Analysis of genetic variability, antimicrobial susceptibility and virulence markers in Helicobacter pylori identified in Central Italy.

ORIGINAL ARTICLE

Analysis of genetic variability, antimicrobial susceptibility andvirulence markers in Helicobacter pylori identified in Central Italy

LUIGINA CELLINI1, ROSSELLA GRANDE1, EMANUELA DI CAMPLI1, SORAYA DI

BARTOLOMEO1, SIMONA CAPODICASA2 & LEONARDO MARZIO2

1Department of Biomedical Sciences, and 2Department of Medicine, University ‘‘G. d’Annunzio’’, Chieti, Italy

AbstractObjective. To assess the relationship between the presence of mixed infection of Helicobacter pylori and both antimicrobialsusceptibility and virulence markers. Material and methods. Thirty-six patients with H. pylori infection were included inthe study. Three colonies were selected from each positive biopsy sample collected from each host for a total of 108H. pyloristrains. The genetic variability was evaluated through the amplified fragment length polymorphism (AFLP) analysis; theantibiotic susceptibility to amoxicillin, clarithromycin, moxifloxacin, rifabutin and tinidazole was determined using theminimum inhibitory concentrations (MICs) with the agar dilution method. Moreover, the vacA, cagA, iceA and babA2status were detected by polymerase chain reaction (PCR). Results. There was a strong connection between mixedH. pylori infection and antimicrobial resistance. In particular, H. pylori strains with genetic variability, in the same host,expressed more resistance to clarithromycin, moxifloxacin and tinidazole than that expressed in strains with a unique genetichost pattern. VacA s1m1/s1m2 genotypes were found in 70% of strains isolated in mixed infection, whereas the same alleliccombinations were found in 42% of strains, isolated in single infection. The cagA status prevailed both in patients withmixed (97%) and in those with single infection (85%) without significant differences. The iceA1 status was more commonlyfound in patients with mixed infection, whereas the babA2 status was significantly prevalent in single H. pyloriinfection. Conclusions. Mixed H. pylori infection harbouring in one patient is significantly related to strains that aremore resistant to antibiotics and with a more virulent genotype (vacA s1m1/s1m2, cagA, iceA1) than strains responsible forsingle infection.

Key Words: AFLP analysis, antimicrobial agents, Helicobacter pylori, mixed and single infections, virulence markers

Introduction

Helicobacter pylori (H. pylori) is a Gram-negative

bacterium that colonizes the human stomach early in

life, although the related pathology may be expressed

later. Both the spiral-shaped bacterium and the

coccoid form persisting within the gastric mucus

layer can cause significant alterations of the gastric

mucosa. Half of all people world-wide are carriers of

this microorganism but disease occurs in only about

15%, with development of gastritis, peptic ulcer,

gastric adenocarcinoma (the fourth most common

malignancy in the world) and mucosa-associated

lymphoid tissue (MALT) lymphoma [1 /4].

Genetic diversity among strains of H. pylori is

more relevant than for other bacterial species and it

is virtually impossible to find two identical DNA

patterns in microorganisms isolated from different

hosts [5,6]. Moreover, one individual can harbour

either more than one isolate or a micro-evolutionary

change among strains originating from a unique

microorganism. This scenario may offer a condition

for a more efficacious bacterium /host association

during long-term colonization [6 /9]. Several viru-

lence factors contribute to the pathogenicity of

H. pylori [10 /12].

VacA encodes a vacuolating toxin that causes

target cell degeneration by interfering with intracel-

lular membrane fusion [13]. Mosaicism in vacA

alleles is expressed by two families of allelic variation

of the signal sequence region (s1, s2) and of the mid-

region (m1, m2) [14]. The mosaic combination of s

Correspondence: Luigina Cellini, Department of Biomedical Sciences, University ‘‘G. d’Annunzio’’, Via dei Vestini, 31, IT-66100 Chieti, Italy. Tel: /39 0871

3555 289. Fax: /39 0871 3555 282. E-mail: [email protected]

Scandinavian Journal of Gastroenterology, 2006; 41: 280 /287

(Received 17 March 2005; accepted 14 June 2005)

ISSN 0036-5521 print/ISSN 1502-7708 online # 2006 Taylor & Francis

DOI: 10.1080/00365520510024223

and m allelic types is related to the production of

vacuolating cytotoxin. Type s1m1 and type s1m2

strains produce a large and moderate level of toxin,

respectively, while type s2m2 strains produce little or

no toxins [14].

The CagA, which is the marker for the presence of

the pathogenicity island (Cag PAI) [15], is the most

studied putative virulence factor. The cagA gene is

detected from biopsies of patient with peptic ulcer

disease and chronic gastritis [16].

