Yakushima Field & Lab Report 1
February 23rd, 2017 Yakushima Field & Lab Report: Testing the trade-off between parasite resistance and the immunosuppressive hormones cortisol and testosterone 1Nelson Broche Jr., 1Akihiro Itoigawa, 1Yuri Kawaguchi, 1Yugo Kawamoto, 2Miho Tanaka, 3Kenya Ueno, 4Zhihong Xu, 5Jingyi Zhang 1Primate Research Institute, Kyoto University 2Wildlife Research Center, Kyoto University 3Division of Biological Science, Kyoto University 4School of Life Science, Sun Yat-sen University 5School of Society and Anthropology, Sun Yat-sen University Abstract This report describes a combination of field and lab techniques in order to investigate the trade-off between cortisol, testosterone, and parasite resistance. In vertebrate species, sexually mature males have been reported to have a higher load of parasites in the wild, challenging the immune system of the host. Chronically elevated levels of cortisol and testosterone are both known to have immunosuppressive properties. We collected 91 fecal samples from wild Yakushima macaques (Macaca fuscata yakui) in the western forest of Yakushima over five days during the mating season. Eggs of five species of nematode parasite were counted from fecal samples. Three parasite species are known to infect through direct transmission (Oesophagostomum aculeatum, Strongyloides fuelleborni, Trichuris trichiura) and two parasite species are trophically transmitted (Streptopharagus pigmentatus, Gongylonema pulchrum). In order to determine Yakushima macaque sex, we extracted DNA from fecal samples and performed polymerase chain reaction (PCR) and electrophoresis. Cortisol and testosterone of all fecal samples were measured quantitatively using a double antibody immunoassay, and concentrations were determined using a standard curve. We found that juveniles had higher EPG of Oesophagostomum aculeatum than adult males and females. There were no significant differences in parasite richness of infection. Hormonal analysis showed that adult males had significantly higher levels of testosterone than adult females. Finally, there was a negative correlation between female cortisol and Oesophagostomum aculeatum. We discuss our results and make recommendations for future studies. Keywords nematode parasitism, hormones, sex difference, Macaca fuscata yakui, immune suppression, mating season
Yakushima Field & Lab Report 2
Introduction
In vertebrate species, sexually mature males have been reported to have higher
parasite burdens creating a higher challenge for the immune system (Zuk & McKean, 1996).
Differences in endocrine-immune interactions between sexes could explain one proximate
reason for this sex difference. In species that seasonally breed, this creates a male fitness
conundrum where mating season sees increased levels of testosterone. Testosterone
exaggerates already existing aggression (Sapolsky, 1997) due to mating competition, which
all likely serves to cause higher levels of aggregate stress. Are there trade-offs between
parasite resistance and the immunosuppressive hormones cortisol and testosterone?
Several terms and concepts are used in this report and for clarity are defined here.
Parasite prevalence is the number of hosts infected by helminthic parasites divided by the
total number of hosts sampled (Bush et al., 1997), or in our case the percentage of samples
that are infected. The intensity of infection refers to the number of a specific parasite species
infecting a single host. Eggs per gram (EPG), which is often used as a surrogate measure for
intensity of infection, refers to the number of eggs per 1 gram of feces. Parasite richness, or
species richness, refers to the number of parasites per individual sample.
Biological stress can be defined as any environmental, physiological, and or
psychosocial demand placed on or perceived by an organism that unbalances the natural
regulatory state of an organism (McEwen, 2000). During times of biological stress,
glucocorticoids are excreted into circulation by the adrenal cortex and thus levels of stress
can be quantitatively measured. This cascade of events is regulated by the hypothalamic-
pituitary-adrenal (HPA) axis, which refers to the complex interaction between the
hypothalamus, pituitary gland, and the adrenal glands during times of stress (Turnball &
Rivier, 1999). Cortisol is a type of glucocorticoid that is often used to measure stress in
primates and other mammals.
