the apical and/or basolateral mem-brane to mediate drug absorption or secretion[31,32]. The presence of apical absorptive andbasolateral efflux transporters could increase oralbioavailability, whereas apical secretory transpor-ters, P-gp, MRP2 and BCRP, would decrease oralbioavailability. However, induction of intestinaltransporters has been well recognized and docu-mented on multiple occasions in studies in vivo[33–35]. With respect to induction of transportersby the VDR, significantly higher protein levels ofPepT1, Mrp2, Mrp4 and Asbt have been observedto occur in the small intestine upon 1,25(OH)2D3

treatment in the rat in vivo [6,7].The present, follow-up intestinal sac study was

performed to investigate the corresponding func-tional changes of rat intestinal transporters with1,25(OH)2D3 treatment. First, the persistent con-cern of activation of VDR on enhancement of tight

junctions in Caco-2 cell monolayers and murineintestine due to an increase of the tight junctionproteins, zonula occluding-1 (ZO-1), claudin-1,claudin-2, claudin-12 as well as adherens junctionprotein E-cadherin [36,37], was first examined.There was no effect of 1,25(OH)2D3 treatment onthe passive diffusion of paracellular transportmarker, mannitol in both the A-to-B and B-to-Adirections among the S1, S2 and S8 segments(Figure 1), thus alleviating the concern. Thus, it isunlikely that alteration of membrane integrity isresponsible for the observed functional changes oftransporters with the probe drugs (Figures 2–4).Our observation, which reports a lack of effect of1,25(OH)2D3 on mannitol transport by the para-cellular route in the rat small intestine, is consistentwith the lack of effect of 100nM of 1,25(OH)2D3 onmannitol transport observed in Caco-2 cells after a3 day-treatment regime [9].

Changes in functional activity of transportersusing the probe drugs in 1,25(OH)2D3-treatedrats were then correlated to changes in expres-sion of mRNA and protein from our previous

Figure 5. Lack of effect of 1,25(OH)2D3 vs. vehicle treatment (2.56 nmol/kg daily for 4 days) on the function of P-gp in the ratileum (S8), appraised via the efflux of digoxin (10mM) in the everted rat sac in the B-to-A direction (n5 5 sacs in each point).(A) Net rates of digoxin absorbed vs. time in the A-to-B direction; each time point represents the mean of 3 or 4 preparations (left)and digoxin net absorption at 20min for the A-to-B direction (right); (B) digoxin efflux in the B-to-A direction, with each timepoint representing the mean of 3 or 4 preparations, for 1,25(OH)2D3- and vehicle-treated rats (n5 3 or 4 sacs)



277

published data [6,7] (Table 2). A good correspon-dence between changes in transporter functionand protein expression with 1,25(OH)2D3 treat-ment was observed. Namely, functions of theabsorptive transporter, PepT1, and the effluxtransporters, Mrp2 and Mrp4, were increased in1,25(OH)2D3-treated rats compared with controlrats, as expected (Figures 2–4). These data,documenting the effect of 1,25(OH)2D3 onabsorptive and efflux transporters in smallintestine, is informative in predicting potentialdrug–drug interactions (DDIs). For example,enhanced PepT1 function by VDR activationwould effectively promote a higher absorptionof di- and tripeptides drugs such as cloxacillin[38], ceftibuten [39] and valacyclovir [40],whereas induced Mrp2 efflux function will likelylower the absorption for organic anion drugssuch as statins (e.g. pravastatin and cerivastatin)[41] or ACE inhibitors (e.g. enalapril and lisino-pril) [42], HIV protease inhibitors (saquinavir,ritonavir and indinavir) [43] and anticancerdrugs (etoposide and vincristine) [44] when usedin conjunction with calcitriol or other VDRligands. However, there was no change forintestinal P-gp functional activity (Figure 5),studied with digoxin as the test probe [45].Digoxin, a substrate of Oatp1a4 [46,47], is likelyto enter the enterocyte by passive diffusion dueto the absence/low levels of Oatp1a4 in the ratileum [48], and the observed secretion in theeverted ileal sac is likely to be influenced mostlyby P-gp function. These observations on the lackof change in P-gp levels in the rat small intestinedemonstrate a species difference between ratenterocytes and Caco-2 cells to 1,25(OH)2D3

treatment [9].Interestingly, the transport of adefovir in the

everted rat intestinal sac in both A-to-B andB-to-A directions was significantly enhanced by1,25(OH)2D3 treatment (Figure 4), results whichare consistent with the overall increase in proteinexpression observed by Chow et al. [7] (Table 2).The localization of Mrp4/MRP4 has been foundon both the apical and/or basolateral membranes[49–51]. Immunofluorescence imaging hadrecently demonstrated that MRP4 is localizedmore on the basolateral membrane than the apicalmembrane in Caco-2 cells [29], and immunohis-tochemical staining further revealed that Mrp4/

MRP4 is expressed on both the basolateral andapical membranes of epithelial cells in the ratintestine [51]. In addition, bidirectional efflux(i.e. both apical and basolateral efflux from theCaco-2 cells) of adefovir, with predominant effluxinto the apical side, was observed [26,27]. Thesame was found in rat jejunal membrane mountedin the Ussing chamber [30]. With Mrp4/MRP4being expressed in both apical and basolateralmembranes of the small intestine [49–51], in-creased efflux of adefovir due to 1,25(OH)2D3

induction of Mrp4/MRP4 would drastically re-duce the accumulation of adefovir in the enter-ocyte. Although Mrp3 levels were found inducedin S1 and S2 segments of 1,25(OH)2D3 treated rats[7], adefovir is not a substrate for Mrp3/MRP3[29]. By contrast, Mrp5 is capable of transportingadefovir [52], but its expression in rat smallintestine is very low [53]. Although Bcrp is alsorecognized as an apical efflux transporter ofadefovir [54], protein levels of Bcrp are found tobe unchanged by the VDR (unpublished data),rendering the observed increase in adefovirtransport in B-to-A direction unlikely to be dueto Bcrp. Taken together, the induced efflux ofadefovir in the rat everted intestinal sac with1,25(OH)2D3 treatment may be mediated primar-ily by increased expression of Mrp4.

In summary, using the everted intestinal sactechnique, we demonstrated that 1,25(OH)2D3

exerted an inductive effect on drug absorptiveand efflux transporters in the rat small intestineand was devoid of effect on the diffusion ofmannitol (Figure 1). It was verified that changesin transporter functional activity paralleled theinduction of transporter protein levels in1,25(OH)2D3-treated rats (Table 2) [6,7]. Inductionof PepT1, Mrp2 and Mrp4 in the small intestineby 1,25(OH)2D3 via the VDR (Figures 2–4) couldaffect drug absorption and potentially lead toDDIs. Since vitamin D analogs are used clinicallyin combination with other drugs [55], the effect ofvitamin D analogs on drug absorption and DDIsrequires further investigation in man in vivo.

Acknowledgments

This work was supported by the CanadianInstitutes for Health Research, MOP89850.



278

Dr Han-Joo Maeng is a recipient of the Govern-ment of Canada Postdoctoral Research Fellow-ship (PDRF) and a fellowship from the NationalResearch Foundation of Korea, funded by theSouth Korean Government (NRF-2009-352-E0068). Edwin C. Y. Chow is a recipient of theAlexander Graham Bell NSERC fellowship,Canada, and Matthew Durk is the recipient of afellowship from the Strategic Training Grant onBiologic Therapeutics from the Canadian Insti-tute for Health Research, CIHR.

References

1. Urquhart BL, Tirona RG, Kim RB. Nuclearreceptors and the regulation of drug-metabolizingenzymes and drug transporters: implications forinterindividual variability in response to drugs.J Clin Pharmacol 2007; 47: 566–578.

2. DeLuca HF, Zierold C. Mechanisms and functionsof vitamin D. Nutr Rev 1998; 56: S4–S10.

3. Zierold C, Mings JA, Deluca HF. 19Nor-1,25-dihydroxyvitamin D2 specifically inducesCYP3A9 in rat intestine more strongly than 1,25-dihydroxyvitamin D3 in vivo and in vitro. MolPharmacol 2006; 69: 1740–1747.

4. Salusky IB. Are new vitamin D analogues in renalbone disease superior to calcitriol? Pediatr Nephrol2005; 20: 393–398.

5. Makishima M, Lu TT, Xie W, et al. Vitamin Dreceptor as an intestinal bile acid sensor. Science2002; 17: 1313–1316.

6. Chow EC, Maeng HJ, Liu S, Khan AA,Groothuis GM, Pang KS. 1a,25-DihydroxyvitaminD3 triggered vitamin D receptor and farnesoidX receptor-like effects in rat intestine andliver in vivo. Biopharm Drug Dispos 2009; 30:457–475.

7. Chow EC, Sun H, Khan AA, Groothuis GM,Pang KS. Effects of 1a,25-dihydroxyvitamin D3 ontransporters and enzymes of the rat intestine andkidney in vivo. Biopharm Drug Dispos 2010; 31:91–108.

8. Thummel KE, Brimer C, Yasuda K, et al. Tran-scriptional control of intestinal cytochrome P-4503A by 1a,25-dihydroxy vitamin D3. MolPharmacol 2001; 60: 1399–1406.

9. Fan J, Liu S, Du Y, Morrison J, Shipman R,Pang KS. Up-regulation of transporters andenzymes by the vitamin D receptor ligands,1a,25-dihydroxyvitamin D3 and vitamin D ana-logs, in the Caco-2 cell monolayer. J Pharmacol ExpTher 2009; 330: 389–402.

10. Khan AA, Chow EC, van Loenen-Weemaes AM,Porte RJ, Pang KS, Groothuis GM. Comparison of

effects of VDR versus PXR, FXR and GR ligandson the regulation of CYP3A isozymes in rat andhuman intestine and liver. Eur J Pharm Sci 2009;12: 115–125.

11. Xu Y, Iwanaga K, Zhou C, Cheesman MJ, Farin F,Thummel KE. Selective induction of intestinalCYP3A23 by 1a,25-dihydroxyvitamin D3 in rats.Biochem Pharmacol 2006; 28: 385–392.

12. Echchgadda I, Song CS, Roy AK, Chatterjee B.Dehydroepiandrosterone sulfotransferase is atarget for transcriptional induction by the vitaminD receptor. Mol Pharmacol 2004; 65: 720–729.

13. Tachibana S, Yoshinari K, Chikada T, Toriyabe T,Nagata K, Yamazoe Y. Involvement of vitamin Dreceptor in the intestinal induction of humanABCB1. Drug Metab Dispos 2009; 37: 1604–1610.

14. Saeki M, Kurose K, Tohkin M, Hasegawa R.Identification of the functional vitamin D re-sponse elements in the human MDR1 gene.Biochem Pharmacol 2008; 15: 531–542.

15. McCarthy TC, Li X, Sinal CJ. Vitamin D receptor-dependent regulation of colon multidrugresistance-associated protein 3 gene expressionby bile acids. J Biol Chem 2005; 280: 23232–23242.

16. Chen X, Chen F, Liu S, et al. Transactivation of ratapical sodium-dependent bile acid transporterand increased bile acid transport by 1a,25-dihydroxyvitamin D3 via the vitamin D receptor.Mol Pharmacol 2006; 69: 1913–1923.

17. Nishida S, Ozeki J, Makishima M. Modulation ofbile acid metabolism by 1a-hydroxyvitamin D3

administration in mice. Drug Metab Dispos 2009;37: 2037–2044.

18. Wilson TH, Wiseman G. The use of sacs of evertedsmall intestine for the study of the transference ofsubstances from the mucosal to the serosalsurface. J Physiol 1954; 123: 116–125.

19. Barthe L, Woodley JF, Kenworthy S, Houin G. Animproved everted gut sac as a simple andaccurate technique to measure paracellular trans-port across the small intestine. Eur J Drug MetabPharmacokinet 1998; 23: 313–323.

20. Lacombe O, Woodley J, Solleux C, Delbos JM,Boursier-Neyret C, Houin G. Localisation of drugpermeability along the rat small intestine, usingmarkers of the paracellular, transcellular andsome transporter routes. Eur J Pharm Sci 2004;23: 385–391.

21. Barthe L, Woodley J, Houin G. Gastrointestinalabsorption of drugs: methods and studies.Fundam Clin Pharmacol 1999; 13: 154–168.