The iceA gene (induced by contact with the

epithelium), has two main allelic variants, iceA1

and iceA2 [17]. Carriage of iceA1 strains is fre-

quently associated with the presence of peptic ulcer

and it increases the production of IL-8 [18,19],

whereas iceA2 strains are more commonly associated

with patients with non-ulcer dyspepsia.

babA and babB genes encode a protein able to

blind the human blood group antigen Lewis b (Leb)

to human gastric epithelial cells [20]. Furthermore,

the chemical structure of LPS of some strains of

H. pylori mimic Lewis x and Lewis y blood group

antigens expressed in the gastric mucosa; this could

down-regulate the immune response in patients with

acute and chronic infections [20]. Although three

bab alleles were identified (babA1, babA2, babB),

the protein which encodes the babA2 gene is a

determinant for the Leb binding activity [21].

Many studies have been carried out to find a

relationship among some virulence markers and

diseases, and have produced different results that

are also related to the investigated geographic areas

[9,22 /24].

The aim of this study was to analyse the genoty-

pical variations, the susceptibility to antimicrobial

agents and the virulence markers of H. pylori strains

isolated from individuals from Central Italy. In

particular, the DNA plasticity, studied through

amplified fragment length polymorphism (AFLP)

analysis among strains isolated from the same host,

was compared with both antibiotics susceptibility

such as amoxicillin, clarithromycin, moxifloxacin,

rifabutin and tinidazole and the virulence factors

vacA, cagA, iceA1, iceA2 and babA2. Finally, the

antimicrobial susceptibility was also paralleled with

the virulence markers.

Overall, this paper furnishes data to confirm that

in mixed H. pylori infection, cohabition exists among

more resistant and more virulent strains.

Material and methods

Patients and H. pylori strains

A total of 36 H. pylori-positive patients living in

Central Italy (12 M, 24 F, aged 30 /71 years) with

dyspeptic symptoms were included in this study.

These patients were identified among a group of

113 subjects submitted to upper gastrointestinal

endoscopy in which two biopsies from the antrum

were taken, one for rapid urease test (CP test) and

the other for H. pylori culture. The CP test had to

be positive within 30 min; bacterial cultures were

performed only when the CP test gave positive

results. Exclusion criteria were: age B/18 or /90

years, gastrointestinal malignancy, use of proton-

pump inhibitors (PPIs) within the previous 4 weeks

and severe concomitant diseases, a history of

allergy to any of the substances used in the study,

previous gastric surgery, pregnancy or lactation,

alcohol abuse, drug addiction, chronic use of

corticosteroids or non-steroidal anti-inflammatory

drugs.

Patients gave their written informed consent to

participate in the study, which was approved by the

Ethics Committee of the ‘‘G. d’Annunzio’’ Univer-

sity, Chieti, Italy.

Endoscopic diagnoses were as follows: 13 patients

had gastro-oesophageal reflux diseases (GORD);

13 patients had non-ulcer dyspepsia (NUD) while

10 patients had peptic ulcer diseases (PUD). GORD

was defined as the presence of predominant symp-

toms of reflux, e.g. heartburn, acid regurgitation

and/or the presence of any length of mucosal break

in the oesophagus due to gastro-oesophageal reflux.

NUD was defined as patients with no history of

GORD or endoscopic evidence of organic patholo-

gies. PUD refers to patients who were either

diagnosed upon endoscopy as suffering from gastric

ulcers (ulcers at the corpus) or duodenal ulcers

(ulcers at the antrum).

Stomach samples were collected in Portagerm-

Pylori (Bio-Merieux, Marcy L’Etoile, France) and

processed microbiologically within 24 h. Biopsies

were trimmed with a razor, homogenized and

cultured on Chocolate agar plus 1% IsoVitaleX

(CA, Becton Dickinson & Co., Cockeisville, Md.,

USA) and Campylobacter selective medium (CP,

Unipath Ltd., Basingstoke, UK). Plates were in-

cubated in a microaerophilic atmosphere at 378Cfor 5 /7 days. H. pylori colonies were identified on

the basis of their colony morphology, Gram staining

and positive reaction with urease, catalase and

oxidase. Three colonies from each positive sample

were picked up randomly from the primary culture,

transferred to CA and incubated in a microaero-

philic atmosphere for 3 days at 378C. Isolated

clones were collected and stored at /808C until

needed, using the Drumm & Sherman method

[25]. A total of 108 H. pylori strains were examined

for the study.

Variability, susceptibility and virulence in H. pylori 281

Antibiotic susceptibility tests

Standard laboratory powders were supplied as fol-

lows: amoxicillin (Sigma, Milan, Italy), clarithromy-

cin (Abbott Laboratories, North Chicago, Ill.,

USA), moxifloxacin (FLUKA-Biochemika, Buchs,

Switzerland), rifabutin (Pharmacia & Upjohn, Ascoli

Piceno, Italy), and tinidazole (Sigma). Powders were

reconstituted following the manufacturer’s instruc-

tions. Minimum inhibitory concentrations (MICs)

were evaluated by the standard agar dilution method

according to the National Committee for Clinical

Laboratory Standards (NCCLS) [26] guidelines,

using Mueller-Hinton agar (Oxoid) with 7% of

defibrinated horse blood. Two-fold dilutions of the

antibiotics were added in order to obtain the

following final concentrations: from 4 to 0.03 mg/ml

for amoxicillin, from 8 to 0.06 mg/ml for clarithro-

mycin, from 64 to 0.5 mg/ml for moxifloxacin and

tinidazole and from 0.5 to 0.003 mg/ml for rifabutin.