Testosterone is an important hormone for reproductive success and its function is
regulated through the hypothalamic-pituitary-gonadal (HPG) axis (Viau, 2002). In males,
testosterone is primarily produced and secreted by Leydig cells located in the testes. Cortisol
and testosterone are both steroid hormones and due to their chemical structure do not exhibit
species specificity in most animals. The mechanistic interplay between testosterone and
cortisol is also complex and not all processes are fully understood. Stress-related hormones
are known to influence the HPG axis at every level (Rivier & Rivest, 1991). For example,
stress-induced beta-endorphins have an inhibitory effect on gonadotropin-releasing hormone
Yakushima Field & Lab Report 3
(GnRH), showing significant effects within seconds and inhibiting the production of
luteinizing hormone (LH) at the level of the pituitary (Wingfield & Sapolsky, 2003).
Glucocorticoids themselves have a direct inhibitory effect on the testicular luteinizing
hormone receptor (Bambino & Hsueh, 1981). And pharmacologically induced cortisol has
been shown to have significantly negative effects on total testosterone levels (e.g. Brownlee
et al., 2005; Cumming et al., 1983). Thus, it is thought that testosterone and cortisol have a
negative inverse relationship.
Helminths are parasitic worms that infect mammalian hosts by living in the
gastrointestinal tract, blood stream, and other parts of the host for at least one stage of their
life cycle (Girgis et al., 2013; Maizels et al., 2004). In general, helminths do not proliferate
within the host and often do not cause symptoms of disease. Through complex processes, the
immune system defends the body against infection caused by pathogens, parasites, and other
potentially harmful intruders. According to Delves and Roitt (2000), similar in principle to
intracellular parasitic and pathogenic immune responses, when the immune system detects a
helminth infection, mechanisms set into action and begin to eliminate the parasite. In various
mediated forms, two lymphocyte cell types known as T cells and B cells, as well as activated
macrophages, are the main components for fighting the infection (Sapolsky, 2002). These
cells are spread throughout the body and therefore blood-borne chemical messengers help
communicate between various immune system cell types. One such critical chemical
messenger includes cytokines, which triggers immune cell proliferation. Glucocorticoid
hormones can have a negative effect on the immune response through disrupting this cascade
of events by inhibiting the release of cytokines. Furthermore, glucocorticoids can destroy
lymphocytes themselves, inhibit B-cell mediated immunity, and disrupt other important
immune responses.
Our team visited Yakushima, a biologically rich island located in the south of Japan,
to study its endemic nonhuman primate species, the Yakushima monkey (Macaca fuscata
yakui), during the mating season and explore the relationship between stress, reproductive
hormones, and parasite resistance. Target parasite species consisted of Oesophagostomum
aculeatum, Strongyloides fuelleborni, Trichuris trichiura, Streptopharagus pigmentatus, and
Gongylonema pulchrum. Our study aims were to (1) test the hypothesis that adult males are
more heavily infected by parasites than adult females and (2) that the immunosuppressive
hormones testosterone and cortisol could explain this male biased parasitism at the proximate
level.
Yakushima Field & Lab Report 4
Methods
Study site and subjects
Yakushima is a mountainous island approximately 60 km south of Kyushu, Japan.
This island is characterized by a warm-temperate climate, with considerable rain
(3,000~10,000 mm per annum depending on altitude) and humidity. Historically, the island is
also famous for Yakushima cedars. Since 1993, much of the island is protected as a United
Nations Education, Scientific, and Cultural Organization (UNESCO) World Natural Heritage
site. Yakushima macaques are frequently observed in mountains and near roads. They are a
seasonally breeding species as well as a subspecies of Japanese macaque (Macaca fuscata).
Our study area was the northwest coastal forest of Yakushima, known as the western
forest road, or Seibu-rindou, which is protected by the prefectural government of Kagoshima.
We studied approximately 10 groups of Yakushima macaques near the western forest road
during our study period. All study subjects allowed observers and sample collectors to
approach within 5 meters, and therefore we could identify sex and age class of most
Yakushima macaques. Our study period was from 15 October – 21 October 2016. This period
was the mating season for Yakushima macaques. We were able to observe aggressive
behavior, mounting behavior and a variety of other behaviors between age and sex classes
throughout this area.
