Slide 1Norovirus Testing: What Happens at The Lab Dr. Amy Woron [email protected] 615-262-6462 Molecular Biologist TN Dept. of Health Laboratory Services Slide 2 Norovirus…

Slide 1The structure of DNA http://ghr.nlm.nih.gov/handbook/illustrations/dnastructure.jpg Slide 2 ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATCCATTTTA…

Slide 1The Use of Dried Blood Spots in HIV Drug Resistance Surveillance Diane Bennett MD MPH Slide 2 U.S. HIV drug resistance (HIVDR) surveillance Remnant HIV diagnostic…

Slide 1 2008 Advances in DNA genotyping and sequencing genotyping and sequencing Tad S. Sonstegard USDA, ARS, Bovine Functional Genomics Laboratory BARC-East Beltsville,…

Slide 1 Overview of the Southern California Children’s Health Study Genes and the Environment: The Genesis of Asthma and Allergy Workshop Muhammad Towhid Salam University…

Slide 1 Biostatistics in biology Slide 2 Why we use biostatistics in biology Slide 3 Facts should be proven e.g. Chemical A is anticancer drug. How to prove it? Slide 4 Facts…

Slide 1 Human Migrations Saeed Hassanpour Spring 2008 Slide 2 Introduction Population Genetics Co-evolution of genes with language and cultural. Human evolution: genetics,…

Slide 1 Center for Homogeneous DNA Analysis - Software April 21, 2005 Slide 2 Second Year Advances Background removal Melting curve calculators Automatic clustering and classification…

Slide 1 Does knowing personal genomic information change behavior? Nate Cira Gene 210 6/5/2012 Slide 2 Importance Are there benefits to testing? Are there risks from testing?…

Slide 1 Outline to SNP bioinformatics lecture Brief introduction SNPs in cell biology SNP discovery SNP assessment SNP databases SNPs in genome browsers Slide 2 Single Nucleotide…