Each dilution was incorporated in appropriate

melted agar medium ad poured into a Petri dish.

Agar plates were inoculated using a Steers replicator

delivering a bacterial suspension of approximately of

5 /104 colony-forming units (cfu)/spot. Test plates

were incubated for 5 /7 days at 378C under micro-

aerophilic conditions. MIC was defined as the lowest

concentration of the antibiotics inhibiting the visible

growth. Bacteria were considered resistant when the

MIC was greater than 0.5 mg/ml for amoxicillin,

1 mg/ml for clarithromycin, 5 mg/ml for moxifloxacin

and tinidazole and 0.05 mg/ml for rifabutin [27 /30].

The reference strain H. pylori ATCC 43629 was

inserted in the experiments as control. All tests were

performed in duplicate.

Amplified fragment length polymorphism

The chromosomal DNA was extracted from each

isolated colony using Qiamp Tissue DNA isolation

minikit (QIAGEN S.p.A., Milan, Italy). The AFLP

fingerprintings of H. pylori strains were generated by

HindIII-AFLP (HindIII digestion and AFLP analy-

sis) following the methodology reported by Gibson

et al. [31].

Briefly, an aliquot containing 1 mg DNA was

digested overnight (16 h) at 378C with 24 U HindIII

(Roche Diagnostic, Milan, Italy) according to the

manufacturer’s instructions. A 10 ml aliquot of

digested DNA was used in a ligation reaction

containing a final volume of 20 ml: 0.2 mg of each

of the adapter oligonucleotides (ADH1 and ADH2),

1 U of T4 DNA ligase (Roche) and single-strength

ligase buffer. The reaction was performed at 378Cfor 3.5 h. The ligated DNA sample was heated

to 808C for 10 min to stop the T4 enzyme activity

and then diluted (1/4) in distilled water. HindIII

restriction fragments tagged with the specific adap-

tors ADH1 and ADH2 were used as template DNA

for selective polymerase chain reaction (PCR) am-

plification. Adapter ologonucleotides ADH1 and

ADH2 and the specific primers ADH2 and HI-A

are listed in Table I.

Amplification reaction was performed in a 2700

Thermocycler (PE-Applied Biosystems, Foster City,

Calif., USA) in 50 ml of total volume containing 5 mlof template DNA, 20 mM of each dNTP, 20 mM of

each primer, 1 U of AmpliTaq DNA polymerase

(Applera Italia, Milan, Italy) and 2.5 mM of MgCl2in standard PCR buffer.

The amplification consisted of 4 min at 948C and

then 33 cycles of 1 min at 948C, 1 min at 608C and

2.5 min at 728C. Amplified DNA products were

separated by electrophoresis in 2% (w/v) agarose gel

at 30 V for 18 h.

Gels were stained with ethidium bromide and

photographed. The AFLP-PCR fingerprintings of

the H. pylori strains were analysed with Gel Compar

Software, Windows version 4.1 (Applied Math,

Kortrijk, Belgium) [32]. AFLP patterns were nor-

malized using the 0.1-kbp standard molecular size.

The similarity coefficient indicates the relationship

of the strains and was calculated using band posi-

tions (coefficient of Jaccard) per the Gel Compar

program. Briefly, for each couple of tracks, the

coefficient of Jaccard [S1] divides the number of

corresponding bands by the total number of bands in

both tracks using the formula S1 /nAB /[(nA /

nB) /nAB], where nAB is the number of bands

common for A and B , nA is the total number of

bands in A , and nB is the total number of bands in B

[32]. A similarity coefficient of B/70% was consid-

ered significant for mixed infection.

Virulence factors genotyping

PCR reactions were performed in a 2700 Thermo-

cycler (PE-Applied Biosystems) with oligonucleotide

primers listed in Table I in a total volume of 25 mlcontaining 2.5 ml of 10 /PCR buffer, 1.5 mM

MgCl2, 200 mM (each) deoxinucleotide tripho-

sphates (dNTPs), 2 U of Amplitaq DNA polymer-

ase, 20 mM of each primer and 50 ng of H. pylori

DNA.

After 5 min of denaturation, each reaction was

amplified for 35 cycles as follows: 30 s at 948C,

1 min of annealing at 558C and 1 min and 30 s of

extension at 728C (for the analysis of vacAs/m

regions, iceA1, iceA2 and babA2 genes); 1 min at

948C, 1 min at 558C and 1 min at 728C for the cagA

gene.