Fecal sample collection
We collected fresh fecal samples following defecation from the ground and tried to
identify as many individual monkeys as possible. Plastic zip-lock freezer bags and iceboxes
were used to store and carry samples to our field laboratory temporarily. In total, we collected
91 samples in four days: 20 males (4 juveniles, 7 sub-adults, 9 adults), 28 females (5
juveniles, 8 sub-adults, 15 adults), 42 unidentified sex (7 juveniles, 0 sub-adult, 3 adult, 32
unknown age class), and one sample that we could not determine to belong to a monkey (see
Table 1). To yield this amount of samples in a short time while they were still fresh, the
strategy we used was to divide the participants into three teams. One team stayed in the
laboratory to process and analyze samples, the other two teams went out into Seibu-rindou to
collect feces (as shown in Fig. 1).
Yakushima Field & Lab Report 5
At our field laboratory, we placed each sample into a paper cup using a plastic
disposable spatula and stirred to make the sample homogeneous. Then we divided each fecal
sample into three parts and stored them to prepare for each part of our experiment:
parasitological, genetic, and hormonal analysis. For hormonal analysis, 1-2 g of feces were
placed in plastic bags and frozen. For genome analysis, we spun a Q-tip into the feces to get
the monkey’s cells and then placed the Q-tip in lysis buffer. For parasite analysis, 1-2 grams
of feces was dissolved and fixed in 10 mL of SAF (sodium acetate-acetic acid-formaldehyde)
in a 15 mL plastic tube.
Before analyzing parasites, we used concentration procedures to separate parasites
from fecal debris. First, we labeled 15 mL centrifuge tubes and their caps, and then weighed
the empty tubes without caps. To lyse cells, we added 5 drops of Triton X-100TM to the
sample tube and vortexed for at least 15 seconds. Next, we filtered the solution through mesh
(~250 µm) into the labeled 15 mL tubes, which were prepared before. Saline was sometimes
used to help filtration and to keep the balance of fecal suspension volume. Then we
centrifuged the suspension at 3000 rpm for 5 minutes with caps, discarded the supernatant
fluid into a designated chemical waste bin, and weighed the tubes containing the remaining
fecal sediment. Next, we added 8 mL saline, 4 mL ethyl acetate and 2 drops of Triton X-
100TM to re-suspend the fecal sediment. After vortexing the solution for 20 seconds and
centrifuging at 3000 rpm for 5 minutes, four layers formed: ethyl acetate at top, plug of the
debris, saline, and the sediment containing parasite eggs at the bottom. Lastly, we discarded
the supernatant and plug with the help of applicators. We kept the remaining sediment, which
includes parasite eggs, in their respective tube.
Adding 10 mL of saline, we vortexed tubes and transferred the suspension to a vial.
We used a Pasteur pipette to take an aliquot from the suspension while it was homogenized,
and filled one of the chambers of the McMaster slide. Then we identified and counted all
parasite eggs at 10x magnification. Three chambers were used per sample with the sample
remixed between each analysis. The number of eggs for each species was used to calculate
EPG, considering the fecal sediment rather than the original whole feces as the denominator
in our analysis. After analyzing each chamber, the contents of the chamber were transferred
back into the vial using the same pipette.
Yakushima Field & Lab Report 6
Figure 1. Parasite analysis of Yakushima macaque feces We first collected identifiable Yakushima macaque feces in the field. Then processed each sample for microscopy. Finally, we counted the number of each parasite species found in each sample to determine EPG.
Yakushima Field & Lab Report 7
Table 1. Yakushima macaque feces sample set
All samples (n=91) were collected from 15 Oct 2016 to 19 Oct 2016. Group abbreviations: - = Unknown, S = Sora, UA = Umi A, KA = Kawahara A. Age classification was determined by direct observation. Age classification: adult = ≥10 yrs; sub-adult = 5 – 9 yrs; juvenile = 2 – 4 yrs. Sample 16 was determined not to be feces.
