Slide 1A Brief History of Mullers Ratchet Slide 2 H.J. Muller (1964, Mutation Research 1: 2-9) pointed out that … an asexual population incorporates a kind of ratchet mechanism,…

Soâ¦. Evolutionary Stuff Wooo Weâre Almost Done! Some Things that need to be Mentioned a Bit New alleles usually enter gene pool in a single copy An Allele that is linked…

Slide 1Topic 18. Lecture 28. Importance of the Evolution of Life outside Life Sciences Evolution of life attracts more attention outside natural sciences that any other branch…

Slide 1 Sources of variation Slide 2 Mutation produces variation at multiple scales: Slide 3 Larger mutations in alleles Microsatellites Examples: AGTCCTGAGATTGGATATATATATATGTAGTACGGTACC…

Slide 1 Recombination Definitions Models Mechanisms Slide 2 Definition of recombination Breaking and rejoining of two parental DNA molecules to produce new DNA molecules…

Slide 1 Rare and common variants: twenty arguments G.Gibson Homework 3 Mylène Champs Marine Flechet Mathieu Stifkens 1 Bioinformatics - GBIO0009-1 - K.Van Steen University…

Slide 1 Human Genetics Mendelian Genetics Exceptions Slide 2 Slide 3 Gene (allele) interactions  Dominance  Recessive  Codominance  Incomplete dominance  Epistasis…

H1N1 FLU Help Slow the Flu’s Spread! Wash your hands or use alcohol-based hand sanitizer often, especially before eating Cover your cough or sneeze Do not come to class…

Topic 15. Lecture 21. Microevolutionary mechanisms of Macroevolution. We already considered genetic variation of natural populations and factors that affect this variation…

A Brief History of Muller’s Ratchet. H.J. Muller (1964, Mutation Research 1: 2-9) pointed out that - PowerPoint PPT Presentation