After the last cycle, the extension was continued

for 5 min. For the analysis of the vacA/s region,

282 L. Cellini et al.

primers VA1-F, VA1-R that yielded a fragment of

259 bp for the s1 variant and a fragment of 286 bp

for the s2 variant were used [33]. For analysis of the

vacA/m region, primers VAG-F and VAG-R which

yielded a fragment of 567 bp for m1 variants and a

fragment of 642 bp m2 variant were used [33]. For

the analysis of the cagA region, primers D008 and

R008 which yielded a fragment of 298 bp were used

[34]. For analysis of the iceA genotype, primers

iceA1-F, iceA1-R /M.Hpy1-R, iceA2-F /CysS-F

iceA2-R which yielded a fragment of 600 bp and of

700 bp, respectively, were used [18]. For the analysis

of the babA2 genotype, primers babA2-F /sense,

babA2-R /antisense which yielded a fragment of

700 /800 bp were used [35]. Each oligonucleotide

sequence used in this work was synthesized by

Primm, (Milan, Italy).

The PCR products were examined by electro-

phoresis in 2% (w/v) agarose gel at 100 V for 30 min.

Gels were stained with ethidium bromide and

photographed.

Statistical analysis

The association between H. pylori mixed or single

infections with both antibiotic resistance and viru-

lence markers was evaluated using either the x2 test

with Yates’s continuity correction or Fisher’s exact

test, as appropriate. Probability levels of B/0.05 were

considered statistically significant.

Results

The analysis of the DNA fingerprintings obtained

through the AFLP technique confirmed the total

heterogeneity among sets of strains isolated from

different individuals. In fact, there were no cases

where identical patterns were observed in sets of

isolates from two different hosts. Repeated AFLP

analysis (three different assays on different days)

showed that the fingerprintings were stable and

reproducible (not shown). Among the 36 analysed

patients, 10 (27.7%) of them had H. pylori colonies

with different DNA patterns. In all these cases the

three colonies were different from each other by a

similarity coefficient B/70%. This value was ob-

tained through the analysis of the AFLP fingerprint-

ings with Gel Compar Software. Representative

AFLP profiles of patients with mixed infection are

shown in Figure 1a in which the same host (patients

36, 62, 63) is colonized by strains with different

fingerprintings (lines 1-2-3). Figure 1b shows repre-

sentative patterns of equal strains harbouring in the

same individual (patients 4, 71, 81).

Regarding the H. pylori resistance to antimicro-

bials, our data show a high presence of resistant

strains. Among the 108 analysed strains, only 36

were colonized by H. pylori cells which were totally

susceptible to drugs tested in the study. In addition,

these susceptible strains were prevalent (33/36) in

single infection (Table II). In 90% of mixed infec-

tion, patients were colonized by resistant strains,

whereas in cases of single infection, resistant strains

were present in 58% of cases.

Regarding the susceptibility towards each antibio-

tic tested in this study (Table III), when different

bacteria were isolated in the host, they showed a

resistance to clarithromycin and tinidazole (80%)

that was higher than that of bacteria in single

infection (48% and 35%; pB/0.001). In particular,

in 3 patients with mixed infection, both susceptible

and resistant strains to clarithromycin were isolated

(not shown).

Table I. Oligonucleotides used for PCR-based typing.

Primer designation Gene Sequence (5? /3?) Reference

VA1-F vacA s1/s2 ATGGAAATACAACAAACACAC

VA1-R CTGCTTGAATGCGCCAAAC 33

VAG-F vacA m1/m2 CAATCTGTCCAATCAAGCGAG

VAG-R GCGTCAAAATAATTCCAAGG 33

D008 cagA TTAGAATAATCAACAAACATCACGCCAT

R008 ATAATGCTAAATTAGACAACTTGAGCGA 34

iceA1-F iceA1 TATTTCTGGAACTTGCGCAACCTGAT

M.Hpy1-R GGCCTACAACCGCATGGATAT 18

CysS-F iceA2 CGGCTGTAGGCACTAAAGCTA

iceA2-R TCAATCCTATGTGAAACAATGATCGTT 18

babA2sense babA2 AATCCAAAAAGGAGAAAAAGTATGAAA

babA2antisense TGTTAGTGATTTCGGTGTAGGACA 35

ADH1* ACGGTATGCGACAG

ADH2* AGCTCTGTCGCATACCGTGAG

HI-A GGTATGCGACAGAGCTTA 31

Abbreviation: PCR /polymerase chain reaction.

*Oligonucleotides used as adapters for ligation reaction in the AFLP method.


Against moxifloxacin, H. pylori strains isolated in

mixed infections expressed a significantly higher

percentage of resistance (20%) in comparison with

strains with similar fingerprintings in one patient

(6%, pB/0.05).