Female Male SexUnknown
Adult↑
No. Date Time Group No. Date Time Group No. Date Time Group AgeUnknow
n↑
No. Date Time Group323394041565759647284889091
16Oct16Oct16Oct16Oct16Oct17Oct17Oct17Oct17Oct18Oct19Oct19Oct
19Oct
19Oct
14:1513:4012:3313:4809:2214:4513:0512:0014:2310:3514:1212:2210:4612:43
-UA-S------SS--
244262636567767778
16Oct16Oct17Oct17Oct18Oct18Oct19Oct19Oct19Oct
13:5015:0209:0412:5114:1513:5013:5012:0011:05
UA--------
5141766
16Oct16Oct16Oct18Oct
11:5511:0510:1614:10
----
89101112131516262728293031323334354445464748495051525354606173
16Oct16Oct16Oct16Oct16Oct16Oct16Oct
-16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct16Oct17Oct17Oct18Oct
12:2909:4109:4510:0510:0609:5010:06-11:3009:4610:0109:3010:0010:1009:3014:0810:1509:3012:4509:2910:0010:0509:4509:2414:1014:1012:00
---------------S----------------
Sub-adult↑
20213638686971
16Oct16Oct16Oct16Oct18Oct18Oct18Oct
09:2513:2312:1413:2709:4009:2011:20
KAUAUAS---
7079808182838586
18Oct19Oct19Oct19Oct19Oct
19Oct
19Oct
19Oct
08:3013:4513:1010:4813:2514:3514:2313:09
-------S
Juvenile↑
6192258747589
16Oct16Oct16Oct17Oct18Oct18Oct19Oct
11:2513:2513:2512:5008:1313:3310:00
-SUA---S
173787
15Oct16Oct16Oct19Oct
16:5514:1512:1507:36
KA-S-
2418254355
16Oct16Oct16Oct16Oct16Oct16Oct
13:4511:1009:3713:1010:4514:13
---UA--
Yakushima Field & Lab Report 8
DNA Analysis
DNA extraction was performed using a QIAamp Fast DNA Stool Mini Kit
(QIAGEN). The sex of our selected DNA samples was identified by PCR and
electrophoresis. We used molecular markers to identify a 445 bp fragment of the ZFX/Y and
a 224 bp fragment of the SRY genes on X+Y chromosomes. ZFX/Y gene is included in both
X and Y chromosomes. On the other hand, the SRY gene is only included in the Y
chromosome. Females only have X chromosomes but males have X and Y chromosomes.
When we performed electrophoresis, we could identify the sex of the sample by the number
of bands. If we observed 2 bands by electrophoresis, the sample was considered male. Using
this method, we can easily identify the sex of the donor of each sample.
Thermal conditions for PCR: Phase Temp[℃] Time First denaturation 94.0 10 min Denaturation 94.0 10 sec Annealing 62.0 30 sec Extraction 72.0 1 min Final extraction 72.0 10 min Primers > ZFXY F: ATAATCACATGGAGAGCCACAAGCT > ZFXY R: GCACTTCTTTGGTATCTGAGAAAGT 445-bp expected amplicon > SRY F: CCCATGAACGCATTCATTGTGTGG > SRY R: ATTTTAGCCTTCCGACGAGGTCGATA 224-bp expected amplicon
Hormonal Analysis
Feces were mixed well and 1 gram was placed into a new plastic bag. After weighing,
feces were dried in a vacuum freeze drier (lyophilizer). We weighed 0.10 g feces and moved
it to a 5 ml crushing tube with 2 beads. We then added 3 ml 80% methanol to the tubes and
the sample was crushed at 4200 rpm for 20 sec. After crushing, these samples were mixed for
30 minutes and then centrifuged for 1 minute at 10,500 rpm. After centrifuging, 500 µl of the
supernatant was transferred to a 1.5 ml micro tube.
Testosterone and cortisol concentrations were measured by double body enzyme
immunoassay. The 2nd antibody (goat anti-rabbit) was diluted with coating buffer and added
45 cycles
Yakushima Field & Lab Report 9
to a 96-well microplate. The plate was incubated at room temperature for 2 hours, and then
the wells were completely emptied. Enzyme immunoassay (EIA) buffer was added to each
well. The plate was then sealed and stored in a refrigerator until further use. Samples were
diluted 5 times by EIA buffer. Next, we added 20 µl of standards (0.195-100 ng / ml) and the
diluted sample to each well. Then 100 µl 1st antibody (rabbit T or C) and 100 µl horseradish
peroxidase (HRP) antigen were added to each well. After adding all of the standards and
samples, the plate was incubated in the dark, overnight at 4°C. The following day, we washed
the plate 4 times and then 150 µl of substrate buffer was added to each well. The plate was
incubated at 37°C for 10 minutes. Then 50 µl of 4N-H2SO4 was added to each well to stop
the reaction. Next, the plate was read at a wavelength of 450 nm with a microplate reader
(SUNRISE, BIO-RAD Laboratories Inc.). Hormone concentration was calculated by using
the standard curve with the known concentration.
