YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: The problem with  human evolution  …
Page 2: The problem with  human evolution  …
Page 3: The problem with  human evolution  …

The problem with human evolution …

?Where did the monkey come from ?

So God created man in his own image, in the image of God created he him; male and female created he them. Gen 1 : 27

Page 4: The problem with  human evolution  …

Starting at the beginning

Page 5: The problem with  human evolution  …

Starting at the beginning

Page 6: The problem with  human evolution  …

What is life ?can it be understood in material

terms?

Page 7: The problem with  human evolution  …

What is life ?

Able to live independently of parent

Has a metabolism that requires energy

Produces offspring identical to itself

Has DNA or RNA for reproduction

Molecules that have ‘chirality’Has a cellular structure

All living organisms are said to have the following characteristics:

Page 8: The problem with  human evolution  …

The important question

Is it possible for living matter to originate from inert matter ? This is also known as

spontaneous generation or abiogenesis.

Page 9: The problem with  human evolution  …

Spontaneous GenerationThe early Greek philosophers such as Anaximander, Aristotle and Lucretius believed that living organisms originated from mud heated from the sun.Your serpent of Egypt is bred now of your mud by the operation of your sun: so is your crocodile.Antony and Cleopatra: Act 2, written before the spring of 1608

On the Nature of Things By

Lucretius Written 50 B.C.E

1st Cent. BC

Page 10: The problem with  human evolution  …

Spontaneous Generation... if you press a piece of underwear soiled with sweat together with some wheat in an open mouth jar, after about 21 days the odour changes and the ferment coming out of the underwear and penetrating through the husks of the wheat, changes the wheat into mice.

1500s

Flemish scientist Jan van Helmont

(1580-1644)

Page 11: The problem with  human evolution  …

Spontaneous GenerationBut what is more remarkable is that mice of both sexes emerge (from the wheat) and these mice successfully reproduce with mice born naturally from parents ...But what is even more remarkable is that the mice which came out were not small mice… but fully grown.

1500s

Flemish scientist Jan van Helmont

(1580-1644)

Page 12: The problem with  human evolution  …

Spontaneous GenerationIn the seventeenth century Italian scientist Francesco Redi through experimentation developed the doctrine of “omne vivum ex vivo” All life comes from pre-existing life Italian scientist

Francesco Redi (1626-1697)

1600s

Page 13: The problem with  human evolution  …

Spontaneous GenerationErasmus Darwin proposed a modified theory of spontaneous generation in which only the simplest life forms spontaneously generated from which higher order life forms were derived.Organic life began beneath the waves.....

Hence without parent by spontaneous birthRise the first specks of animated earth;From nature's womb the plant or insect swims,And buds or breathes with microscopic limbs."

Organic life beneath the shoreless wavesWas born and nurs'd in ocean's pearly cavesFirst forms minute unseen by sphearic glass Move on the mud, or pierce the watery mass;These, as successive generations bloom,New powers acquire and larger limbs assume;Temple of Nature by Erasmus Darwin

Erasmus Darwin (1731-1802)

1700s

Page 14: The problem with  human evolution  …

Spontaneous GenerationIn the nineteenth century, famous French scientist Louis Pasteur entered the debate and through experiments proved that the supposedly spontaneously generated life forms had in fact come from micro-organisms which abound in the atmosphere. French chemist

Louis Pasteur(1822-1895)

1800s

Page 15: The problem with  human evolution  …

The primordial soup mythSpontaneous generation having been disproved, the battle field was moved to a time in the supposed primordial earth, when conditions were more favorable to the generation of life.

Russian biochemist Aleksandr Ivanovich

Oparin(1894-1980)

1900s

Page 16: The problem with  human evolution  …

The primordial soup myth“Life arose on earth thousands of millions of years ago when collections of organic molecules in the primeval soup which formed in the primitive ocean became isolated from the bulk water of that ocean. Because of their closeness these molecules were able to interact with one another and began to show the first signs of life.”E.J. Wood and W.R. Pickering, Introducing Biochemistry (1982) p. 17

Heat for 1 million years and add lightning bolt

1900s

Page 17: The problem with  human evolution  …

The primordial soup myth1900s

Page 18: The problem with  human evolution  …

The Miller ExperimentThe most generally respected study on the origin of life via a primordial soup is the experiment conducted by the American researcher Stanley Miller in 1953.

1900s

Page 19: The problem with  human evolution  …

The Miller Experiment

Used a “cold trap” to isolate the amino acids from the environment as soon as they were formed.

Unrealistic atmosphere simulated. Scientists now agree that nitrogen and carbon dioxide are required.

