1. The future of#devopsPatrick Debois - #devopsdays Austin 2013 2. I’m not gonna talk ...“Technology is a wordthat describes somethingthat doesnt work yet”Douglas Adams…

Slide 1n Chapter 19~The Organization and Control of Eukaryotic Genomes Slide 2 Chromatin DNA Packing histone protein (+ charged amino acids ~ phosphates of DNA are - charged)…

1.VectorBase gene sets A tutorialMartin HammondVectorBase European Bioinformatics InstituteDecember 2008 Slide 1 of 18 2. What this tutorial covers• What is a VectorBase…

Slide 1 Chapter 19 The Organization and Control of Eukaryotic Genomes Slide 2 Chromatin structure is based on successive layers of DNA packing. Chapter 19 The Organization…

Slide 1 Slide 2 GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State Slide 3 Hidden…

Slide 1 Molecular Genetics & Gene Function NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS Slide 2 Concepts We Already Know: Chromosomes Genome Genes Central…

Slide 1 Data integration via XML Ela Hunt John Wilson Vangelis Pafilis Inga Tulloch http://xtect.cis.strath.ac.uk/ Slide 2 Hunt, Wilson, Pafilis and Tulloch, Glasgow Overview…

Chapter 19 The Organization and Control of Eukaryotic Genomes Chromatin structure is based on successive layers of DNA packing. Chapter 19 The Organization and Control of…

Chapter 11: Transcription Initiation Complex Copyright © Garland Science 2007 Genome expression includes 2 steps Initiation of transcription. Assembly of upstream protein…

Summer Term 2014 Noel Jackson, Head of Education newsletterEducation O n- Po in t D an ce r C op yr ig ht : G un th er v on H ag en s' BO D Y W O RL D S, In st itu te…