Data Analysis
We categorized Yakushima macaques into three main classifications: male, female,
and juvenile. Male and female classifications included sub-adult ages (5 – 9 years) and adult
ages (10 years and older). The juvenile classification included monkeys that were estimated
to be between 2 – 4 years old; both juvenile sexes were combined since our focus was on
investigating reproductive hormone differences among adult Yakushima macaques and the
juveniles we observed were determined not to be sexually mature. However, the juvenile
classification is included in this report as an added comparison to previous studies, such as
reported in MacIntosh et al. (2010). No sample was determined to come from an infant,
which we classified as 1 year and below. Our analyses focused on each part of our
hypotheses: (1) that Yakushima macaque adult males would be more heavily infected than
adult females during mating season and (2) that the immunosuppressive hormones cortisol
and testosterone could proximately explain this occurrence. Statistical analyses were
performed using R statistical software, version 3.3.2 (https://www.r-project.org/). All
statistical analyses were performed with the alpha level set to 0.05.
We first investigated sample prevalence of infection, EPG count, and parasite
richness. EPG in Yakushima macaque fecal samples were compared among males, females,
and juveniles (Category 1) using the Kruskal Wallis test. The mean richness of parasite
species, or parasite richness, in fecal samples was compared among males, females, and
juveniles in Category 1 using a one-way ANOVA. We tested the relationship between each
Yakushima Field & Lab Report 10
parasite infection and Category 1 using Fisher’s exact tests, respectively. These tests were
used to determine whether adult male Yakushima macaques were more heavily infected by
parasites than adult females. Lastly, we investigated correlations between level of infection
and hormonal data. Correlation between Yakushima macaque sex and fecal steroid hormones,
testosterone and cortisol, were tested using Spearman's rank-order correlation coefficient.
Results
Sex identification
First, our interpretation of the electrophoresis results were based on identifying genes
ZFX/Y (associated with both sexes) and SRY (only located on the Y chromosome). We
inferred that the bands near 400 bp (base pair) were that of ZFX/Y and bands near 200 bp are
those of SRY (see Fig. 4), and determined sex in 53 fecal samples. In samples showing only
the SRY band, allele drop-out probably occurred. We judged these samples as male. The
other length bands were probably derived from DNA of bacteria or food particles in feces.
Second, we compared results of our sex determination DNA analysis with
observational sex determination data (as shown in Table 1). In 15 samples, sex based on DNA
analysis corresponded with that based on observation. However, in 10 samples, sex based on
DNA analysis did not correspond with that based on observation. As these results were not
reliable enough to use for data analysis, we used only observational sex determination data as
markers for sex for the following data analysis.
Figure 4. Example of analysis of electrophoresis Bands near 200 bp correspond with gene SRY and bands near 400 bp correspond with gene ZFX/Y. If both bands were visible, then the sex was determined to be a Yakushima macaque male. If only the ZFX/Y band was visible, then the sex was determined to be female.
Yakushima Field & Lab Report 11
Level of nematode infection We tested our two hypotheses that (1) males are more heavily infected by parasites
than females, and (2) that the immunosuppressive hormones testosterone and cortisol could
provide a proximate explanation for this male biased parasitism in our five target parasite
species: Oesophagostomum aculeatum, Strongyloides fuelleborni, Trichuris trichiura,
Streptopharagus pigmentatus, Gongylonema pulchrum. Trichuris trichiura eggs were found
in only two male samples and Gongylonema pulchrum eggs were found in one male sample
and one female sample. Both Trichuris trichiura and Gongylonema pulchrum were removed
from further analyses of parasite prevalence and EPG due to a lack of data, but were included
in the analyses of parasite richness. The remaining three species (Oesophagostomum
aculeatum, Strongyloides fuelleborni, Streptopharagus pigmentatus) were found in many of
our samples and used for analysis.
There were no significant differences in the mean parasite prevalence among all
categories (Table 3). For Oesophagostomum aculeatum (74.5%) and Streptopharagus
pigmentatus (70.9%), sample prevalence was high in all categories. Strongyloides fuelleborni
(27.3%) had lower sample prevalence than the other two parasite categories. There was no
statistical difference between males and females in sample prevalence of any species.
