Slide 1Update On Avian Influenza Wallace Greene, PhD, ABMM Director, Diagnostic Virology Laboratory Department of Pathology M. S. Hershey Medical Center Hershey, Pennsylvania…

1.I’ve got the Big Data Blues C. Titus Brown [email protected] Microbiology, Computer Science, and BEACON 2. Outline 1. Genetics 101 and 102 - what you need to know. 2. Marek’s…

1.• You are going to be given a set of cards with the following theories on them.Your task is to arrange the theories in order of the most likely cause for the extinction…

1. Dr. Saleem Akhtar Rana Dr. Mahboob Ashraf Dr. Arshad Javaid Sh 2. KEY FACTS  A mosquito-borne infection : No mosquito = no infection  A severe flu-like illness …

1. V Reconstructing the social network of viruses in wild ducks Eric J. Ma, Runstadler Lab BATS 2013 !1 2. Outline What’s the deal with influenza viruses…

Virulence Factor-Based Drug Discovery A Novel Approach for Identifying Drug Targets for Autoimmune and Inflammatory Diseases David Bienvenue, Ph.D. VLST Corporation Viral…

1. Expression and Purification of Virulence Factors A Novel Approach for Identifying Drug Targets for Autoimmune and Inflammatory Diseases David Bienvenue, Ph.D. VLST Corporation…

Slide 1 Rabies Nahed Abdel-Haq, M.D Division of infectious Diseases Children’s Hospital of Michigan Slide 2 Rabies Virus Belongs to the genus Lyssavius (lyssa: rage in…

Slide 1 An Introduction to Phylogenetics > Sequence 1 GAGGTAGTAATTAGATCCGAAA… > Sequence 2 GAGGTAGTAATTAGATCTGAAA… > Sequence 3 GAGGTAGTAATTAGATCTGTCA… Anton…

Slide 1 Chapter 19 – Viruses (structure, reproduction, pathogens) HIV infection (TEM) (CDC) T4 bacteriophages infecting E. coli (colorized SEM) Phages (TEM) Slide 2 Viral…