Finally, the very low increase of amoxicillin and

rifabutin resistance in mixed infection strains (10%)

compared with single infection strains (4%) was not

significant (p /0.05). In particular, amoxicillin was

ineffective against six H. pylori strains isolated from

2 patients with single and mixed infection, respec-

tively. For strains isolated in single infection, the

detected MIC value was 1 mg/ml, whereas in mixed

infection MIC values were 2 mg/ml for one strain and

one step lower for the other two strains.

Significant differences were also recorded when

H. pylori strains isolated in patients with mixed and

single infections were studied for their virulence

factors (Table IV). Among H. pylori strains isolated

in mixed infection, 21 (70%) of them displayed vacA

s1m1/s1m2 genotypes and 9 (30%) of them showed

vacA s2m2 genotype, whereas 33 (42%) H. pylori

strains in single infection had the s1m1/s1m2 geno-

type and 45 (58%) displayed the non-toxin-produ-

cing vacA s2m2 genotype. Among the 108 H. pylori

analysed, there was a significant association between

the vacA s1m1/s1m2 genotypes and mixed infection

(pB/0.01).

The cagA status was recorded in 29 (97%) to 30

strains in mixed infection and in 66 (85%) of the 78

strains showing equal fingerprintings in the same

individual. There was no significant difference

(p /0.05) among the presence of cagA microor-

ganisms in the single and mixed infections.

The iceA allelic types (iceA1 and iceA2) displayed

a total presence of strains iceA1 (100%) in mixed

infection without the iceA2 (0%) allele, whereas

single infection had the iceA1 and iceA2 alleles in

74% and 26% of cases, respectively. The distribution

of iceA1 and iceA2 alleles among strains causing

mixed and single infection showed significant differ-

ences (PB/0.01).

Concerning the babA2 genotype, there was a

significant prevalence of this condition in isolates in

single infection (31/78, 40%) in comparison with

isolates in mixed infection (5/30, 17%; pB/0.025).

When the 108 H. pylori strains analysed were

compared for their susceptibility to antibiotics and

the presence of the virulence markers (Table V), no

correlation was observed among the vacA, cagA,

iceA1/iceA2 and babA2 status and the susceptibility

Figure 1. Representative amplified fragment length polymorphism (AFLP) profiles of Helicobacter pylori isolates from 36 biopsy specimens

obtained from (a) patients (36, 62, 63) with mixed infection and (b) patients (4, 71, 81) with single infection. For each biopsy, 3 colonies

(lanes 1-2-3) were collected to compare the fingerprintings. DNA size standards (0.1 Kbp marker) are in the lanes marked ‘‘M’’.

Table II. Association between mixed and single Helicobacter pylori

infections and antimicrobial agents susceptibility.

Helicobacter pylori infection Susceptibility (%) Resistance* (%)

Multiple 3 (10) 27 (90)

Single 33 (42) 45 (58)

*Referred to strains which showed at least one resistance to

antimicrobial agents tested.

Table III. Association between Helicobacter pylori strains isolated

in patients with mixed and single infections and antimicrobial

agent susceptibility.

Mixed infection Single infection

Antimicrobial agents S* (%) R** (%) S (%) R (%)

Amoxicillin 27 (90) 3 (10) 75 (96) 3 (4)

Clarithromycin 6 (20) 24 (80) 48 (62) 30 (48)

Moxifloxacin 24 (80) 6 (20) 73 (94) 5 (6)

Rifabutin 27 (90) 3 (10) 75 (96) 3 (4)

Tinidazole 6 (20) 24 (80) 51 (65) 27 (35)

S* /susceptible strains; R** /resistant strains.


or resistance of at least one antibiotic tested in this

work (P /0.05).

Conclusions

This work is aimed at finding significant differences

between strains with or without genetic variability in

the same host, and susceptibility of antimicrobial

agents and virulence markers.

The high degree of genomic diversity among

H. pylori strains in one individual, which can be

due to mechanisms such as free recombination [36]

or co-infection with mixed H . pylori strains [6,37],

has been confirmed in this study through the AFLP

analysis. Among the analysed strains, this technique

displayed reproducible and discriminatory patterns.

In particular, among the 36 patients, the DNA

fingerprintings were different from each other and

these results are consistent with those of other

investigators [5,38] who asserted that polymorphism

has spread globally during the long evolutionary

history of H . pylori and has led to unprecedented

allelic diversity [9].

Moreover, significant differences among H . pylori

DNA patterns in a single host were also detected,

emphasizing the ability of the microorganism to

develop conditions for a more efficient colonization;

mixed infections were found in 27.7% of the cases

analysed. Various studies reported on the coexis-

tence of different strains of H . pylori in the same

patient detected by different methods [17,36,39,40].