Overall, when comparing sample prevalence of infected hosts, Oesophagostomum
aculeatum and Streptopharagus pigmentatus had higher sample prevalence in males (82.4%
and 76.5%, respectively) than in females (70% and 70%) and juveniles (72% and 67%)
(Table 3), though these differences were not significant. There was little difference observed
Male Female Unknown Total Male 11 4 12 27
Female 5 6 15 26 Unknown 3 9 7 19
Total 19 19 34 72
Table 2. Results of comparing between DNA analysis and observation
As shown in the highlighted green box, DNA analysis did not correspond to observational data in 9 samples.
Observation D
NA
ana
lysi
s
Yakushima Field & Lab Report 12
in Strongyloides fuelleborni prevalence between juveniles (38.9%) and males (35.3%),
though females (10.0%) were notably lower than males and juveniles. Though males seemed
to have relatively higher sample prevalence of nematode infection, individual species
differences when compared to females and juveniles were not statistically significant.
In addition, parasite richness in adult males was not significantly higher than that in
adult females (see Fig. 6). These results show that we did not find a difference in sample
prevalence and EPG between males, females, and juveniles, as well as a difference in parasite
richness. Therefore, we cannot conclude from our data that there was a male bias in nematode
infection.
Figure 5. EPG in Yakushima macaque fecal samples (Kruskal-Wallis test) EPG corresponds to the number of parasite eggs per 1 gram of feces. Male category (blue) refers to sexually mature males. Female category (red) refers to sexually mature females. Juvenile category (yellow) refers to non-sexually mature Yakushima macaques of both sexes.
Yakushima Field & Lab Report 13
Figure 6. Parasite richness in Yakushima macaque fecal samples (One-way ANOVA) p = 0.3457 Male (n=17) refers to sexually mature males. Female (n=20) refers to sexually mature females. Juvenile (n=20) includes ages 1-4 years of both sexes.
Yakushima Field & Lab Report 14
Table 3. Infected hosts and sample prevalence � male female juvenile total
Total
infected 16 17 15 48non-infected 1 3 3 7
total 17 20 18 55sampleprevalence 94.1% 85.0% 83.3% 87.3%
Oesophagostomumaculeatum
infected 14 14 13 41non-infected 3 6 5 14
total 17 20 18 55sampleprevalence 82.4% 70.0% 72.2% 74.5%
Strongyloidesfuelleborni
infected 6 2 7 15non-infected 11 18 11 40
total 17 20 18 55sampleprevalence 35.3% 10.0% 38.9% 27.3%
Streptopharaguspigmentatus
infected 13 14 12 39non-infected 4 6 6 16
total 17 20 18 55sampleprevalence 76.5% 70.0% 66.7% 70.9%
Trichuristrichiura
infected 1 0 2 3non-infected 16 20 15 51
total 17 20 17 54sampleprevalence 5.9% 0.0% 11.8% 5.6%
Gongylonemapulchrum
infected 1 1 0 2non-infected 16 19 17 52
total 17 20 17 54sampleprevalence 5.9% 5.0% 0.0% 3.7%
Hormones & EPG
We first investigated the correlation between macaque sex and fecal steroid hormones.
Our results clearly showed that males had higher testosterone levels than females (see Fig. 7).
This was a significant difference (p < 0.001) and coincides with what we predicted for the
Yakushima macaque mating season. On the other hand, cortisol hormonal results showed
there were no significant differences between male, female, and juvenile categories.
Next, we investigated the relationship between both steroid hormones (cortisol and
testosterone) and parasite EPG. Only samples that were infected with parasites were used
within the hormonal analysis data set. Our hormonal results showed, when only analyzing
Yakushima Field & Lab Report 15
males and females, that there were almost no significant correlations between hormones and
EPG of each parasite species (see Fig. 8). However, there was a negative correlation (-0.59, p
< 0.026) between female cortisol and Oesophagostomum aculeatum EPG (see Fig. 9).
