Slide 1 Facultative Intracellular world Facultative Extracellular Free-living world Obligate (Vertically -transmitted) Obligate (Horizontally- Transmitted) Exposure to novel…

Slide 1 Sporozoa life cycle - Plasmodium 1.Oocyst forms in mosquito gut, mitosis forms sporozoites 2.Mosquito injects sporozoites, migrates into hepatocyte 3.Schizogeny (mitosis)…

Slide 1 Slide 2 1. What is the key to effective integrated pest management? Regular monitoring of plants Slide 3 2. What is the first control method that should be used?…

Slide 1 Sources of variation Slide 2 Mutation produces variation at multiple scales: Slide 3 Larger mutations in alleles Microsatellites Examples: AGTCCTGAGATTGGATATATATATATGTAGTACGGTACC…

Slide 1 Lab Background Slide 2  Saltmarshes: are coastal wetlands found in protected bays and estuaries and are flooded by the tides on a daily basis.  Estuaries: are…