Slide 1 Overview of Text Mining Expertise @ SCD Slide 2  Text Mining @ SCD Introduction  Text mining team @ SCD  Started around 2000  Currenty 1 postdoc, 4 PhD…

What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale Microarray ATATCGGCATCAGTCGATCGATCATCGATCGAT UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA…

Literature Mining for the Biologist Literature Mining for the Biologists Santhosh J. Eapen [email protected] Present scenario Generation of large scale literature data…

What Is Microarray A new powerful technology for biological exploration Parallel High-throughput Large-scale Genomic scale Microarray ATATCGGCATCAGTCGATCGATCATCGATCGAT UAUAGCCGUAGUCAGCUAGCUAGUAGCUAGCUA…

Annotator Interface Sharon Diskin GUS 3.0 Workshop June 18-21, 2002 Outline Current annotation efforts Motivation for new annotation tool Requirements for new annotation…