Chloroplast Genome Chloroplast - organelle found in plant cells and eukaryotic algae - Photosynthesis Structure of chloroplast • Lens shaped ,5-10 um long • Soluble phase…

Slide 1Genome Sizes are Large human = 3 x 10 9 bp E. coli = 4 x 10 6 bp If 1 bp = 1 mm, then: human genome = 3000 km (1800 miles) E. coli genome = 4 km (2.5 miles) gene of…

Slide 1 Genome sequence Slide 2 Genome size does not correlate well with gene number or with apparent organism complexity Closely related organisms can have genome sizes…

1.Genome evolution: tales of scales Pat Heslop-Harrison [email protected] www.molcyt.com and www.molcyt.org User & pw ‘visitor’Twitter, YouTube and Slideshare: pathh1…

1.Genes Code for Proteins One gene: One enzime One gene : One polypeptide or RNA 2.  Dominance is explained by the properties of mutant proteins 3. Mutations in the same…

1.tctttttatgattaaattaaattttcaaaacgtcgaaatcatttgactgtttgttcagaatgaacagagcctgtaaaagccagttggctgtataatcgcctgatattcggttcccacgtggattagattgattttcaacaagaagttttataaatttttttgtttaaaattttgaatatttggatctgaaaaaattaaagtttgatgattcgaaaattttctggaaaagttctttcagtaaaaactttttttcaactttttgattttttttccgcattttgtttttgaattattttcctgatttttttcgattaataaatttgtaaaaacaattttttttctaatttt...

Slide 1 Tutorial 1 Biology background for the course Slide 2 Genome sizes and number of genes OrganismGenome SizeNo. of genes E. coli4.6 Mb~4,300 genes Baker’s Yeast12…

Slide 1 Large scale proteome comparisons Genome trees Fredj Tekaia Institut Pasteur [email protected] Slide 2 Complete genomes 1387 projects  261 published (01-03-05)…

Chapter 3: How many genes are there? 3.1 Introduction Total number of genes at four levels: genome is the complete set of genes of an organism transcriptome is the complete…

Phylogenetics Phylogenetics in the cloud Brian OâMeara http://www.brianomeara.info http://xkcd.com/287/ Understand what phylogenetics is and its utility for life scientists…