Documents Symptom Management of Treatment Toxicities in Early Breast Cancer Patients Frances M. Palmieri, RN,....

Slide 1 Slide 2 Symptom Management of Treatment Toxicities in Early Breast Cancer Patients Frances M. Palmieri, RN, MSN, OCN Clinical Nurse Specialist Manager, Multidisciplinary…

Documents Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer

Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr. Garry Larson City…