Slide 1 Slide 2 AP Biology 2007-2008 Biotechnology Slide 3 AP Biology A Brave New World Slide 4 AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG…

Slide 1 Slide 2 VIRUSES, BACTERIA, and PRIONS https://www.msu.edu/course/isb/202/ebertmay/images/HIV%20virus.png http://www.scifair.org/+images/Electrophoresis.gif http://foodsafety.wisc.edu/assets/foodfacts_2007/wffFeb2007_clip_image002.jpg…

RESTRICTION ENDONUCLEASES CUT AT SPECIFIC SITES & LEAVE STICKY ENDS EcoR1 animation Leave âsticky endsâ that can be used to join DNA from different organisms PLASMIDS…

RESTRICTION ENDONUCLEASES CUT AT SPECIFIC SITES & LEAVE STICKY ENDS EcoR1 animation Leave âsticky endsâ that can be used to join DNA from different organisms PLASMIDS…

RESTRICTION ENDONUCLEASES CUT AT SPECIFIC SITES & LEAVE STICKY ENDS EcoR1 animation Leave âsticky endsâ that can be used to join DNA from different organisms PLASMIDS…

Bacterial Genomes Remember no nucleus!! Bacterial chromosome - Large ds circular DNA molecule = haploid - E. coli has about 4,300 genes (~4.2 Mb) 100x more DNA than the average…

Lecture 036 - Prokaryotic Genetics Chapter 13 Bacterial Genetics AP Biology AP Biology 1 Why study bacterial genetics? Its an easy place to start history we know more about…