22. Lafforgue G, Arellano C, Vachoux C, et al. Oralabsorption of ampicillin: role of paracellular routevs. PepT1 transporter. Fundam Clin Pharmacol2008; 22: 189–201.

23. Liu S, Tam D, Chen X, Pang KS. P-glycoproteinand an unstirred water layer barring digoxinabsorption in the vascularly perfused rat smallintestine preparation: induction studies with



279

pregnenolone-16a-carbonitrile. Drug Metab Dispos2006; 34: 1468–1479.

24. Veau C, Leroy C, Banide H, et al. Effect of chronicrenal failure on the expression and function ofrat intestinal P-glycoprotein in drug excretion.Nephrol Dial Transplant 2001; 16: 1607–1614.

25. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ.Protein measurement with the Folin phenolreagent. J Biol Chem 1951; 193: 265–275.

26. Annaert P, Kinget R, Naesens L, de Clercq E,Augustijns P. Transport, uptake, and metabolismof the bis(pivaloyloxymethyl)-ester prodrug of9-(2-phosphonyl methoxyethyl)adenine in an invitro cell culture system of the intestinal mucosa(Caco-2). Pharm Res 1997; 14: 492–496.

27. Annaert P, Van Gelder J, Naesens L, et al. Carriermechanisms involved in the transepithelial trans-port of bis(POM)-PMEA and its metabolitesacross Caco-2 monolayers. Pharm Res 1998; 15:1168–1173.

28. Tian X, Zamek-Gliszczynski MJ, Zhang P,Brouwer KL. Modulation of multidrugresistance-associated protein 2 (Mrp2) and Mrp3expression and function with small interferingRNA in sandwich-cultured rat hepatocytes. MolPharmacol 2004; 66: 1004–1010.

29. Ming X, Thakker DR. Role of basolateral effluxtransporter MRP4 in the intestinal absorption ofthe antiviral drug adefovir dipivoxil. BiochemPharmacol 2010; 79: 455–462.

30. Annaert P, Tukker JJ, van Gelder J, et al. In vitro,ex vivo, and in situ intestinal absorption character-istics of the antiviral ester prodrug adefovirdipivoxil. J Pharm Sci 2000; 89: 1054–1062.

31. Suzuki H, Sugiyama Y. Role of metabolic enzymesand efflux transporters in the absorption of drugsfrom the small intestine. Eur J Pharm Sci 2000; 12:3–12.

32. Shitara Y, Horie T, Sugiyama Y. Transporters as adeterminant of drug clearance and tissue distri-bution. Eur J Pharm Sci 2006; 27: 425–446.

33. Adibi SA. Regulation of expression of theintestinal oligopeptide transporter (Pept-1) inhealth and disease. Am J Physiol Gastrointest LiverPhysiol 2003; 285: G779–G788.

34. Ghanem CI, Gomez PC, Arana MC et al. Induc-tion of rat intestinal P-glycoprotein by spirono-lactone and its effect on absorption of orallyadministered digoxin. J Pharmacol Exp Ther 2006;318: 1146–1152.

35. Iizasa H, Genda N, Kitano T, et al. Alteredexpression and function of P-glycoprotein indextran sodium sulfate-induced colitis in mice.J Pharm Sci 2003; 92: 569–576.

36. Kong J, Zhang Z, Musch MW, et al. Novel role ofthe vitamin D receptor in maintaining the integrityof the intestinal mucosal barrier. Am J PhysiolGastrointest Liver Physiol 2008; 294: G208–G216.

37. Fujita H, Sugimoto K, Inatomi S, et al. Tightjunction proteins claudin-2 and -12 are critical forvitamin D-dependent Ca21 absorption betweenenterocytes. Mol Biol Cell 2008; 19: 1912–1921.

38. Luckner P, Brandsch M. Interaction of 31 b-lactamantibiotics with the H1/peptide symporter PEPT2:analysis of affinity constants and comparison withPEPT1. Eur J Pharm Biopharm 2005; 59: 17–24.

39. Bretschneider B, Brandsch M, Neubert R. Intestinaltransport of beta-lactam antibiotics: analysis of theaffinity at the H1/peptide symporter (PEPT1), theuptake into Caco-2 cell monolayers and the trans-epithelial flux. Pharm Res 1999; 16: 55–61.

40. Ganapathy ME, Huang W, Wang H, Ganapathy V,Leibach FH. Valacyclovir: a substrate for theintestinal and renal peptide transporters PEPT1and PEPT2. Biochem Biophys Res Commun 1998;246: 470–475.

41. Itagaki S, Chiba M, Kobayashi M, Hirano T,Iseki K. Contribution of multidrug resistance-associated protein 2 to secretory intestinal trans-port of organic anions. Biol Pharm Bull 2008; 31:146–148.

42. Liu L, Cui Y, Chung AY, et al. Vectorial transportof enalapril by Oatp1a1/Mrp2 and OATP1B1 andOATP1B3/MRP2 in rat and human livers.J Pharmacol Exp Ther 2006; 318: 395–402.

43. Huisman MT, Smit JW, Crommentuyn KM, et al.Multidrug resistance protein 2 (MRP2) transportsHIV protease inhibitors, and transport can beenhanced by other drugs. AIDS 2002; 16: 2295–2301.

44. Chen ZS, Kawabe T, Ono M, et al. Effect ofmultidrug resistance-reversing agents on trans-porting activity of human canalicular multi-specific organic anion transporter. Mol Pharmacol1999; 56: 1219–1228.

45. Stephens RH, O’Neill CA, Bennett J, et al.Resolution of P-glycoprotein and non-P-glycopro-tein effects on drug permeability using intestinaltissues frommdr1a (-/-) mice. Br J Pharmacol 2002;135: 2038–2046.

46. Sugiyama D, Kusuhara H, Shitara Y, Abe T,Sugiyama Y. Effect of 17 beta-estradiol-D-17 beta-glucuronide on the rat organic anion transportingpolypeptide 2-mediated transport differs dependingon substrates. Drug Metab Dispos 2002; 30: 220–223.

47. Kodawara T, Masuda S, Wakasugi H, et al.Organic anion transporter oatp2-mediated inter-action between digoxin and amiodarone in the ratliver. Pharm Res 2002; 19: 738–743.

48. Cattori V, Van Montfoort J, Stieger B, et al.Localization of Oatp4 in rat liver and comparisonof its substrate specificity with Oatp1, Oatp2 andOatp3. Eur J Physiol 2001; 443: 188–195.

49. Leggas M, Adachi M, Scheffer GL, et al. Mrp4confers resistance to topotecan and protects thebrain from chemotherapy. Mol Cell Biol 2004; 24:7612–7621.



280

50. Kruijtzer CM, Beijnen JH, Schellens JH. Improve-ment of oral drug treatment by temporaryinhibition of drug transporters and/or cyto-chrome P450 in the gastrointestinal tract andliver: an overview. Oncologist 2002; 7: 516–530.

51. Johnson BM, Zhang P, Schuetz JD, Brouwer KL.Characterization of transport protein expression inmultidrug resistance-associated protein (Mrp) 2-deficient rats. Drug Metab Dispos 2006; 34: 556–562.

52. Dallas S, Schlichter L, Bendayan R. Multidrugresistance protein (MRP) 4- and MRP 5-mediatedefflux of 9-(2-phosphonylmethoxyethyl) adenine

by microglia. J Pharmacol Exp Ther 2004; 309:1221–1229.

53. Maher JM, Cherrington NJ, Slitt AL, Klaassen CD.Tissue distribution and induction of the ratmultidrug resistance-associated proteins 5 and 6.Life Sci 2006; 78: 2219–2225.

54. Takenaka K, Morgan JA, Scheffer GL, et al. Substrateoverlap between Mrp4 and Abcg2/Bcrp affectspurine analogue drug cytotoxicity and tissue dis-tribution. Cancer Res 2007; 67: 6965–6972.

55. Masuda S, Jones G. Promise of vitamin Danalogues in the treatment of hyperproliferativeconditions. Mol Cancer Ther 2006; 5: 797–808.



281

282

APPENDIX A6 Chow EC, Sondervan M, Jin C, Groothuis GM and Pang KS (2011) Comparative effects of doxercalciferol (1α-hydroxyvitamin D2) versus calcitriol (1α,25-dihydroxyvitamin D3) on the expression of transporters and enzymes in the rat in vivo. J Pharm Sci 100:1594-1604

PHARMACOKINETICS, PHARMACODYNAMICS AND DRUGMETABOLISM

Comparative Effects of Doxercalciferol (1α-Hydroxyvitamin D2)Versus Calcitriol (1α,25-Dihydroxyvitamin D3) on the Expressionof Transporters and Enzymes in the Rat In Vivo

EDWIN C.Y. CHOW,1 MYRTE SONDERVAN,2 CHENG JIN,1 GENY M.M. GROOTHUIS,2 K. SANDY PANG1

1Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, Toronto, Ontario, Canada

2Pharmacokinetics, Toxicology and Targeting, Department of Pharmacy, University of Groningen, Groningen, the Netherlands

Received 3 June 2010; revised 29 July 2010; accepted 31 August 2010

Published online 21 October 2010 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jps.22366

ABSTRACT: Effects of 1.28 nmol/kg doxercalciferol [1"(OH)D2], a synthetic vitamin D2 analogthat undergoes metabolic activation to 1",25-dihydroxyvitamin D2, the naturally occurring, bio-logically active form of vitamin D2, on rat transporters and enzymes were compared with those of1",25-dihydroxyvitamin D3 [1,25(OH)2D3, active form of vitamin D3; 4.8 and 6.4 nmol/kg] givenon alternate days intraperitoneally for 8 days. Changes were mostly confined to the intestine andkidney where the vitamin D receptor (VDR) was highly expressed: increased intestinal Cyp24and Cyp3a1 messenger RNA (mRNA) and a modest elevation of apical sodium-dependent bilesalt transporter (Asbt) and P-glycoprotein (P-gp) protein; increased renal VDR, Cyp24, Cyp3a9,Mdr1a, and Asbt mRNA, as well as Asbt and P-gp protein expression; and decreased renalPepT1 and Oat1 mRNA expression. In comparison, 1"(OH)D2 treatment exerted a greater ef-fect than 1,25(OH)2D3 on Cyp3a and Cyp24 mRNA. However, the farnesoid X receptor -relatedrepressive effects on liver Cyp7a1 were absent because intestinal Asbt, FGF15 and portal bileacid concentrations were unchanged. Rats on the alternate day regimen showed milder changesand lessened signs of hypercalcemia and weight loss compared with rats receiving daily injec-tions (similar or greater amounts of 0.64–2.56 nmol/kg daily ×4) described in previous reports,showing that the protracted pretreatment regimen was associated with milder inductive andlesser toxic effects in vivo. © 2010 Wiley-Liss, Inc. and the American Pharmacists AssociationJ Pharm Sci 100:1594–1604, 2011Keywords: doxercalciferol or Hectorol R©; 1",25-dihydroxyvitamin D3; vitamin D receptor;farnesoid X receptor; P-glycoprotein; membrane transporters; induction; drug transport; drugmetabolizing enzymes; cytochrome P450

INTRODUCTION

Doxercalciferol (Hectorol R©, Genzyme, Cambridge,Massachusetts), 1"-hydroxyvitamin D2 or 1"(OH)D2,is metabolized to 1",25-dihydroxyvitamin D2[1,25(OH)2D2], the naturally occurring, biolog-ically active form of vitamin D2. Like 1",25-dihydroxyvitamin D3 [1,25(OH)2D3 or calcitriol, theactive form of vitamin D3], doxercalciferol is used forthe treatment of secondary hyperparathyroidism,1,2

metabolic bone disease,3 as well as tumor growth4

Correspondence to: K. Sandy Pang (Telephone: 416-978-6164;Fax: 416-978-8511; E-mail: [email protected])Journal of Pharmaceutical Sciences, Vol. 100, 1594–1604 (2011)© 2010 Wiley-Liss, Inc. and the American Pharmacists Association

and androgen-independent prostate cancer.5 Theprodrug is metabolized by the 25-hydroxylaseand 24-hydroxylase, respectively, to form the ac-tive metabolites, 1,25(OH)2D2

6 and 1,24(OH)2D2,3

ligands of the vitamin D receptor (VDR).7 Unlike1,25(OH)2D3, 1"(OH)D2 was reported to be associatedwith lower calcemic and phosphatemic activities.8

There is increasing evidence that activation of theVDR by 1,25(OH)2D3 is involved in the regulation oftransporters and enzymes. In the Caco-2 cell mono-layer, 1,25(OH)2D3 was found to activate the VDR andupregulate cytochrome P450 3A4 (CYP3A4) and xeno-biotic transporters such as the multidrug resistanceprotein (MDR1 or P-gp) and the multidrug resistanceassociated proteins (MRP2 and MRP4)9–11 and, in

1594 JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 100, NO. 4, APRIL 2011283

DOXERCALCIFEROL AND CALCITRIOL ON RAT TRANSPORTERS AND ENZYMES 1595

HepG2 cells, induce the hydroxysteroid sulfotrans-ferase enzyme (SULT2A1).12 In precision-cut intesti-nal slice studies, 1,25(OH)2D3 induced rat Cyp3a1and Cyp3a2 and human CYP3A4.13 Recently, Fanet al.11 compared the effects of 1"(OH)D2 with those of1,25(OH)2D3 in the Caco-2 cell monolayer and foundthat 1"(OH)D2 was equipotent to 1,25(OH)2D3 in theinduction of CYP3A4, MDR1, MRP2 messenger RNA(mRNA), and protein expression as well as MRP4protein. The prodrug, 1"(OH)D2, and the active lig-and, 1,25(OH)2D3, appear to exhibit similar induc-tive effects on transporters and enzymes in Caco-2cells in vitro.11 However, 1,25(OH)2D3 was reportedto inhibit the activity of the liver X receptor-alpha(LXR-") in HepG2 VDR-transfected cells14 and thefarnesoid X receptor (FXR) in CV1 VDR-transfectedcells,15 suggesting that there is cross-talk between thenuclear receptors that may further lead to other indi-rect changes on levels of the transporter and enzyme.

Recent in vivo studies showed additional complex-ities in separating the effects elicited by the VDR di-rectly and those indirectly via the FXR due to elevatedbile acids. VDR effects differ among tissues, becausethe VDR is present abundantly in the rat intestineand kidney16 but is scant in the rat liver,17,18 whereasboth human hepatocytes and nonparenchymal cellsshow detectable expressions of the VDR.19 Intestinalproteins in the proximal segments of the small in-testine, for example, Cyp3a1, Mrp2, Mrp3, Mrp4 andthe oligopeptide transporter, PepT1, were found to beupregulated in 1,25(OH)2D3-treated rats.18,20 In thekidney, P-gp and Asbt protein levels were induced in1,25(OH)2D3-treated rats, whereas PepT1 and PepT2and organic anion transporters, Oat1 and Oat3, weredownregulated.18 Although the VDR was virtually ab-sent in rat hepatocytes, the VDR effect on intestinalAsbt induction led to elevated portal bile acid concen-trations and FXR effects in the intestine pursuant to1,25(OH)2D3 dosing.20 Additionally, increased intesti-nal fibroblast growth factor 15 (FGF15) produced inthe ileum activated the FGF receptor 4 (FGFR4) inthe rat liver, coupled with the bile acid–FXR acti-vation of the small heterodimer partner (SHP), trig-gered the downregulation of Cyp7a1, the rate-limitingenzyme for cholesterol metabolism, in the rat liver.20

These composite findings suggest the importance ofthe VDR-mediated regulation of transporters and en-zymes in the intestine, liver, and kidney, both directlyand indirectly, in bile acid homeostasis as well as drugdisposition in vivo.

The manner in which the prodrug doxercalcif-erol [1"(OH)D2] alters the expression of transportersand enzymes is mostly unknown. Doxercalciferol re-quires activation to 1,25(OH)2D2 and 1,24(OH)2D2,the active primary and minor metabolites, respec-tively, in order to bind to the VDR prior to man-ifestation of its activity. Cyp24 exists at lower lev-

els in the intestine and liver for 24-hydroxylation,21

but is present abundantly in the kidney.18 Reportshave suggested that the presence of microsomal CYP(CYP2R1) and the mitochondrial CYP27A22 acts as25-hydroxylases.23–26 Thus, it is possible that localconcentrations of the active metabolites of 1"(OH)D2are higher at various tissue sites that are rich inthe activation enzymes. The effect of 1"(OH)D2 onits target genes is expected to be higher in thekidney because Cyp24 activates, rather than deac-tivates, 1"(OH)D2 in contrast to the catabolism of1,25(OH)2D3 to form the inactive 1,24,25(OH)3D3. Al-though studies have shown that 1,25(OH)2D2 hasa similar terminal elimination half-life comparedto 1,25(OH)2D3,27 the conversion of 1"(OH)D2 to1,25(OH)2D2 is still the rate-limiting step. Theseevents would generate interesting differences on VDReffects between 1"(OH)D2 and 1,25(OH)2D3 adminis-tration pursuant to their administration to rats.

The vitamin D analogs, including 1"(OH)D2, are aburgeoning and important class of compounds usedfor the treatment of hyperparathyroidism, kidneyand bone diseases, and anticancer therapy, and aresometimes used clinically with other drugs for vari-ous indications.28 If the assoicated changes in trans-porter or enzyme are left unstudied or unnoticed, wewould not be aware that the vitamin D analogs, whenused concomitantly with other drugs, could lead todrug–drug interactions. We therefore proposed to in-vestigate the effects of 1"(OH)D2 in rats in vivo ontransporters and enzymes and compared these withthose from 1,25(OH)2D3 treatment. Although we onlyreported mRNA and protein changes, these changeshave been further translated to functional changesand pharmacokinetic situations (yet to be published).For this class of drugs, hypercalcemia is a major con-cern, and was observed in earlier studies whereinrats given daily 1,25(OH)2D3 (0.64–2.56 nmol/kg) in-traperitoneal (i.p.) injections for 4 days.20 For ap-praisal of the strategy of lessened toxicity, we utilizeda slightly more protracted regimen: the compoundswere administered i.p. every other day for 8 days toinvestigate whether higher doses of 1"(OH)D2 and1,25(OH)2D3 would evoke similar or lesser changeson hypercalcemia and on VDR target genes in the in-testine, liver, and kidney in vivo.

MATERIALS AND METHODS

Materials

The 1,25(OH)2D3 powder was purchased from Sigma–Aldrich Canada (Mississauga, Ontario, Canada).1"(OH)D2 was a kind gift from Dr Peter Bonate(Genzyme, Cambridge, Massachusetts). Antibodies tovillin (C-19) and Cyp7a1 (N-17) were purchased fromSanta Cruz Biotechnology (Santa Cruz, California),

DOI 10.1002/jps JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 100, NO. 4, APRIL 2011284

1596 CHOW ET AL.

anti-Mrp2 (ALX-801–016-C250) from Alexis Bio-chemicals (San Diego, California), anti-P-gp (C219)and anti-glyceraldehyde 3-phosphate dehydrogenase(GAPDH) (6C5) from Abcam (Cambridge, Mas-sachusetts), anti-Cyp3a2 antibodies (458223) thatfailed to distinguish from Cyp3a1 or Cyp3a9 were pur-chased from BD Biosciences (Mississauga, Ontario,Canada), and OAT11-A against Oat1 was from AlphaDiagnostic Intl. Inc. (San Antonio, Texas). Other an-tibodies were kind gifts from various investigators:anti-Oatp1a1 and anti-Ntcp (Dr. Allan W. Wolkoff,Albert Einstein College of Medicine, the Bronx, NewYork), anti-Asbt (Dr. Paul A. Dawson, Wake ForestUniversity, Salem, North Carolina), anti-Mrp3 (Dr.Yuichi Sugiyama, University of Tokyo, Japan), anti-Mrp4 (Dr. John D. Schuetz, St. Jude Children’s Re-search Hospital, Memphis, Tennessee), and anti-Bsep (Dr. Bruno Stieger, University Hospital, Zurich,Switzerland). All other reagents were purchased fromSigma–Aldrich and Fisher Scientific (Mississauga,Ontario, Canada).

1,25(OH)2D3 and Vehicle (Corn Oil) Treatment in RatsIn Vivo

The concentrations of 1,25(OH)2D3 and 1"(OH)D2 inanhydrous ethanol were measured spectrophotomet-rically at 265 nm (UV-1700, Shimadzu Scientific In-struments, Columbia, Maryland), and the solutionswere diluted in filtered corn oil (Sigma–Aldrich) forinjection. Male Sprague–Dawley rats (260–280 g),purchased from Charles River (St. Constant, Quebec,Canada), were given water and food ad libitum andmaintained under a 12:12-h light and dark cycle in ac-cordance to animal protocols approved by the Univer-sity of Toronto (Ontario, Canada). Rats (n = 4 in eachgroup) were injected with 0, 1.28 nmol/kg of 1"(OH)D2or 4.8 or 6.4 nmol/kg of 1,25(OH)2D3 in 1 mL/kg cornoil i.p. every other day for 8 days. At 48 h following thelast day of injection, rats were anesthetized with ke-tamine and xylazine (90 and 10 mg/kg, respectively)by i.p. injection. An aliquot (0.5 mL) of portal and sys-temic blood was collected and centrifuged at 605 g for10 min to obtain plasma.

Blood Analysis and Preparation of Tissues

Portal bile acid concentration was determined usinga Total Bile Acids Assay Kit (BQ042A-EALD fromBioQuant, San Diego, California) following the man-ufacturer’s protocol. Calcium and phosphorus mea-surements in systemic plasma were determinedby inductively coupled plasma atomic emissionspectroscopy (Optima 3000 DV, PerkinElmer Inc.,Waltham, Massachusetts). These plasma sampleswere diluted 350-fold with 1% nitric acid before eachmeasurement. Calcium was measured at 317.9 and315.9 nm, whereas phosphorus at 213.6 and 214.9 nm.

After blood collection, the portal vein was cannu-lated and flushed with 50 mL of ice-cold physiologi-cal saline solution. The segments of the small intes-tine of vehicle control and treated rats were removedand placed on ice and cut into eight segments, asoutlined by the procedure of Chow et al.20 Entero-cytes were isolated from the mucosal scrapings of ev-erted intestinal segments of the S1 (duodenum) andS8 (ileum) segments. Enterocytes were then imme-diately snapped frozen in liquid nitrogen and storedat −80◦C until analyses. The liver and kidney sam-ples were removed, weighed, cut to small pieces, andsnapped frozen in liquid nitrogen, then stored in the−80◦C freezer for future analyses.

Preparation of Subcellular Fractions from Enterocytes

Frozen mucosal scrapings from intestinal segmentswere homogenized with 1 mL of Trizma HCl (0.1 M,pH 7.4) buffer containing 1% protease inhibitor cock-tail (Sigma–Aldrich) and then sonicated for 10 s,as previously described.20 Samples were centrifugedfirst at 1000 g at 4◦C for 10 min and the supernatantwas transferred to a new tube and spun again at21,000 g at 4◦C for 1 h. The resulting pellet was resus-pended in the same homogenizing buffer for Westernblot analyses.

Preparation of Subcellular Fractions of Liverand Kidney Tissue

For preparation of the crude membrane fraction, liverand kidney tissues were homogenized in the crudemembrane homogenizing buffer (250 mM sucrose,10 mM HEPES, and 10 mM Trizma base, pH 7.4)containing 1% protease inhibitor cocktail as describedabove. The resultant homogenate was centrifuged at3000 g for 10 min at 4◦C. The supernatant obtainedwas transferred to an ultracentrifuge tube and spunat 33,000 g for 60 min at 4◦C. The resultant pelletwas placed in a resuspension buffer (50 mM man-nitol, 20 mM HEPES, 20 mM Trizma base, pH 7.4)containing 1% protease inhibitor cocktail for West-ern blot analyses. For preparation of the hepatic mi-crosomal fraction, liver tissue was homogenized withmicrosomal buffer (250 mM sucrose, 10 mM TrizmaHCl, 1 mM EDTA, pH 7.4) containing 1% protease in-hibitor cocktail, as described above. The homogenatewas centrifuged at 9000 g for 10 min at 4◦C to pro-vide a supernatant, which was subsequently spun at100,000 g for another 60 min at 4◦C. The resultingpellet was resuspended in the same microsomal ho-mogenizing buffer containing protease inhibitor forWestern blot analyses. The protein concentrations ofthe samples were assayed by Lowry method29 usingbovine serum albumin as the standard. Samples werethen stored at −80◦C until Western blot analyses.

JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 100, NO. 4, APRIL 2011 DOI 10.1002/jps285


Western Blotting

Intestinal, hepatic, and renal protein samples (20or 50 :g) were separated by 7.5% or 10% SDS-polyacrylamide gels at 100 V. After separation,proteins were transferred onto a nitrocellulosemembrane (Amersham Biosciences, Piscataway, NewJersey) that was subsequently blocked with 5% (w/v)skim milk in Tris-buffered saline (pH 7.4) and 0.1%Tween 20 (TBS-T) (Sigma–Aldrich Canada) for 1 hat room temperature, and then washed with 0.1%TBS-T followed by incubation with primary antibodysolution in 2% skim milk in 0.1% TBS-T overnightat 4◦C. On the next day, the membrane was washedwith 0.1% TBS-T and then incubated with secondaryantibody in 2% skim milk in 0.1% TBS-T for 2 h atroom temperature, and again washed with 0.1% TBS-T. Bands were visualized using chemiluminescencereagents (Amersham Biosciences) and quantified byscanning densitometry (NIH Image software; http://rsb.info.nih.gov/nih-image/). The band intensity oftarget protein was normalized against that of villinfor intestinal samples or GAPDH for liver and kid-ney samples, to correct for loading errors. All targetproteins were checked by linearity (range 10–60 :g)against band intensity, and were found to be associ-ated with good correlation coefficients (0.9–0.99) forthe plot of the intensity versus the amount of proteinin the tissue.

Quantitative Real-Time Polymerase Chain Reaction

Similar to the procedures previously described,20 to-tal RNA from scraped enterocytes, liver, and kidneytissues were extracted with the TRIzol extractionmethod (Sigma–Aldrich) according to the manufac-turer’s protocol, with modifications. Total RNA wasquantified by ultraviolet spectrometry measured at260 nm. The purity was checked by the ratios of thereadings at 260/280 and 260/230 nm (≥1.7). The com-plementary DNA (cDNA) was immediately synthe-sized from the RNA samples, using the High CapacitycDNA Reverse Transcription Kit (Applied BiosystemsCanada, Ontario, Canada). Quantitative polymerasechain reaction (qPCR) was performed with two de-tection systems (SYBR Green or Taqman assay), de-pending on the availability of the primer sets. A PCRmixture (20 :L final volume) consisting of 75 ngcDNA, 1 :M of forward and reverse primers, and1× Power SYBR Green PCR Master Mix (AppliedBiosystems) was used to perform PCR analysis. In-formation on primer sequences was summarized inthe published lists of Chow et al.18,20 Amplificationand detection were performed using the ABI 7500system. The qPCR system was designated the follow-ing PCR reaction profile: 95◦C for 10 min, and 40 cy-cles of 95◦C for 15 s and 60◦C for 1 min, followed bythe dissociation curve. Data were analyzed using the

ABI Sequence Detection software version 1.4 (AppliedBiosystems Canada, ON) to obtain critical thresholdcycle (CT) value. Fold changes between vehicle con-trol and treatment was expressed as 2−(��CT). All tar-get mRNA data were normalized to villin mRNA forintestinal samples and GAPDH mRNA for liver andkidney samples.

Statistical Analysis

Data were expressed as mean ± standard deviation.Data comparing the difference between two groupswere analyzed using both the two-tailed Student’s t-test and the Mann–Whitney U-test, respectively. Aone-way analysis of variance was used for the mRNAand protein data to compare the treatment groupsversus the vehicle control. A P value of less than 0.05was set as the level of significance.

RESULTS

Effects of 1α(OH)D2 and 1,25(OH)2D3 on BodyWeight, Calcium and Phosphorus Levels, and Portal BileAcid Concentrations

Treatment with the 1.28 nmol/kg dose of 1"(OH)D2,given i.p. every other day for 8 days, resulted in aslightly but significantly lower body weight comparedwith the vehicle control at the beginning of day 2. The1,25(OH)2D3 dose of 4.8 nmol/kg, given every otherday for 8 days, also resulted in a modest but signifi-cant loss in body weight compared with vehicle controlat the beginning of day 6, and a small and significantweight loss compared with vehicle control at the be-ginning at day 5 for the 6.4 nmol/kg dose (Fig. 1a). Incomparison, rats reported earlier, which were givendaily, lower 1,25(OH)2D3 doses (1.28 and 2.56 nmol/kg) consecutively for 4 days, suffered a significantlygreater loss in body weight that was apparent afterday 3 of treatment (Fig. 1b).18,20 The calcium levelsin plasma were significantly increased (12% and 20%)in rats treated with 1"(OH)D2 and the 1,25(OH)2D3(1.28, and 4.8 nmol/kg, respectively, every other dayfor 8 days), whereas the phosphorus levels had re-mained unchanged (Fig. 1c). These changes weremilder in comparison with the daily treatment groupreported earlier (Fig. 1d), wherein higher calcium in-creases (20%, 33%, and 37%) for all 1,25(OH)2D3-treated groups (0.64, 1.28, and 2.56 nmol/kg daily ×4)were noted. Again, the phosphorus levels were un-changed. Portal bile acid concentrations were signifi-cantly increased only in the group receiving the high-est dose of 6.4 nmol/kg of 1,25(OH)2D3 every otherday (Fig. 1e), and the same was observed in the grouptreated with 2.56 nmol/kg of 1,25(OH)2D3 daily for4 days (Fig. 1f).


1598 CHOW ET AL.

Figure 1. Comparative effects of 1"(OH)D2 and 1,25(OH)2D3 treatment every other day (for 8days) versus every day (for 4 days) on rat body weight (a and b), plasma calcium and phosphoruslevels (c and d), and bile acids (e and f). ∗P < 0.05 compared with vehicle control using the two-tailed Student’s t-test.

Effects of 1α(OH)D2 and 1,25(OH)2D3 Treatment onIntestinal Nuclear Receptors, Enzymes, andTransporters

Treatment of 1"(OH)D2 and 1,25(OH)2D3 to rats re-sulted in different effects on the nuclear receptors,

transporters, and enzymes of the intestine. With1"(OH)D2 treatment, the intestinal mRNA expres-sions of VDR, FXR, SHP, FGF15, Cyp3a9, Asbt, andMdr1a in rat duodenum (S1) and/or ileum (S8) re-mained unchanged, whereas levels for Cyp24 andCyp3a1 were increased significantly in both the



Figure 2. Effects of 1"(OH)D2 and 1,25(OH)2D3 treat-ment every other day (for 8 days) on rat intestinal Cyp3aprotein in S1 (duodenum) and Asbt and P-gp protein in S8(ileum). Cyp3a, Asbt, and P-gp protein bands were detectedat 56, 48, and 170 kDa, respectively. ∗P < 0.05 comparedwith vehicle control in the same segment using the two-tailed Student’s t-test.

duodenum and ileum (Table 1). On the contrary, aslight decrease in VDR and FXR mRNA and a slightincrease in SHP, FGF15, Cyp3a9, and Asbt mRNAwere observed in the ileum of the 1,25(OH)2D3-treated rats, with greater changes at the higher dose.Upon comparison, the fold changes in Cyp24 andCyp3a1 mRNA induced by 1"(OH)D2 were >300×and >7× those of 1,25(OH)2D3 (Table 1). However,the total Cyp3a protein in the duodenum remainedunchanged among all treatment groups (Fig. 2). TheAsbt protein expression in the ileum was increased by45% only with 1"(OH)D2 treatment (Fig. 2), despitethat the increase in Asbt mRNA was insignificant (Ta-ble 1). Although no change was observed for Mdr1amRNA for all treatment groups (Table 1), the P-gpprotein level was increased by 66% after 1"(OH)D2,but not after 1,25(OH)2D3 treatment (Fig. 2).

Effects of 1α(OH)D2 and 1,25(OH)2D3 Treatment onHepatic Nuclear Receptors, Enzymes, and Transporters

Treatment with 1"(OH)D2 and 1,25(OH)2D3 only ex-erted a minimum impact on the expression of hepaticnuclear receptors/transcription factors, enzymes, andtransporters in the rat liver. The mRNA expression ofthe VDR, FXR, and hepatocyte nuclear factor 4 alpha(HNF-4") remained unchanged among the treatmentgroups (Table 2). SHP mRNA was increased signifi-cantly in the 1,25(OH)2D3 treatment groups of 4.8 and6.4 nmol/kg. A twofold to threefold and highly variableincrease was observed for Mrp2, Mrp3, and Cyp3a9mRNA in the 1"(OH)D2 and 1,25(OH)2D3 treatmentgroups (Table 2). The changes in hepatic Cyp3a1,Cyp3a2, Cyp7a1, Ntcp, Bsep, and Mdr1a mRNA ex-pression were minor, except for the small change inmRNA of Oatp1a1, the organic anion transporting

Figure 3. Comparative effects of 1"(OH)D2 and1,25(OH)2D3 treatment every other day (for 8 days) onrat hepatic cytochrome P450 isozymes (a) and sinusoidaland canalicular transporter (b) proteins. Cyp7a1, Ntcp,Oatp1a1, Bsep, Mrp2, Mrp3, and Mrp4 bands were detectedat 50, 50, 80, 160, 180, 170, and 160 kDa, their molecularweights, respectively. ∗P < 0.05 compared with vehicle con-trol using the two-tailed Student’s t-test.

polypeptide 1a1, in the 1"(OH)D2 treatment group.Protein levels of total Cyp3a and Cyp7a1 (Fig. 3a), andfor the transporters, Mrp2, Mrp3, Mrp4, Bsep, Ntcp,and Oatp1a1 (Fig. 3b), were all unchanged. The onlynotable change was the 2.3-fold increase in P-gp pro-tein in the 1,25(OH)2D3 treatment group (4.8 nmol/kg) (Fig. 3b). The same was observed previously.18

Effects of 1α(OH)D2 and 1,25(OH)2D3 Treatment onRenal Nuclear Receptors, Enzymes, and Transporters

Greater changes were observed for the renal nu-clear receptors/transcription factor, enzymes, andtransporters of rats treated with 1"(OH)D2 and1,25(OH)2D3. Notably, the mRNA expression of theVDR was significantly increased twofold to fourfold,whereas levels of SHP, HNF-1", HNF-4", and liver re-ceptor homolog-1 remained relatively unchanged forall groups (Table 3). Renal Cyp24 (23- to 38-fold),


1600 CHOW ET AL.

Table 1. Changes in mRNA Expression of Rat Intestinal Nuclear Receptors, Enzymes, and Transporters in S1 (Duodenum) and S8(Ileum), Expressed as Fold Expression Compared with Vehicle Treatment

IntestinalSegment

Nuclear Receptor,Enzymes, andTransporters

Vehicle Every OtherDay for 8 Days

1"(OH)D2 nmol/kg dayEvery Other Day for 8 Days

1,25(OH)2D3 nmol/kg day EveryOther Day for 8 Days ANOVA

0 1.28 4.80 6.40S1 Duodenum VDR 1.00 ± 0.12 0.96 ± 0.06 0.84 ± 0.16 0.96 ± 0.23

Cyp24 1.00 ± 0.31 174 ± 137a 0.47 ± 0.07 0.53 ± 0.16 <.05Cyp3a1 1.00 ± 0.64 7.52 ± 7.17a 0.71 ± 0.24 0.87 ± 0.75 <.05Cyp3a9 1.00 ± 0.38 2.05 ± 1.38 1.41 ± 0.28 1.16 ± 0.75Mdr1a 1.00 ± 0.17 0.72 ± 0.09 1.30 ± 0.14 0.99 ± 0.37

S8 ileum VDR 1.00 ± 0.09 1.01 ± 0.17 0.68 ± 0.03b 0.66 ± 0.15b <.05FXR 1.00 ± 0.23 0.90 ± 0.13 0.67 ± 0.37 0.72 ± 0.10b

SHP 1.00 ± 0.76 1.36 ± 1.33 1.78 ± 0.44 3.71 ± 1.44b

FGF-15 1.00 ± 0.52 4.11 ± 3.17 1.24 ± 0.79 2.64 ± 1.21b <.05Cyp24 1.00 ± 0.29 879 ± 720a 1.30 ± 0.64 1.49 ± 0.36 <.05

Cyp3a1 1.00 ± 0.47 6.38 ± 2.46b 0.86 ± 0.53 1.26 ± 1.06 <.05Cyp3a9 1.00 ± 0.63 1.75 ± 0.47 1.84 ± 1.05 2.21 ± 0.42b <.05Mdr1a 1.00 ± 0.22 1.43 ± 0.42 1.04 ± 0.13 1.46 ± 0.41 <.05Asbt 1.00 ± 0.13 1.27 ± 0.14 1.34 ± 0.79 1.43 ± 0.26b

aP < 0.05 compared with vehicle treatment (0 nmol 1,25(OH)2D3/kg) using Mann–Whitney U-test.bP < 0.05 compared with vehicle treatment (0 nmol 1,25(OH)2D3/kg) using the two-tailed Student’s t-test.ANOVA, analysis of variance; VDR, vitamin D receptor; FXR, farnesoid X receptor; SHP, small heterodimer partner; Asbt, apical sodium-dependent bile

salt transporter.

Cyp3a9 (8- to 32-fold), Asbt (about 2.5- to 5-fold),and Mdr1a (twofold) mRNA were increased amongall 1,25(OH)2D3-treated rats. The inductive effectsof 1"(OH)D2 were usually greater than those of1,25(OH)2D3 (Table 3). However, expression levels ofCyp3a1, Oat3, Ost-$, PepT2, and Mrp4 mRNA re-mained unchanged (Table 3). The positive changesnoted were confined to increased Ost-", Mrp2, andMrp3 mRNA for the 1"(OH)D2 treatment group only,and not for the 1,25(OH)2D3 treatment groups. De-creased mRNA expressions of Oat1 [for the 4.8 nmol/kg of 1,25(OH)2D3 treatment group] and PepT1 [forthe 4.8 and 6.4 nmol/kg of 1,25(OH)2D3 treatment

group] were observed (Table 3). The decrease in Oat1and increase in P-gp protein (Fig. 4) paralleled thechanges in mRNA levels (Table 3). The Mrp3, Mrp4,and Mrp2 protein expressions were unchanged forall groups, whereas Asbt protein levels were foundto increase significantly at highest 1,25(OH)2D3 dose(Fig. 4).

DISCUSSION

The VDR-mediated transcriptional changes in trans-porter and enzyme expression are increasingly be-ing investigated due to the importance of vitamin D

Table 2. Changes in mRNA Expression of Rat Hepatic Nuclear Receptors, Enzymes, and Transporters, Expressed as FoldExpression Compared with Vehicle Treatment

Nuclear Receptors,Enzymes, and Transporters


1"(OH)D2 nmol/kg EveryOther Day for 8 Days

1,25(OH)2D3 nmol/kg Every OtherDay for 8 Days ANOVA

1.28 4.80 6.40VDR 1.00 ± 0.26 1.22 ± 0.61 1.10 ± 0.35 0.82 ± 0.32FXR 1.00 ± 0.26 1.15 ± 0.13 1.24 ± 0.24 1.12 ± 0.29SHP 1.00 ± 0.35 2.02 ± 1.15 2.22 ± 0.88a 1.66 ± 0.32b

HNF-4" 1.00 ± 0.22 1.24 ± 0.41 1.19 ± 0.19 0.97 ± 0.07Cyp3a1 1.00 ± 0.49 1.82 ± 0.80 1.19 ± 0.16 1.37 ± 0.08Cyp3a2 1.00 ± 0.37 0.79 ± 0.65 1.51 ± 0.38 0.92 ± 0.33Cyp3a9 1.00 ± 1.06 0.99 ± 0.32 2.76 ± 2.34 3.64 ± 2.02a

Cyp7a1 1.00 ± 0.32 0.94 ± 0.33 1.43 ± 0.58 1.95 ± 1.81Oatp1a1 1.00 ± 0.17 0.73 ± 0.10a 1.23 ± 0.43 0.98 ± 0.24Ntcp 1.00 ± 0.24 1.26 ± 0.07 1.34 ± 0.39 0.96 ± 0.10Bsep 1.00 ± 0.14 0.92 ± 0.19 1.49 ± 0.59 1.17 ± 0.18Mdr1a 1.00 ± 0.29 1.07 ± 0.03 1.33 ± 0.56 1.00 ± 0.32Mrp2 1.00 ± 0.56 1.07 ± 0.50 1.89 ± 0.47a 1.58 ± 0.31 <.05Mrp3 1.00 ± 0.30 2.02 ± 0.68a 1.48 ± 0.64 1.20 ± 0.11 <.05Mrp4 1.00 ± 0.31 0.74 ± 0.16 1.34 ± 0.36 1.01 ± 0.08

aP < 0.05 compared with vehicle treatment (0 nmol 1,25(OH)2D3/kg/day) using two-tailed Student’s t-test.ANOVA, analysis of variance; VDR, vitamin D receptor; FXR, farnesoid X receptor; SHP, small heterodimer partner; HNF-4", hepatocyte nuclear

factor 4 alpha (HNF-4").



Figure 4. Comparative effects of 1"(OH)D2 and 1,25(OH)2D3 treatment every other day (for8 days) on rat renal basolateral and apical transporters proteins. Oat1 band was detected at 72kDa. ∗P < 0.05 compared with vehicle control using the two-tailed Student’s t-test. †P < 0.05using one-way analysis of variance.

analogs in the treatment of secondary hyperparathy-roidism, psoriasis, advanced malignancy, and an-ticancer therapy.28,30 In man, inductive effects onCYP3A4 and MDR1/P-gp by 1,25(OH)2D3 were ob-served in Caco-2 cells,11 observations that are con-gruent with reports on presence of vitamin D re-

sponse elements in these genes.31,32 In support ofthese data in vitro,9–12 our laboratory also observedthat 1,25(OH)2D3 exerts a positive transcriptional in-duction on the rat Asbt33 and Cyp3a1 of the smallintestine via the VDR in vivo,20 and Cyp3a9, Mdr1a/P-gp, and Asbt in the rat kidney.18 The reduction of

Table 3. Changes in mRNA Expression of Rat Renal Nuclear Receptors, Enzymes, and Transporters, Expressed as FoldExpression Compared with Vehicle Treatment∗

Nuclear Receptors,Enzymes, and Transporters


1"(OH)D2 nmol/kg EveryOther Day for 8 Days

1,25(OH)2D3 nmol/kg Every OtherDay for 8 Days ANOVA

1.28 4.80 6.40VDR 1.00 ± 0.12 4.43 ± 0.64a 2.40 ± 0.86a 2.41 ± 0.38a <.05FXR 1.00 ± 0.15 0.93 ± 0.15 0.71 ± 0.05a 0.85 ± 0.10 <.05SHP 1.00 ± 0.10 0.94 ± 0.29 0.94 ± 0.16 0.86 ± 0.14HNF-1" 1.00 ± 0.11 0.83 ± 0.14 0.87 ± 0.09 0.77 ± 0.11a

HNF-4" 1.00 ± 0.12 0.84 ± 0.08 0.79 ± 0.15 0.93 ± 0.06LRH-1 1.00 ± 0.29 1.01 ± 0.20 1.16 ± 0.36 0.84 ± 0.06Cyp24 1.00 ± 0.88 38.2 ± 7.66a 23.1 ± 8.19a 27.8 ± 3.19a

Cyp3a1 1.00 ± 0.82 0.94 ± 0.72 1.28 ± 0.95 2.22 ± 0.89Cyp3a9 1.00 ± 0.32 31.8 ± 7.88a 9.42 ± 5.14a 8.36 ± 5.49a <.05Asbt 1.00 ± 0.29 4.99 ± 0.40a 2.42 ± 0.74a 2.62 ± 0.97a <.05Oat1 1.00 ± 0.29 0.72 ± 0.06 0.49 ± 0.17a 0.86 ± 0.13 <.05Oat3 1.00 ± 0.44 1.27 ± 0.13 0.64 ± 0.41 1.30 ± 0.06 <.05Ost-" 1.00 ± 0.22 2.15 ± 0.52a 0.91 ± 0.36 1.12 ± 0.13 <.05Ost-$ 1.00 ± 0.28 0.89 ± 0.16 0.96 ± 0.27 0.78 ± 0.17Pept1 1.00 ± 0.40 0.38 ± 0.12a 0.34 ± 0.20a 0.59 ± 0.09 <.05Pept2 1.00 ± 0.18 0.88 ± 0.06 0.96 ± 0.31 0.84 ± 0.18Mdr1a 1.00 ± 0.12 2.13 ± 0.34a 2.11 ± 0.56a 2.21 ± 0.35a <.05Mrp2 1.00 ± 0.35 1.50 ± 0.20a 0.82 ± 0.10 1.38 ± 0.27 <.05Mrp3 1.00 ± 0.09 1.48 ± 0.10a 1.01 ± 0.07 1.16 ± 0.23 <.05Mrp4 1.00 ± 0.08 0.96 ± 0.09 0.84 ± 0.18 0.91 ± 0.04

∗Cyp3a2 was present at very low levels and was not reported.aP < 0.05 compared with vehicle treatment (0 nmol 1,25(OH)2D3/ kg) using the two-tailed Student’s t-test.ANOVA, analysis of variance; VDR, vitamin D receptor; FXR, farnesoid X receptor; SHP, small heterodimer partner; HNF-1", hepatocyte nuclear

factor-1 alpha; LRH-1, liver receptor homolog-1; Asbt, apical sodium-dependent bile salt transporter.


1602 CHOW ET AL.

Cyp7a1 in the rat liver after daily 1,25(OH)2D3 treat-ment in vivo was explained by the elevated intesti-nal FGF15 and hepatic FXR activation as a result ofhigher portal bile acid concentrations that were asso-ciated with 1,25(OH)2D3 treatment.20

Moreover, parallel increases in plasma calcium lev-els were observed in 1"(OH)D2 and 1,25(OH)2D3-treated rats (Fig. 1c). Previous studies had reportedon hypercalcemia and weight loss being associatedwith the treatment of 1,25(OH)2D3 after its daily ad-ministration to rats (Figs. 1b and 1d).18,20 The vita-min D analog, 1"(OH)D3, a prodrug of 1,25(OH)2D3, isknown to alter transporters and enzymes in mice,34,35

and this prodrug displayed higher hypercalcemicproperties than 1"(OH)D2.36,37 It is therefore pru-dent to first assess the methods of dosing in vivofore correlation to the changes in transporter andenzyme target genes associated with treatment of1,25(OH)2D3 or vitamin D analogs. In this study, weexamined whether a longer, protracted dosing sched-ule of 1"(OH)D2 and 1,25(OH)2D3 treatment can re-sult in lessened hypercalcemia and yet retain the ef-fects on transporters and enzymes in vivo. Indeed,the alternate-day, protracted dosing regimen allevi-ated the hypercalcemic and weight loss effects in-duced by 1,25(OH)2D3 and 1"(OH)D2 compared withthose from the daily administration of 1,25(OH)2D3(Figs. 1a–1d), showing that the newly adopted reg-imen is effective in reducing the toxicity associatedwith treatment of vitamin D analogs.

