Documents Introduction to statistics using R I519, Introduction to bioinformatics.

Slide 1 Introduction to statistics using R I519, Introduction to bioinformatics Slide 2 Given a sequence, what can we ask? AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC…

Documents Introduction to statistics using R

Introduction to statistics using R I519, Introduction to bioinformatics Given a sequence, what can we ask? AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC…