Slide 1ACIDS, BASES and SALTS Slide 2 My numbering system Slide title: A, B, C… - Points on a slide: 1, 2, 3, - How to find it on your note handout: A1, A2, B1, B2… Slide…

Slide 1 Slide 2 AP Biology 2007-2008 Biotechnology Slide 3 AP Biology A Brave New World Slide 4 AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG…

Slide 1 Slide 2 AP Biology 2007-2008 From Gene to Protein How Genes Work Slide 3 AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells &…

Slide 1Chapter 13 Acids and Bases Slide 2 Some Properties of Acids þ Produce H + (as H 3 O + ) ions in water (the hydronium ion is a hydrogen ion attached to a water molecule)…

Slide 1 Slide 2 Slide 3 Slide 4 red and green are opposites Slide 5 assume red and green cancel each other net color = neutral Slide 6 take away one red Slide 7 net color…

Slide 1 Slide 2 Warm Up A solution has a H+ ion concentration of 3.5 X 10 -8 M. a. What is the pH? b. What is the [OH - ]? c. What is the pOH? d. Would the litmus paper turn…

Slide 1Chapter 6 Solution, Acids and Bases Slide 2 Mixtures Two or more substances Two or more substances Heterogeneous- different from place to place Heterogeneous- different…

Slide 1Implementing Declarative Overlays Timothy Roscoe Joint work with Boon Thau Loo, Tyson Condie, Joseph M. Hellerstein, Petros Maniatis, Ion Stoica Intel Research and…

Slide 1Contact: Deanne Emory at Miller & Weber, Inc. (718) 821-7110 email: [email protected] ASTM Committee D04 on Road and Paving Materials Standards Requiring Review…

Slide 1¿Es hereditario el cáncer? Javier Benítez Dpto. Genética Humana CNIO Slide 2 Cancer incidence in spain (Cases /year) LocationMale Female Total Lung 13.728 1.36215.090…