The atmosphere should also have had oxygen, which would have destroyed the newly formed amino acids.

Other organic acids also formed that were detrimental to the structure and function of living things.

4 key problems with this experiment:

1900s

Page 20: The problem with  human evolution  …

Millers Experiment

If I can just synthesize life here, then I’ll have proven that no intelligence was necessary to form life in the beginning

1900s

Page 21: The problem with  human evolution  …

The primordial soup myth“It was popular not because there was any evidence to support it, but because it seemed to be the only alternative to Biblical creationism.”Physicist Freeman Dyson

“It is remarkable that over the past half-century the scientific world has, almost without exception, believed a theory for which there is not a single supporting fact.”Sir Fred Hoyle

1900s

Page 22: The problem with  human evolution  …

Molecular Chiralityall molecules are not created

equal

Page 23: The problem with  human evolution  …

Molecular chiralityThe building block amino acids of all living things are 100% left handed.

Sarfati, J., The origin of life: the chirality problem, CEN Technical Journal12(3):281-284, 1998

However, a hypothetical ‘soup’, by well-known laws of chemistry, would inevitably be an even racemic mixture of left and right-handed acids.

Page 24: The problem with  human evolution  …

Extra-Terrestrial Life

move the problem somewhere else

Page 25: The problem with  human evolution  …

If life could not have started on Earth, it must have come from somewhere else – right ?

Life from Mars?

Electron micrograph of Martian meteorite ALH84001

The Moon : LIFELESS !

400 to 54 million km from earth

400 000 km from earth

Page 26: The problem with  human evolution  …

Life on Earth ?

Magnetosphere filtering out lethal solar radiation

Atmospheric gases of the exactly the right ratio

Earth tilted at a angle of 23° giving us our seasons

Position in relation to the gas giant planets and asteroid belt

The distance from and the tidal effect of the moon

Located within the Habitable Zone (HZ)

Add 154 other factors!

Page 27: The problem with  human evolution  …

The chemistry of life

how to build a human

Page 28: The problem with  human evolution  …

If the nucleus of a typical atom were expanded to the size of a basket ball, the atom would be about a 3 km in diameter. Atoms are mostly empty space!

Elements - AtomsNitrogenHydrogenOxygenCarbonPhosphorus

Page 29: The problem with  human evolution  …

Amino Acids Sugars

All amino acid molecules in DNA are left handed chiral molecules

Molecules

DNA and RNA also use pure right-handed chiral sugar molecules

CytosineAdenine Guanine Thymine

Page 30: The problem with  human evolution  …

DNA - Deoxyribose Nucleic Acid

In a human being, each cell holds 46 separate DNA molecules, each containing, on the average, about 160 million nucleotide pairs, yet this massive amount of information is stored and replicated almost flawlessly.

DNA is such an incredibly complicated molecule that it is over six feet in length !

NitrogenHydrogenOxygenCarbonPhosphorus

Page 31: The problem with  human evolution  …

Genes The base pairs of amino acids act like a structural integrity test.

Because only A & T join and C & G join, the two sugar backbones that make the DNA double helix are identical but in verse order.

This ensures that in the case of a single amino acid being wrong the whole double helix structure is invalidated.

ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC

Cytosine + Guanine

Adenine + Thymine

Thymine + Adenine

Guanine + Cytosine

Page 32: The problem with  human evolution  …

Chromosomes

All humans have 23 pairs of chromosomes. 22 regular pairs and an XY pair. Chromosomes exist in the nucleus of all of our 100 trillion cells and are essential discreet sections of the genetic code.

Page 33: The problem with  human evolution  …

sCells

Some life forms are made of only a single cell

Cells are where the atoms and molecules begin to demonstrate specific purpose and functional objectives – the first real evidence of intelligence

Page 34: The problem with  human evolution  …

sThe two most important cells

Page 35: The problem with  human evolution  …

sAs thou knowest not what is the way of the spirit, nor how the bones do grow in the womb of her that is with child: even so thou knowest not the works of God who maketh all. Ecclesiastes 11:5

Human Foetus

A human life at about 12 weeks

Page 36: The problem with  human evolution  …

I will praise thee; for I am fearfully and wonderfully made: marvellous are thy works; and that my soul knoweth right well. Psalms 139:14

Page 37: The problem with  human evolution  …

The Last Wordwhat has God said …

Page 38: The problem with  human evolution  …

The invisible things …Romans 1:20 For the invisible things of him from the creation of the world are clearly seen, being understood by the things that are made, even his eternal power and Godhead; so that they are without excuse:

Professing themselves to be wise, they became fools …

Page 39: The problem with  human evolution  …