When changes with 1"(OH)D2 were appraised inthe rat kidney, a major target site for VDR trans-activation, the alternate-day treatment regimen per-sistently increased Cyp24, Cyp3a9, Asbt, and Mdr1a,and downregulated Oat1, observations that comparedwell with results from 1,25(OH)2D3 treatment athigher doses and the same dosing regimen (Table 3;Fig. 4) as well as those reported previously for thedaily regimen with 1,25(OH)2D3.18 However, the ex-tents of induction of VDR, Cyp24, Cyp3a9, and Asbtby the 1"(OH)D2 treatment were significantly greaterthan those of 1,25(OH)2D3 administered at higherdoses (Table 3). Induction of Cyp24 due to the highlevels of VDR in the kidney21 and the activation ofCyp24 is expected to result in increased catabolism of1,25(OH)2D3

38 but increased activation of 1"(OH)D2to 1,24(OH)2D2.3 As a result, 1"(OH)D2, the prodrugthat is activated to 1,24(OH)2D2, may be more effi-cacious than the native active ligand, 1,25(OH)2D3,that is rapidly inactivated by Cyp24 in vivo. Thesechanges can explain the reciprocal relationship be-tween 1,24(OH)2D2 and 1,25(OH)2D3.6 Perhaps dueto these reasons, 1"(OH)D2 treatment, even at alower dose, evoked dramatically greater changes inrenal transporter and enzyme expressions more than1,25(OH)2D3 at high doses. The one significant changein the kidney resides in Mdr1a mRNA and a twofold

increase in P-gp protein expression for the all treat-ment groups (Fig. 4). Although reports have shownthat the upregulation of Mdr1a/P-gp may be due tothe activation of the transcription factor hypoxia-inducible factor-1 by calcium,39 we believe that theupregulation of Mdr1a/P-gp is mainly due to VDR ac-tivation. First of all, Saeki et al.32 showed that a vita-min D response element is found in MDR1 gene, andFan et al.11 have reported that both 1,25(OH)2D3 and1"(OH)D2 increased P-gp in vitro. Calcium absorp-tion occurred in both intestine and kidney by TRP6and TRP5, respectively.40,41 If elevated plasma cal-cium would increase P-gp in the intestine, liver, andkidney, then levels of P-gp would all be increased inthese tissues. However, only P-gp in the kidney wasupregulated in the 1,25(OH)2D3-treated rats in this(Fig. 4) and other studies.18

When changes were appraised in the rat liver, aVDR-poor tissue,17 1"(OH)D2 was found to play onlya minor role in the regulation of transporter and en-zyme expressions (Table 2; Fig. 3), as observed for1,25(OH)2D3 in this study. The changes were alsosimilar to those observed in previous studies wherein1,25(OH)2D3 at lower doses was administered dailyfor 4 days.20 However, the secondary FXR effect on thereduction of Cyp7a1 (Fig. 3a) as a result of the highportal bile acid concentrations after daily injectionsof 1,25(OH)2D3

20 was absent in the present studyin both the 1"(OH)D2 and 1,25(OH)2D3 treatmentgroups. The induction of SHP in liver by 1"(OH)D2and 1,25(OH)2D3 for the protracted, alternate-dayregimen (Table 2) was lower than those achieved with1,25(OH)2D3 daily dosing at lower doses.20 The com-parison suggests lower FXR effects for the protractedregimen. Indeed, the alternative day administrationof 1,25(OH)2D3 to rats resulted in a lack of changeAsbt protein and a smaller induction of intestinalFGF15 mRNA (Table 1), factors previously found to beimportant in the downregulation of Cyp7a1.20 How-ever, the extents of induction of intestinal FGF15mRNA (4.1-fold) and Asbt protein by 1"(OH)D2 treat-ment in this study (Table 1) were similar and com-parable to those previously observed with the dailytreatment regime;20 the lack of change for 1"(OH)D2on Cyp7a1 in the liver was unknown.

The upregulation of intestinal CYP3A11,13 and re-nal P-gp18 by the vitamin D analogs, 1,25(OH)2D3 or1"(OH)D2 (Fig. 4), could lead to potential drug–druginteractions when these drugs are taken in combi-nation with other xenobiotics. Currently, high dosesof 1,25(OH)2D3 and the vitamin D analogs have beenused clinically in combination with anticancer agentssuch as docetaxel and paclitaxel that are also CYP3A4and P-gp substrates.28 The upregulation of CYP3A4and P-gp by 1,25(OH)2D3 or 1"(OH)D2 could reducethe therapeutic effects of these drugs and their as-soicated toxicity. Thus, more studies are needed to



examine the potential drug–drug interactions of vita-min D analogs and drugs that are P-gp substrates.

In conclusion, this study demonstrates that VDRregulation of transporters and enzymes in the smallintestine and kidney persisted when 1,25(OH)2D3 andthe provitamin D analog, 1"(OH)D2, are given inter-mittently to the rat in vivo. In this study, we veri-fied that 1"(OH)D2 showed a greater induction poten-tial toward transporters and enzymes in the kidneythan 1,25(OH)2D3, an observation attributed to thehigh levels of renal Cyp24 that converts 1"(OH)D2 tothe active form, 1,24(OH)2D2 (Table 3). These obser-vations are significant in terms of considerations ofdrug–drug interactions for the concomitant use of an-ticancer drugs with the vitamin D analogs. With a pro-tracted dosing schedule of these vitamin D analogs,changes in transporters and enzymes in the intestineand kidney were found to be less dramatic comparedwith those after daily administration. The protractedschedule is associated with reduced hypercalcemiaand weight loss, and would prove beneficial for long-term treatments. The benefits of even more sparseadministration of vitamin D analogs, as used clin-ically in the treatment of cancer,28 on transportersand enzymes need to be further appraised for theirlong-term use.

ACKNOWLEDGMENTS

This work was supported by the Canadian Institutesfor Health Research, MOP89850. Edwin C.Y. Chowis a recipient of the NSERC Alexander Graham BellCanada Graduate Scholarship.

References

1. Martin KJ, Gonzalez EA. 2001. Strategies to minimize bonedisease in renal failure. Am J Kidney Dis 38:1430–1436.

2. Frazao JM, Elangovan L, Maung HM, Chesney RW, AcchiardoSR, Bower JD, Kelley BJ, Rodriguez HJ, Norris KC, RobertsonJA, Levine BS, Goodman WG, Gentile D, Mazess RB, KylloDM, Douglass LL, Bishop CW, Coburn JW. 2000. Intermittentdoxercalciferol (1"-hydroxyvitamin D2) therapy for secondaryhyperparathyroidism. Am J Kidney Dis 36:550–561.

3. Strugnell S, Byford V, Makin HL, Moriarty RM, Gilardi R,LeVan LW, Knutson JC, Bishop CW, Jones G. 1995. 1",24(S)-dihydroxyvitamin D2: A biologically active product of 1"-hydroxyvitamin D2 made in the human hepatoma, Hep3B.Biochem J 310 (Pt 1):233–241.

4. Grostern RJ, Bryar PJ, Zimbric ML, Darjatmoko SR,Lissauer BJ, Lindstrom MJ, Lokken JM, Strugnell SA, Al-bert DM. 2002. Toxicity and dose-response studies of 1"-hydroxyvitamin D2 in a retinoblastoma xenograft model. ArchOphthalmol 120:607–612.

5. Liu G, Wilding G, Staab MJ, Horvath D, Miller K, DresenA, Alberti D, Arzoomanian R, Chappell R, Bailey HH. 2003.Phase II study of 1"-hydroxyvitamin D2 in the treatment ofadvanced androgen-independent prostate cancer. Clin CancerRes 9:4077–4083.

6. Knutson JC, Hollis BW, LeVan LW, Valliere C, Gould KG,Bishop CW. 1995. Metabolism of 1"-hydroxyvitamin D2 to

activated dihydroxyvitamin D2 metabolites decreases endoge-nous 1",25-dihydroxyvitamin D3 in rats and monkeys. En-docrinology 136:4749–4753.

7. Peter WL. 2000. Hectorol: A new vitamin D prohormone.Nephrol Nurs J 27:67–68.

8. Salusky IB. 2005. Are new vitamin D analogues in renal bonedisease superior to calcitriol? Pediatr Nephrol 20:393–398.

9. Aiba T, Susa M, Fukumori S, Hashimoto Y. 2005. The effectsof culture conditions on CYP3A4 and MDR1 mRNA inductionby 1",25-dihydroxyvitamin D3 in human intestinal cell lines,Caco-2 and LS180. Drug Metab Pharmacokinet 20:268–274.

10. Schmiedlin-Ren P, Thummel KE, Fisher JM, Paine MF, LownKS, Watkins PB. 1997. Expression of enzymatically activeCYP3A4 by Caco-2 cells grown on extracellular matrix-coatedpermeable supports in the presence of 1",25-dihydroxyvitaminD3. Mol Pharmacol 51:741–754.

11. Fan J, Liu S, Du Y, Morrison J, Shipman R, Pang KS. 2009.Up-regulation of transporters and enzymes by the vitamin Dreceptor ligands, 1",25-dihydroxyvitamin D3 and vitamin Danalogs, in the Caco-2 cell monolayer. J Pharmacol Exp Ther330:389–402.

12. Echchgadda I, Song CS, Roy AK, Chatterjee B. 2004. Dehy-droepiandrosterone sulfotransferase is a target for transcrip-tional induction by the vitamin D receptor. Mol Pharmacol65:720–729.

13. Khan AA, Chow EC, van Loenen-Weemaes AM, Porte RJ, PangKS, Groothuis GM. 2009. Comparison of effects of VDR ver-sus PXR, FXR and GR ligands on the regulation of CYP3Aisozymes in rat and human intestine and liver. Eur J PharmSci 37:115–125.

14. Jiang W, Miyamoto T, Kakizawa T, Nishio SI, Oiwa A, TakedaT, Suzuki S, Hashizume K. 2006. Inhibition of LXR" signal-ing by vitamin D receptor: Possible role of VDR in bile acidsynthesis. Biochem Biophys Res Commun 351:176–184.

15. Honjo Y, Sasaki S, Kobayashi Y, Misawa H, NakamuraH. 2006. 1,25-dihydroxyvitamin D3 and its receptor inhibitthe chenodeoxycholic acid-dependent transactivation by far-nesoid X receptor. J Endocrinol 188:635–643.

16. Sandgren ME, Bronnegard M, DeLuca HF. 1991. Tissue dis-tribution of the 1,25-dihydroxyvitamin D3 receptor in the malerat. Biochem Biophys Res Commun 181:611–616.

17. Gascon-Barre M, Demers C, Mirshahi A, Neron S, Zalzal S,Nanci A. 2003. The normal liver harbors the vitamin D nu-clear receptor in nonparenchymal and biliary epithelial cells.Hepatology 37:1034–1042.

18. Chow EC, Sun H, Khan AA, Groothuis GM, Pang KS. 2010.Effects of 1",25-dihydroxyvitamin D3 on transporters and en-zymes of the rat intestine and kidney in vivo. Biopharm DrugDispos 31:91–108.

19. Han S, Chiang JY. 2009. Mechanism of vitamin D receptorinhibition of cholesterol 7"-hydroxylase gene transcription inhuman hepatocytes. Drug Metab Dispos 37:469–478.

20. Chow EC, Maeng HJ, Liu S, Khan AA, Groothuis GM, PangKS. 2009. 1",25-Dihydroxyvitamin D3 triggered vitamin Dreceptor and farnesoid X receptor-like effects in rat intestineand liver in vivo. Biopharm Drug Dispos 30:457–475.

21. Feldman D, Pike JW, Glorieux FH. 2005. Vitamin D. 2nd ed.Boston: Elsevier Academic Press , pp. 86-87 .

22. Theodoropoulos C, Demers C, Mirshahi A, Gascon-BarreM. 2001. 1,25-Dihydroxyvitamin D3 downregulates the ratintestinal vitamin D3-25-hydroxylase CYP27A. Am J PhysiolEndocrinol Metab 281:E315–E325.

23. Cheng JB, Levine MA, Bell NH, Mangelsdorf DJ, RussellDW. 2004. Genetic evidence that the human CYP2R1 enzymeis a key vitamin D 25-hydroxylase. Proc Natl Acad Sci U S A101:7711–7715.

24. Gupta RP, He YA, Patrick KS, Halpert JR, Bell NH. 2005.CYP3A4 is a vitamin D-24- and 25-hydroxylase: Analysis of


1604 CHOW ET AL.

structure function by site-directed mutagenesis. J Clin En-docrinol Metab 90:1210–1219.

25. Rahmaniyan M, Patrick K, Bell NH. 2005. Characterizationof recombinant CYP2C11: A vitamin D 25-hydroxylase and24-hydroxylase. Am J Physiol Endocrinol Metab 288:E753–760.

26. Aiba I, Yamasaki T, Shinki T, Izumi S, Yamamoto K, YamadaS, Terato H, Ide H, Ohyama Y. 2006. Characterization of ratand human CYP2J enzymes as Vitamin D 25-hydroxylases.Steroids 71:849–856.

27. Upton RA, Knutson JC, Bishop CW, LeVan LW. 2003. Phar-macokinetics of doxercalciferol, a new vitamin D analoguethat lowers parathyroid hormone. Nephrol Dial Transplant18:750–758.

28. Masuda S, Jones G. 2006. Promise of vitamin D analoguesin the treatment of hyperproliferative conditions. Mol CancerTher 5:797–808.

29. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. 1951. Pro-tein measurement with the Folin phenol reagent. J Biol Chem193:265–275.

30. Nagpal S, Na S, Rathnachalam R. 2005. Noncalcemic actionsof vitamin D receptor ligands. Endocr Rev 26:662–687.

31. Thummel KE, Brimer C, Yasuda K, Thottassery J, Senn T,Lin Y, Ishizuka H, Kharasch E, Schuetz J, Schuetz E. 2001.Transcriptional control of intestinal cytochrome P-4503Aby 1",25-dihydroxy vitamin D3. Mol Pharmacol 60:1399–1406.

