1. DNA GRADE 12 2. LOCATION OF DNA IN A CELL : Position of gene on chromosomeLocus 3. LOCATION OF DNA IN A CELL •Chromatin is a complex of DNA and protein, and is found…

Slide 1The structure of DNA http://ghr.nlm.nih.gov/handbook/illustrations/dnastructure.jpg Slide 2 ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA…

Slide 1 Fated ? Paradoxes August 4, 2013 Dr. Katie Galloway Do your genes decide your fate? Slide 2 Fat gene? Slide 3 Infidelity gene? Slide 4 Slide 5 Identifies-meaningless-correlations…

PowerPoint Presentation Week #4 Quarter 2 (11/4) Homework: unit 4 cell cycle, mitosis and meiosis test Tuesday To Do Today: Complete meiosis handout Review for cell cycle,…

Structure of DNA Structure of DNA Genes and Chromosomes or Cellular Reproduction pt. II I. Deoxyribonucleic Acid Serves as genetic messenger Master program that controls…

PowerPoint Presentation Week #5 Quarter 2 (11/12/13) Homework: Lab report Due Nov 19 one week! To Do Today: Lab report directions Due Nov 19 Finish coloring DNA Video on…

PowerPoint Presentation Week #4 Quarter 2 (11/4) Homework: unit 4 cell cycle, mitosis and meiosis test Tuesday To Do Today: Complete meiosis handout Review for cell cycle,…