In particular, Van Doorn et al. [17] identified mixed

infection of H. pylori in 20.2% of the cases analysed,

using a rapid and efficient method directly from

gastric biopsies based on the detection of mixed

vacA and/or iceA genotypes. In this work, we found

mixed infection in the same individual which in some

cases showed identical virulence marker profiles.

Therefore, the prevalence of mixed infection, as

reported earlier, could be underestimated. In our

opinion, the AFLP method represents a valid

technique for detection of mixed H. pylori infection.

Moreover, in our study, mixed infection was inde-

pendent of age and gender (not shown) which

suggests that relevant polymorphisms in one host

are not associated with the duration of H . pylori

infection.

When mixed or single colonization was compared

with antimicrobial susceptibility, the presence of

more resistant strains was consistent with the co-

infection. In fact, in mixed infection there is a

significant higher presence of resistant microorgan-

isms in respect of single H. pylori infections. The

presence in 90% of strains in mixed infections with

at least one resistance to the antimicrobial agents

tested emphasizes the need for more accurate studies

based on new strategies in H . pylori eradication

therapy. On the other hand, H . pylori resistance to

antimicrobials is the biggest cause of failure in

eradication therapy. In our study, in some cases of

mixed infection, H . pylori cells were found to be

either susceptible or resistant to clarithromycin in

the same host, which suggests the need to perform

an antimicrobial susceptibility test of at least two

different H . pylori colonies. This H . pylori hetero-

resistance has also been demonstrated by taking two

biopsies from two different sites in patients with

secondary resistance in previous studies [29,41]. All

these data emphasize the need for a careful H . pylori

antimicrobial surveillance to improve management

of H . pylori infection.

In particular, in this study, we found clarithromy-

cin and tinidazole resistance values, in different co-

infectant strains, that were higher than those of

single infection. These data confirm the ability of

these strains to better adapt themselves to the host

and highlight the worrying problem of clarithromy-

cin resistance found in our geographic area [29].

In this study, we found a significant relationship

when mixed and single infections were compared

with the main virulence factors, with the exception of

Table V. Association between Helicobacter pylori strains suscept-

ibility and virulence markers.

Genotype Susceptibility (%) Resistance* (%)

vacA s1m1/s1m2 15 (28) 39 (72)

vacA s2m2 21 (40) 33 (60)

cagA / 32 (34) 4 (66)

cagA / 4 (30) 8 (70)

iceA1 / 32 (35) 61 (65)

iceA1 / 4 (25) 11 (75)

iceA2 / 7 (29) 18 (71)

iceA2 / 29 (35) 54 (65)

babA2 / 12 (31) 26 (69)

babA2 / 24 (34) 46 (66)

*Referred to strains which showed at least one resistance to

antimicrobial agents tested.

Table IV. Association between Helicobacter pylori strains isolated

in patients with mixed and single infections and virulence markers.

Genotype

Mixed infection

isolates (%)

Single infection

isolates (%)

vacA s1m1/s1m2 21 (70) 33 (42)

vacA s2m2 9 (30) 45 (58)

cagA / 29 (97) 66 (85)

cagA / 1 (3) 12 (15)

iceA1 / 30 (100) 58 (74)

iceA1 / 0 (0) 20 (26)

iceA2 / 0 (0) 20 (26)

iceA2 / 30 (100) 58 (74)

babA2 / 5 (17) 31 (40)

babA2 / 25 (83) 47 (60)


the cagA gene. Therefore, co-infected hosts har-

boured strains that were characterized by genotypes

which encode proteins able to display the most

relevant damage.

However, the combination of vacA, cagA, iceA

status was not always helpful in predicting the

clinical state of patients [19,42] with controversial

reports on the presence of virulence markers and

clinical outcome [13,17,19,42]. This suggests that

other factors must play a role in disease pathogen-

esis. In fact, the interaction between bacterium /host

involves complex mechanisms that can balance or

emphasize the effect of virulence factors together

with environmental and dietary factors.

Our study presents a new scenario in which co-

infected hosts are colonized by H . pylori strains that

are more difficult to eradicate, and are more virulent.

Acknowledgements

We thank Professor Ray Pizzuto for help with editing

the manuscript. This study was supported by a grant

awarded by the Ministero Istruzione, Universita e

Ricerca, Rome, Italy.

References

[1] Cover TL, Berg DE, Blaser MJ. H. pylori pathogenesis. In:

Groisman EA, editor. Principles of bacterial pathogenesis.

New York NY: Academic Press; 2001. pp 509 /58.

[2] Frenck RW Jr, Clemens J. Helicobacter in the developing

world. Microbes Infect 2003;/5:/705 /13.

[3] Mobley HLT, Mendez GL, Hazell SL. Helicobacter pylori :

physiology and genetics. Washington DC: ASM Press; 2001.

[4] Suerbaum S, Michetti P. Helicobacter pylori infection. N Engl

J Med 2002;/347:/1175 /86.

[5] Suerbaum S. Genetic variability within Helicobacter pylori .