32. Saeki M, Kurose K, Tohkin M, Hasegawa R. 2008. Identifi-cation of the functional vitamin D response elements in thehuman MDR1 gene. Biochem Pharmacol 76:531–542.

33. Chen X, Chen F, Liu S, Glaeser H, Dawson PA, Hofmann AF,Kim RB, Shneider BL, Pang KS. 2006. Transactivation of ratapical sodium-dependent bile acid transporter and increased

bile acid transport by 1",25-dihydroxyvitamin D3 via the vita-min D receptor. Mol Pharmacol 69:1913–1923.

34. Nishida S, Ozeki J, Makishima M. 2009. Modulation of bileacid metabolism by 1"-hydroxyvitamin D3 administration inmice. Drug Metab Dispos 37:2037–2044.

35. Ogura M, Nishida S, Ishizawa M, Sakurai K, Shimizu M, Mat-suo S, Amano S, Uno S, Makishima M. 2009. Vitamin D3modulates the expression of bile acid regulatory genes and re-presses inflammation in bile duct-ligated mice. J PharmacolExp Ther 328:564–570.

36. Sjoden G, Smith C, Lindgren U, DeLuca HF. 1985. 1"-Hydroxyvitamin D2 is less toxic than 1"-hydroxyvitamin D3in the rat. Proc Soc Exp Biol Med 178:432–436.

37. Coburn JW, Tan AU, Jr., Levine BS, Mazess RB, Kyllo DM,Knutson JC, Bishop CW. 1996. 1"-Hydroxy-vitamin D2: Anew look at an ‘old’ compound. Nephrol Dial Transplant (11Suppl 3):153–157.

38. Zierold C, Mings JA, DeLuca HF. 2003. Regulationof 25-hydroxyvitamin D3–24-hydroxylase mRNA by 1,25-dihydroxyvitamin D3 and parathyroid hormone. J CellBiochem 88:234–237.

39. Riganti C, Doublier S, Viarisio D, Miraglia E, PescarmonaG, Ghigo D, Bosia A. 2009. Artemisinin induces doxorubicinresistance in human colon cancer cells via calcium-dependentactivation of HIF-1" and P-glycoprotein overexpression. Br JPharmacol 156:1054–1066.

40. den Dekker E, Hoenderop JG, Nilius B, Bindels RJ. 2003. Theepithelial calcium channels, TRPV5 & TRPV6: From identifi-cation towards regulation. Cell Calcium 33:497–507.

41. Meyer MB, Zella LA, Nerenz RD, Pike JW. 2007. Characteriz-ing early events associated with the activation of target genesby 1,25-dihydroxyvitamin D3 in mouse kidney and intestinein vivo. J Biol Chem 282:22344–22352.


294

APPENDIX T1 Mouse Primer Sequences for qPCR APPENDIX T1

Gene Bank


PPAR NM_011146.3 CATGCTTGTGAAGGATGCAAG TTCTGAAACCGACAGTACTGACAT

ApoE NM_009696.3 AAGCAACCAACCCTGGGAG TGCACCCAGCGCAGGTA

CETP NM_011125.2 GATGGTGTACGTGGCCTTTT TGGCCTCTAGCTTCAGCTTC

VLDLr NM_001161420.1 GAGCCCCTGAAGGAATGCC CCTATAACTAGGTCTTTGCAGATATGG

LDLr NM_010700.2 AGGCTGTGGGCTCCATAGG TGCGGTCCAGGGTCATCT

SR-B1 NM_016741.1 GGGAGCGTGGACCCTATGT CGTTGTCATTGAAGGTGATGT

Asbt NM_011388.2 GATAGATGGCGACATGGACCTC CAATCGTTCCCGAGTCAACC

Oatp1a4 NM_030687.1 CACGTCTGTAGTTGGGCTTATC CCCATAACTGCACATCCTACAC

Ost NM_145932.3 TACAAGAACACCCTTTGCCC CGAGGAATCCAGAGACCAAA

Ost NM_178933.2 GTATTTTCGTGCAGAAGATGCG TTTCTGTTTGCCAGGATGCTC

NPC1L1 NM_207242.2 TGGACTGGAAGGACCATTTCC GCGCCCCGTAGTCAGCTAT

Ntcp NM_011387.2 ATCTGACCAGCATTGAGGCTC CCGTCGTAGATTCCTTGCTGT

ABCA1 NM_013454.3 CGTTTCCGGGAAGTGTCCTA CTAGAGATGACAAGGAGGATGGA

ABCG5 NM_031884.1 TCAATGAGTTTTACGGCCTGAA GCACATCGGGTGATTTAGCA

ABCG8 NM_026180.2 TGCCCACCTTCCACATGTC ATGAAGCCGGCAGTAAGGTAGA

295

Bsep NM_021022.3 ACAGCACTACAGCTCATTCAGAG TCCATGCTCAAAGCCAATGATCA

Mrp2 NM_013806.2 GCTTCCCATGGTGATCTCTT CTTGGATTGTGGCTTCCAAG

Mrp3 NM_029600.3 CGCTCTCAGCTCACCATCAT GGTCATCCGTCTCCAAGTCA

Mrp4 NM_001163675.1 GGTTGGAATTGTGGGCAGAA TCGTCCGTGTGCTCATTGAA

TRPV6 NM_022413.4 ATCGATGGCCCTGCCAACT CAGAGTAGAGGCCATCTTGTTGCTG

Cyp3a11 NM_007818.3 TTTGGTAAAGTACTTGAGGCAGA CTGGGTTGTTGAGGGAATC

Cyp8b1 NM_010012.3 GCCTTCAAGTATGATCGGTTCCT GATCTTCTTGCCCGACTTGTAGA

HMG CoA Reductase

NM_008255.2 CAAGGAGCATGCAAAGACAA GCCATCACAGTGCCACATAC

Sult2a1 NM_001111296.2 CTGGCTGTCCATGAGAGAAT GGCTTGGAAAGAGCTGTACT

296

APPENDIX T2 Antibodies Chart APPENDIX T2

Antibody, Cat#

Company Species/Tissue

Tested % SDS-

PAGE gel Incubation condition

Molecular Weight (kDa)

Primary Ab and Dilution

Secondary Ab and Dilution

GAPDH (ab9245)

Abcam Inc. mouse and rat

intestine, liver, and kidney

any any 37 1: 10000 anti-mouse;

1:10000

Villin (C-19) Santa Cruz

Biotechnology

mouse and rat intestine, liver, and

kidney any any 95 1:5000 anti-goat; 1:5000

Lamin-B (ab45848)

Abcam Inc. mouse liver any any 72 1: 5000 anti-rabbit; 1:5000

VDR (9A7) Thermo Fisher

Scientific


kidney 10 95°C for 5 min 60 1:1000 anti-rat; 1:2000

Asbt Dr. Paul A.

Dawson mouse and rat

intestine and kidney 12 37°C for 15 min 48 1:5000 anti-rabbit; 1:5000

Oat1 (OAT11-A) Alpha

Diagnostic Intl. Inc.

mouse and rat kidney 10 37°C for 15 min 72 1:1000 anti-rabbit; 1:2000

Oatp1a1 Dr. Allan W.

Wolkoff mouse and rat liver 10 37°C for 15 min 80 1:2000 anti-rabbit; 1:2000

Oatp1a4 Dr. Allan W.

Wolkoff mouse and rat liver 10 37°C for 15 min 94 1:2000 anti-rabbit; 1:2000

Oatp1b2 Dr Richard B.

Kim mouse and rat liver 10 37°C for 15 min 80 1:2000 anti-rabbit; 1:2000

PepT1 Dr. Wolfgang

Sadee mouse and rat kidney

and rat intestine 10 37°C for 15 min 95 1:5000 anti-rabbit; 1:5000

Bsep Dr. Bruno

Stieger mouse and rat liver 7.5 37°C for 15 min 160 1:2000 anti-rabbit; 1:2000

Mrp2 (ALX-801-016-C250)

Alexis Biochemicals

rat intestine, liver, and kidney

7.5 37°C for 15 min 180 1:1000 anti-mouse;

1:2000

Mrp3 Dr. Yuichi Sugiyama


kidney 7.5 37°C for 15min 170 1:2000 anti-rabbit; 1:5000

297

Mrp4 Dr. John D.

Schuetz


kidney 7.5 37°C for 15 min 160 1:2000 anti-rabbit; 1:2000

P-gp (C-19) Abcam Inc. mouse and rat

intestine, liver, and kidney

7.5 37°C for 15 min 170 1:1000 anti-mouse;

1:2000

Cyp24 (H-87) Santa Cruz

Biotechnology mouse and rat kidney 10 37°C for 15 min 50 1:1000 anti-goat; 1:2000

Cyp3a2 (458223)

BD Biosciences


kidney 10 37°C for 15 min 55 1:5000 anti-rabbit; 1:5000

Cyp7a1 (N-17) Santa Cruz

Biotechnology mouse and rat liver 10 37°C for 15 min 50 1: 1000 anti-goat; 1:2000

298

APPENDIX T3 Body weight of fxr(+/+) (wild-type) mice treated with 1,25(OH)2D3 i.p. q2d (every other day) for 8 days. Data represents mean ± SD. * denotes P < 0.05 using two-tailed Student t test compared to vehicle control.

Batch 3 (Jan 19, 2009) Batch 4A (Mar 30, 2009) Batch 5A (Nov 15, 2010) Treatment

Day Vehicle Control

2.5 µg/kg 1,25(OH)2D3

Vehicle Control

2.5 µg/kg 1,25(OH)2D3

Vehicle Control

2.5 µg/kg 1,25(OH)2D3

1 0.965 ± 0.041 0.967 ± 0.026 0.992±0.018 0.961 ± 0.011* 1.001 ± 0.021 1.002 ± 0.013

2 0.958 ± 0.048 0.964 ± 0.057 0.989±0.030 0.961 ± 0.019 0.990 ± 0.019 0.974 ± 0.015

3 0.961 ± 0.048 0.953 ± 0.034 0.985±0.036 0.952 ± 0.021 0.990 ± 0.022 0.967 ± 0.018

4 0.983 ± 0.032 0.957 ± 0.053 0.977±0.031 0.945 ± 0.024 0.977 ± 0.029 0.955 ± 0.026

5 1.010 ± 0.032 0.927 ± 0.053* 0.974±0.031 0.911 ± 0.022* 0.992 ± 0.026 0.953 ± 0.026*

6 1.022 ± 0.023 0.945 ± 0.044* 0.969±0.027 0.922 ± 0.021* 0.992 ± 0.024 0.955 ± 0.019*

7 1.025 ± 0.024 0.906 ± 0.066* 0.974±0.022 0.905 ± 0.042* 0.980 ± 0.021 0.898 ± 0.032*

8 1.030 ± 0.022 0.934 ± 0.060* 0.972±0.023 0.921 ± 0.049 0.991 ± 0.028 0.943 ± 0.038*

* denotes P < 0.05 compared to vehicle control using Mann-Whitney U test APPENDIX T3 APPENDIX T4 Body weight of fxr(-/-) mice treated with 1,25(OH)2D3 i.p. q2d (every other day) for 8 days. Data represents mean ± SD. * denotes P < 0.05

using two-tailed Student t test compared to vehicle control.

