Slide 1Annotation and Visualization Doreen Ware Slide 2 Project Challenges Rapidly growing sequence data Full annotation of all clones New high-performance computing cluster…

1.Genome browsing, Genomic data mining and Genome data visualization with Ensembl, Biomart and IGV Alex Sánchez August 2005 2. 2 What is Ensembl • Ensembl is a joint scientific…

1. Ensembl Plants: Visualising, mining and analysing crop genomics data Dan Bolser Ensembl Plants project leader EMBL-EBI http://plants.ensembl.org #EnsemblGenomes 2. Visualising,…

1. FIND MEANING IN COMPLEXITY © Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved.For Research Use Only. Not for use in diagnostic procedures.…

Slide 1COMPARATIVE FUNGAL GENOMICS : KNOWN KNOWNS & KNOWN UNKNOWNS. Josh Herr, Plant Biology Interdepartmental Program Slide 2 Problems, hurdles, help wanteds… …

Slide 1 Comparative Genomics and Evolution Pollard, K.S., et al., Forces Shaping the Fastest Evolving Regions in the Human Genome. PLoS Genetics 2(10), 2006. McLean, C.,…

Slide 1 2013 iPlant workshop Marcela Karey Monaco Slide 2 2013 What is Gramene? An integrated plant reference genome resource Comparative genomics hub of data & tools…

Slide 1 Dissecting virulence of E. coli O157:H7 using genome alignments Slide 2 E. coli Escherichia coli is a normal resident of the mammalian gut –Most strains are non-pathogenic…

Slide 1 Whole Genome Alignment MUMmer and Alignment October 2 nd, 2007 Adam M Phillippy [email protected] Slide 2 Goal of WGA  For two genomes, A and B, find a mapping from…

Slide 1 TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT CCCTGTTTCCAGGTTTGTTGTCCCAAAATAGTGACCATTTCATATGTATA…