Int J Med Microbiol 2000;/290:/175 /81.

[6] Cellini L, Di Campli E, Di Candia M, Marzio L. Molecular

fingerprinting of Helicobacter pylori strains from duodenal

ulcer patients. Lett Appl Microbiol 2003;/36:/222 /6.

[7] Jorgensen M, Daskalopoulos G, Waburton V, Mitchell HM,

Hazell SL. Mixed strain colonization and metronidazole

resistence in Helicobacter pylori -infected patients: identifica-

tion from sequential and mixed biopsy specimens. J Infect

Dis 1996;/174: /631 /5.

[8] Kersulyte D, Mukhopadhyay AK, Velapatino B, Su W, Pan

Z, Garcia C, et al. Differences in genotypes of Helicobacter

pylori from different human populations. J Bacteriol 2000;/

182:/3210 /8.

[9] Wong BC, Wang WH, Berg DE, Fung FM, Wong KW, Wong

WM, Lai KC, et al. High prevalence of mixed infections by

Helicobacter pylori in Hong Kong: metronidazole sensitivity

and overall genotype. Aliment Pharmacol Ther 2001;/15:/

493 /503.

[10] Cellini L, Donelli G. Virulence factors of Helicobacter pylori .

Microb Ecol Health Dis 2000;/Suppl 2:/259 /62.

[11] Datta S, Chattopadhyay S, Balakrish Nair G, Mukhopad-

hyay AK, Hembram J, Berg DE, et al. Virulence genes and

neutral DNA markers of Helicobacter pylori isolates from

different ethnic communities of West Bengal, India. J Clin

Microbiol 2003;/41:/3737 /43.

[12] Lehours P, Menard A, Dupouy S, Bergey B, Richy F, Zerbib

F, et al. Evaluation of the association of nine Helicobacter

pylori virulence factors with strains involved in low-grade

gastric mucosa-associated lymphoid tissue lymphoma. Infec

Immun 2004;/72:/880 /8.

[13] Atherton JC, Peek RM Jr, Tham KT, Cover TL, Blaser MJ.

Clinical and pathological importance of heterogeneity in

vacA, the vacuolating cytotoxin gene of Helicobacter pylori .

Gastroenterology 1997;/112:/92 /9.

[14] Atherton JC, Cao P, Peek RM Jr, Tummuru MK, Blaser MJ,

Cover TL, et al. Mosaicism in vacuolating cytotoxin alleles

of Helicobacter pylori . Association of specific vacA types with

cytotoxin production and peptic ulceration. J Biol Chem

1995;/270:/17771 /7.

[15] Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D,

Macchia G, et al. Molecular characterization of the 128-kDa

immunodominant antigen of Helicobacter pylori associated

with cytotoxicity and duodenal ulcer. PNAS USA 1993;/90:/

5791 /5.

[16] Awakawa T, Sugiyama T, Hisano K, Karita M, Yachi A.

Detection and identification of cagA of Helicobacter pylori by

polymerase chain reaction. Eur J Gastroenterol Hepatol

1995;/Suppl 1:/S75 /8.

[17] van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schnee-

berger P, de Boer W, et al. Clinical relevance of the cagA,

vacA, and iceA status of Helicobacter pylori . Gastroenterol-

ogy 1998;/115:/58 /66.

[18] Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S, Ito Y,

Chowdhury A, et al. Distinctiveness of genotypes of Helico-

bacter pylori in Calcutta, India. J Bacteriol 2000;/182:/3219 /

27.

[19] Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K,

Graham DY, et al. Relationship between Helicobacter pylori

iceA, cagA, and vacA status and clinical outcome: studies in

four different countries. J Clin Microbiol 1999;/37:/2274 /9.

[20] Ilver D, Arnqvist A, Ogren J, Frick IM, Kersulyte D, Incecik

ET, et al. Helicobacter pylori adhesin binding fucosylated

histo-blood group antigens revealed by retagging. Science

1998;/279:/373 /7.

[21] Appelmelk BJ, Negrini R, Moran AP, Kuipers EJ. Molecular

mimicry between Helicobacter pylori and the host. Trends

Microbiol 1997;/5: /70 /3.

[22] Kidd M, Atherton JC, Lastovica AJ, Louw JA. Clustering of

South African Helicobacter pylori isolates from peptic ulcer

disease patients is demonstrated by repetitive extragenic

palindromic-PCR fingerprinting. J Clin Microbiol 2001;/39:/

1833 /9.

[23] Kidd M, Lastovica AJ, Atherton JC, Louw JA. Heterogeneity

in the Helicobacter pylori vacA and cagA genes: association

with gastroduodenal disease in South Africa? Gut 1999;/45:/

499 /502.

[24] Kidd M, Lastovica AJ, Atherton JC. Specific genotypes of

Helicobacter pylori vacA and cagA, but not presence of cagA,

are associated with gastroduodenal disease in South Africa.