Batch 1 (Nov 8, 2007) Batch 2 (Dec 4, 2007) Batch 4B (Mar 24, 2009) Batch 5B (Nov15, 2010) Treatment

Day Vehicle Control

2.5 µg/kg 1,25(OH)2D3

Vehicle Control

2.5 µg/kg 1,25(OH)2D3

Vehicle Control

2.5 µg/kg 1,25(OH)2D3

Vehicle Control

2.5 µg/kg 1,25(OH)2D3

1 0.993 ± 0.0195 0.972 ± 0.021 0.988 ± 0.013 0.980 ± 0.011 0.994 ± 0.032 0.986 ± 0.008 0.986±0.018 0.981 ± 0.014

2 1.021 ± 0.0207 0.976 ± 0.032* 1.001 ± 0.007 0.984 ± 0.024 1.007 ± 0.016 0.982 ± 0.014 0.994±0.014 0.982 ± 0.032

3 1.031 ± 0.0100 0.970 ± 0.026* 0.993 ± 0.014 0.964 ± 0.012* 0.996 ± 0.018 0.946 ± 0.027 0.992±0.023 0.951 ± 0.020*

4 1.035 ± 0.0252 0.959 ± 0.016* 1.002 ± 0.016 0.975 ± 0.014* 1.001 ± 0.038 0.982 ± 0.013 1.007±0.034 0.978 ± 0.019

5 1.040 ± 0.0319 0.923 ± 0.026* 0.992 ± 0.014 0.933 ± 0.013* 1.007 ± 0.022 0.933 ± 0.017* 1.015±0.031 0.947 ± 0.016*

6 1.035 ± 0.0315 0.960 ± 0.024* 0.995 ± 0.019 0.952 ± 0.015* 1.006 ± 0.027 0.945 ± 0.027* 1.010±0.026 0.961 ± 0.031*

7 1.038 ± 0.0292 0.942 ± 0.019* 0.999 ± 0.011 0.918 ± 0.013* 1.022 ± 0.047 0.894 ± 0.017* 1.021±0.029 0.959 ± 0.028*

8 1.020 ± 0.0201 0.974 ± 0.029* 0.996 ± 0.016 0.923 ± 0.032* 1.017 ± 0.049 0.932 ± 0.023* 1.019±0.026 0.956 ± 0.048*

* denotes P < 0.05 compared to vehicle control using Mann-Whitney U test APPENDIX T4

299

APPENDIX T5 Body weight of wild-type mice treated with 1,25(OH)2D3 i.p. q2d (every other day) for 8 days in the last week of a 3 weeks pretreatment of Western diet and its cumulative food intake (g) per mouse. Data represents mean ± SD. * and † denote P < 0.05 using two-tailed Student t test compared to normal diet and Western diet vehicle control, respectively.

Batch 6 (Oct 1, 2009) Batch 7A (Mar 2, 2010)

Treatment Day

Normal Diet; Vehicle Control

Western diet; Vehicle Control

Western diet; 2.5 µg/kg

1,25(OH)2D3




1,25(OH)2D3 1 0.975 ± 0.009 0.975 ± 0.043 0.980 ± 0.016 0.995±0.036 0.970 ± 0.037 1.002 ± 0.020

2 0.974 ± 0.009 0.985 ± 0.021 0.959 ± 0.029* 0.991±0.059 0.982 ± 0.020 0.985 ± 0.015

3 0.979 ± 0.015 0.992 ± 0.014 0.897 ± 0.042* 1.001±0.050 0.995 ± 0.025 0.952 ± 0.029*

4 0.991 ± 0.006 1.008 ± 0.026 0.905 ± 0.072* 1.010±0.043 1.009 ± 0.032 0.949 ± 0.022*

5 0.982 ± 0.023 1.024 ± 0.030† 0.841 ± 0.084* 1.018±0.038 1.010 ± 0.026 0.924 ± 0.024*

6 0.993 ± 0.017 1.033 ± 0.036† 0.861 ± 0.106* 1.013±0.026 1.010 ± 0.047 0.944 ± 0.022*

7 0.988 ± 0.014 1.033 ± 0.039† 0.824 ± 0.122* 1.025±0.020 1.014 ± 0.039 0.925 ± 0.031*

8 1.001 ± 0.017 1.037 ± 0.038 0.842 ± 0.146* 1.028±0.014 1.025 ± 0.047 0.953 ± 0.041*

† indicates P < 0.05 compared to normal diet vehicle control using Mann-Whitney U test * denotes P < 0.05 compared to Western diet fed vehicle control using Mann-Whitney U test APPENDIX T5 APPENDIX T6 Cumulative food intake (g) per mouse of wild-type mice treated with 1,25(OH)2D3 i.p. q2d (every other day) for 8 days in the last week of a 3

weeks pretreatment of Western diet. Data represents mean ± SD. * and † denote P < 0.05 using two-tailed Student t test compared to normal diet and Western diet vehicle control, respectively.

Batch 7B (Mar 2, 2010)

Treatment Day




1,25(OH)2D3 2 6.18 ± 1.38 4.25 ± 0.75 5.62 ± 0.43

4 12.68 ± 1.48 9.81 ± 1.65 9.90 ± 0.97

6 19.08 ± 1.66 15.23 ± 1.79 16.70 ± 1.85

8 25.40 ± 1.70 20.43 ± 2.10 21.82 ± 1.01

APPENDIX T6

300

APPENDIX T7 Body weight of shp(-/-) mice treated with 1,25(OH)2D3 i.p. q2d (every other day) for 8 days in the last week of a 3 weeks pretreatment of Western diet. Data represents mean ± SD. * denotes P < 0.05 using two-tailed Student t test compared to vehicle control.

Batch 8 (July 4, 2011)

Treatment Day Western diet;

Vehicle Control


1,25(OH)2D3 2 1.009 ± 0.015 1.005 ± 0.011

4 1.028 ± 0.026 0.983 ± 0.028

6 1.035 ± 0.031 0.943 ± 0.044*

8 1.039 ± 0.041 0.894 ± 0.024*

* denotes P < 0.05 compared to Western diet fed vehicle control using Mann-Whitney U test APPENDIX T7 APPENDIX T8 Plasma calcium, phosphorus, and alanine aminotransferase (ALT) and liver triglyceride levels in fxr(+/+) and fxr(-/-) mice. Data represented

mean ± S.E.M. (n=4-6). Calcium and phosphorus in systemic plasma, diluted 350-fold with 1% HNO3, was determined by inductively coupled plasma atomic emission spectroscopy, and showed about a 23-30% increase in calcium in mice treated with 1,25(OH)2D3 treatment. Alanine transaminase (ALT) leakage in systemic plasma was measured with ALT kit (Bioquant, Nashville, TN). 1,25(OH)2D3 treated fxr(-/-) mice showed a 81% decrease in ALT. Concentrations of liver triglyceride from samples of liver cholesterol extraction procedure were measured with a Triglyceride commercial kit (Thermo Scientific, Rockford, IL). Liver triglyceride concentration in fxr(-/-) vehicle control was 2-fold higher than wild-type control.

fxr(+/+) (Batch 4A) fxr(-/-) (Batch 1) Vehicle control 1,25(OH)2D3 (2.5 µg/kg) Vehicle control 1,25(OH)2D3 (2.5 µg/kg) Plasma Calcium (mg/dl) 9.6 ± 0.2 12.5 ± 0.2* 8.1 ± 0.4# 10.0 ± 0.6* Plasma Phosphorus (mg/dl) 19.2 ± 0.9 18.7 ± 0.7 19.8 ± 1.3 17.3 ± 0.8 Plasma ALT (IU/ml) 10.2 ± 0.9 11.4 ± 1.2 173.2 ± 30.0 32.4 ± 4.7* Liver Triglyceride (mg/g) 17.1 ± 4.0 15.7 ± 2.6 48.6 ± 14.1# 36.2 ± 6.0

* denotes P < 0.05 compared to vehicle control using Mann-Whitney U test # indicates P < 0.05 compared to fxr(+/+) control using Mann-Whitney U test

APPENDIX T8

301

APPENDIX T9 Plasma ALT and liver triglyceride levels in C57BL6, fxr(-/-), and shp(-/-) mice fed with a Western diet. Data represented mean ± S.E.M. (n=4-

8). The level of ALT was increased with Western diet in wild-type, but not fxr(-/-) and shp(-/-) mice. Mice treated with 1,25(OH)2D3 had not effect on ALT changes compared to its vehicle control. Liver triglyceride concentrations were increased in mice fed with a Western diet, but showed a decrease in trend when treated with 1,25(OH)2D3. (From Batch 7)

Normal Diet; Vehicle Control Western Diet; Vehicle Control Western Diet; 1,25(OH)2D3 (2.5 µg/kg) Wild-type mice (Batch 7)

ALT (IU/ml) 7.2 ± 1.6 23.5 ± 2.3† 17.2 ± 2.7 Liver Triglyceride (mg/g) 9.7 ± 5.1 28.5 ± 16.6† 17.1 ± 12.1

Plasma Calcium (mg/dl) 9.1 ± 0.1 9.0 ± 0.1 12.8 ± 0.5* Plasma Phosphorus (mg/dl) 17.3 ± 0.9 21.1 ± 1.0† 19.5 ± 0.6

fxr(-/-) mice (Holly samples) ALT (IU/ml) 96.3 ± 9.0 81.4 ± 59.9 89.2 ± 54.3

Liver Triglyceride (mg/g) 19.7 ± 1.0 53.5± 4.4† 31.3 ± 8.9 shp(-/-) mice (Batch 8)

ALT (IU/ml) 12.0 ± 2.0 23.7 ± 4.5 46.2 ± 14.7 Liver Triglyceride (mg/g) 4.2 ± 1.0 35.0 ± 7.7† 13.9 ± 3.5*

† indicates P < 0.05 compared to normal diet vehicle control using Mann-Whitney U test * denotes P < 0.05 compared to Western diet fed vehicle control using Mann-Whitney U test APPENDIX T9

302

APPENDIX F1

APPENDIX F1 Comparsion of human SHP (hSHP) and mouse SHP (mSHP) promoter sequences used in Chapter 5 using BLAST Aligment software (http://blast.ncbi.nlm.nih.gov/). The result shows 78% homology between human and mouse SHP promoter sequences.

Human

Mouse

303

APPENDIX F2

APPENDIX F2 Changes in (A) hepatic apolipoprotein E (ApoE), cholesteryl ester transfer protein (CETP), very low density lipoprotein receptor (VLDLr), low density lipoprotein receptor (LDLr), scavenger receptor class B type 1 (SR-B1), cholesterol efflux transporters (ABCA1, ABCG5, and ABCG8), Cyp8b1, and 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA reductase) and (B) ileal Niemann-Pick C1-Like 1 (NPC1L1), ABCA1, ABCG5, and ABCG8 mRNA expressions in both fxr(+/+) and fxr(-/-) mice. The symbols † and * denote significant differences, using Mann-Whitney U test, between the two controls, and between the treated vs. vehicle control within the wild-type or fxr(-/-) mice, respectively. Data represent the mean ± SEM (n = 4-8).

NPC1L1 ABCA1 ABCG5 ABCG8

Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5

6fxr(+/+) Controlfxr(+/+) 1,25(OH)2D3

fxr(-/-) Controlfxr(-/-) 1,25(OH)2D3

Ileum

ApoE CETP VLDLr LDLr SR-B1 ABCA1 ABCG5 ABCG8 Cyp8b1HMG CoA

Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5

6fxr(+/+) Controlfxr(+/+) 1,25(OH)2D3

fxr(-/-) Controlfxr(-/-) 1,25(OH)2D3

Reductase

Liver

*

†

†

†

(A)

(B)

304

. APPENDIX F3

APPENDIX F3 Changes in hepatic ApoE, CETP, VLDLr, LDLr, SR-B1, ABCA1, ABCG5, ABCG8, Cyp8b1, and HMG-CoA reductase mRNA expressions in wild-type, fxr(-/-) and shp(-/-) mice prefed the Western diet for 3 weeks. The symbols † and * denote significant differences using Mann-Whitney U test between the two controls, and between the treated vs. vehicle control, respectively. Data represent the mean ± SEM (n = 4-8).


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


Wild Type Mouse Liver

Reductase


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


shp(-/-) Mouse Liver

Reductase


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

2

4

6

8

10

12


fxr(-/-) Mouse Liver

Reductase

††

††

††

††

††

†

††

††

†* * **

* *

**

* **

†

Wildtype Mouse Liver

fxr(-/-) Mouse Liver

shp(-/-) Mouse Liver

305

APPENDIX F4

APPENDIX F4 Changes in ileal NPC1L1, ABCA1, ABCG5, and ABCG8 mRNA expressions in wild-type, fxr(-/-) and shp(-/-) mice prefed the Western diet for 3 weeks. The symbols † and * denote significant differences using Mann-Whitney U test between the two controls, and between the treated vs. vehicle control, respectively. Data represent the mean ± SEM (n = 4-8). The results show that the decrease in intestinal ABCA1 may be responsible for the reduction of plasma cholesterol in wild-type and shp(-/-) mice.


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


shp(-/-) Mouse Ileum


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

1

2

3

4

5


Wild Type Mouse Ileum


Rel

ativ

e m

RN

A E

xpre

ssio

n

0

2

4

6

8

10

12


fxr(-/-) Mouse Ileum

†

† †

†

†P=0.05

*

*

Wildtype Mouse Ileum

fxr(-/-) Mouse Ileum

shp(-/-) Mouse Ileum

† *

P=0.05

Chow_Edwin_CY_PhD_thesis.pdf - TSpace

Documents