Slide 1Nucleic Acids DHPLC Applications in Biomedicine Pooria Gill PhD of Nanobiotechnology [email protected] In The Name of Allah Slide 2 Nucleic Acids DNA DNA –Linear…
1. Designing for Online: Instructional Design in Action! 21 stCentury Learning and Sharing April 23th 2009 Monique Brewer Open School BC 2. Designing for Online Challenges…
Developing a Training Program for LIS Professionals Dheeraj Singh Negi INTRODUCTION Training and development is a function of human resource management concerned…
1. Next Generation Sequencing By Amir Bagheri Supervisor: Dr. S. J. Mowla Brief introduction to 2. $1,000 genome challenge 3. • Advances in sequencing technologies paved…
Slide 1 Introduction to statistics using R I519, Introduction to bioinformatics Slide 2 Given a sequence, what can we ask? AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC…
Slide 1 Biological Motivation Gene Finding in Eukaryotic Genomes Anne R. Haake Rhys Price Jones Slide 2 Recall from our previous discussion of gene finding in prokaryotes:…
Slide 1 Nucleotide and Protein sequence databases Dinesh Gupta Structural and Computational Biology Group ICGEB Slide 2 Nucleotide sequence databases EMBL, GenBank, and DDBJ…
Introduction to statistics using R I519, Introduction to bioinformatics Given a sequence, what can we ask? AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC…