Slide 1Overview of Gene Expression Systems with Gateway ® Technology Slide 2 2 Research trends Current research focuses on proteomics: drug target example –Approximately…

Slide 1Bacterial Infection in Liver Cirrhosis: the Microbiologist Point of View Prof. Marie-Hélène NICOLAS-CHANOINE Slide 2 Bacterial infections life-threatening complications…

Slide 1 Slide 2 AP Biology 2007-2008 Biotechnology Slide 3 AP Biology A Brave New World Slide 4 AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG…

Slide 1CDC perspective on non-O157 Shiga toxin-producing E. coli (STEC) in the United States Patricia M. Griffin, M.D. Chief, Enteric Diseases Epidemiology Branch October…

Slide 1Molecular Biology Fifth Edition Chapter 20 DNA Replication, Damage, and Repair Lecture PowerPoint to accompany Robert F. Weaver Copyright © The McGraw-Hill Companies,…

Slide 1 Slide 2 Slide 3 Cellular response to DNA damage Reponse Mechanisms Tolerance of DNA damage Replicative bypass of template damage Translesion DNA synthesis Reversal…

Slide 1Bacteria Bacteria Slide 2 Peptidoglycan Cell wall Cell membrane Ribosome Flagellum DNA Pili Section 19-1 Eubacterium Structure Slide 3 Classification DKPCOFGS DKPCOFGS…

Slide 1Diet and purines Prof David Perrett William Harvey Research Institute Barts & the London School of Medicine Slide 2 You are what you eat! or Slide 3 Gout A disease…

Slide 1Development of Resistance mechanisms in Pseudomonas aeruginosa Luis Martínez Martínez Service of Microbiology University Hospital Marqués de Valdecilla Santander,…

Slide 1Introduction to Lake Surveys: Laboratory Techniques Unit 3: Module 9 Slide 2 Developed by: Axler, Ruzycki Updated: Dec. 29, 2003 U3-m9a-s2 Objectives Students will…