Gastroenterology 1999;/116:/G0928.

[25] Drumm B, Sherman P. Long-term storage of Campylobacter

pylori . J Clin Microbiol 1989;/27:/1655 /6.

[26] National Committee for Clinical Laboratory Standards.

Methods for dilution antimicrobial susceptibility tests for

bacteria that grow aerobically. Approved standard M7-A5.

National Committee for Clinical Laboratory Standards,

Villanova, Pa: 2000.

[27] Andrews JM, Ashby JP, Jevons GM, Wise R. Tentative

minimum inhibitory concentration and zone diameter break-

points for moxifloxacin using BSAC criteria. J Antimicrob

Chemother 1999 Dec;/44:/819 /22.


[28] Aydemir S, Boyacioglu S, Gur G, Demirbilek M, Can FK,

Korkmaz M, et al. Helicobacter pylori infection in hemodia-

lysis patients: susceptibility to amoxicillin and clarithromy-

cin. World J Gastroenterol 2005;/11:/842 /5.

[29] Toracchio S, Capodicasa S, Soraja DB, Cellini L, Marzio L.

Rifabutin based triple therapy for eradication of H. pylori

primary and secondary resistant to tinidazole and clarithro-

mycin. Dig Liver Dis 2005;/37:/33 /8.

[30] Toracchio S, Cellini L, Di Campli E, Cappello G, Malatesta

MG, Ferri A, et al. Role of antimicrobial susceptibility

testing on efficacy of triple therapy in Helicobacter pylori

eradication. Aliment Pharmacol Ther 2000;/14:/1639 /43.

[31] Gibson JR, Slater E, Xerry J, Tompkins DS, Owen RJ. Use

of an amplified-fragment length polymorphism technique to

fingerprint and differentiate isolates of Helicobacter pylori . J

Clin Microbiol 1998;/36:/2580 /5.

[32] Gerner-Smidt P, Graves LM, Hunter S, Swaminathan B.

Computerized analysis of restriction fragment length poly-

morphism patterns: comparative evaluation of two commer-

cial software packages. J Clin Microbiol 1998;/36:/1318 /23.

[33] Chisholm SA, Teare EL, Patel B, Owen RJ. Determination

of Helicobacter pylori vacA allelic types by single-step mixed

PCR. Lett Appl Microbiol 2002;/35:/42 /6.

[34] Covacci A, Rappuoli R. PCR amplification of gene se-

quences Helicobacter pylori : techniques for clinical diagnosis

and basic research. In: Lee A, Megraud F, editors. PCR

amplification of gene sequences from H. pylori strains.

London: WB Saunders; 1996. pp 94 /109.

[35] Gerhard M, Lehn N, Neumayer N, Boren T, Rad R, Schepp

W, et al. Clinical relevance of the Helicobacter pylori gene for

blood-group antigen-binding adhesin. Proc Natl Acad Sci

USA 1999;/96:/12778 /83.

[36] Suerbaum S, Smith JM, Bapumia K, Morelli G, Smith NH,

Kunstmann E, et al. Free recombination within Helicobacter

pylori . Proc Natl Acad Sci USA 1998;/95:/12619 /24.

[37] Prewett EJ, Bickley J, Owen RJ, et al. DNA patterns of

Helicobacter pylori isolated from gastric antrum, body, and

duodenum. Gastroenterology 1992;/102:/829 /33.

[38] Owen RJ, Ferrus M, Gibson J. Amplified fragment length

polymorphism genotyping of metronidazole-resistant Helico-

bacter pylori infecting dyspeptics in England. Clin Microbiol

Infect 2001;/7:/244 /53.

[39] Owen RJ, Bickley J, Hurtado A, Fraser A, Pounder RE.

Comparison of PCR-based restriction length polymorphism

analysis of urease genes with rRNA gene profiling for

monitoring Helicobacter pylori infections in patients on triple

therapy. J Clin Microbiol 1994;/32:/1203 /10.

[40] Owen RJ, Desai M, Figura N, Bayeli PF, Di Gregorio L,

Russi M, et al. Comparisons between degree of histological

gastritis and DNA fingerprints, cytotoxicity and adhesivity of

Helicobacter pylori from different gastric sites. Eur J Epide-

miol 1993;/9:/315 /21.

[41] Kim JJ, Kim JG, Kwon DH. Mixed-infection of antibiotic

susceptible and resistantHelicobacter pylori isolates in a single

patient and underestimation of antimicrobial susceptibility

testing. Helicobacter 2003;/8:/202 /6.

[42] Ho YW, Ho KY, Ascencio F. Neither gastric topological

distribution nor principle virulence genes of Helicobacter

pylori contributes to clinical outcomes. World J Gastroen-

terol 2004;/10:/3274 /7.


Analysis of genetic variability, antimicrobial susceptibility and virulence markers in Helicobacter pylori identified in Central Italy.

Documents