Figure 7. Testosterone sex difference
Wilcoxon rank sum test (p value adjustment method: Bonferroni) ***p < 0.001
Yakushima Field & Lab Report 16
Figure 8. Total EPG and hormone relationship
Spearman's rank-order correlation coefficient There is no correlation
0 500 1000 1500 2000 2500
050
010
0015
0020
0025
0030
00
0 500 1000 1500 2000 2500
050
010
0015
0020
0025
0030
00
0 500 1000 1500 2000 2500
050
010
0015
0020
0025
0030
00
Total EPG
Cor
tisol
con
cent
ratio
n (n
g/g)
Male
Female
Juvenile
0 500 1000 1500 2000 2500
010
0020
0030
0040
0050
0060
00
0 500 1000 1500 2000 2500
010
0020
0030
0040
0050
0060
00
0 500 1000 1500 2000 2500
010
0020
0030
0040
0050
0060
00
Total EPG
Test
oste
rone
con
cent
ratio
n (n
g/g)
Male
Female
Juvenile
Yakushima Field & Lab Report 17
Figure 9. Sex difference between cortisol & testosterone and Oesophagostomum aculeatum
(Spearman’s rank-order correlation coefficient, *p = 0.026) Cortisol had a negative correlation (-0.59) with Yakushima macaque adult female Oesophagostomum aculeatum EPG (top graph)
0 100 200 300 400 500 600
050
010
0015
0020
0025
0030
00
0 100 200 300 400 500 600
050
010
0015
0020
0025
0030
00
0 100 200 300 400 500 600
050
010
0015
0020
0025
0030
00
Oesophagostomum EPG
Cor
tisol
con
cent
ratio
n (n
g/g)
Male
Female
Juvenile
0 100 200 300 400 500 600
010
0020
0030
0040
0050
0060
00
0 100 200 300 400 500 600
010
0020
0030
0040
0050
0060
00
0 100 200 300 400 500 600
010
0020
0030
0040
0050
0060
00
Oesophagostomum EPG
Test
oste
rone
con
cent
ratio
n (n
g/g)
Male
Female
Juvenile
Yakushima Field & Lab Report 18
Discussion
Our aim for this study was to first test the hypothesis that Yakushima macaque males
are more heavily infected by parasites than females. Further, we predicted that the
immunosuppressive hormones testosterone and cortisol could provide a proximate
explanation for expected male-biased parasitism. There were no significant differences
between males and females in either sample prevalence or EPG of our three targeted parasite
species (Oesophagostomum aculeatum, Strongyloides fuelleborni, Streptopharagus
pigmentatus). We found no difference in parasite richness among males and females. As
expected, males did have significantly higher testosterone than females. However, contrary to
our predictions, we did not find any positive relationships between parasite EPG and either
cortisol or testosterone. Although our predictions were only partially supported by our data,
our study nonetheless provided useful information regarding parasite infection in Yakushima
macaques, and we hope these will be helpful for future researchers.
Our results showed no significant sex difference in nematode parasite EPG among
Yakushima macaque adult males and adult females. Not surprisingly, testosterone was higher
in males than in females but there was no significant sex difference in cortisol levels.
Typically, primate males have higher testosterone levels than females. Mating season will
likely show elevated levels of testosterone. Other research on captive Japanese macaques
(Macaca fuscata) report that there was a testosterone peak at about September, but due to our
short study period we could not test testosterone levels outside of the mating season
(Matsubayashi & Enomoto, 1983). Given the immunosuppressive characteristics of steroid
hormones, our second hypothesis predicted that cortisol and testosterone could explain male-
biased parasitism in our sample set.
Previous research has shown testosterone to have suppressive characteristics on the
immune system of animals (e.g. Klein, 2000; Muehlenbein & Watts, 2010). However, there is
also research that reports testosterone to have pro-immune qualities (Nava et al., 2001) with
seasonal modulation (Greenman et al., 2005). One possibility is that testosterone can actually
improve the animal’s ability to fight against parasite infection (Evans et al., 2000), though the
exact mechanisms are unclear. The handicap hypothesis (see Zahavi, 1975) states that
“handicaps” may be an honest marker of biological fitness showing one’s high quality during
mate choice. Under the handicap hypothesis, males carry the burden of immunosuppression
by maintaining high levels of testosterone but are able to somehow tolerate or resist parasite
infection. Males doing so are sending reliable signals of biological fitness to potential mates.
Yakushima Field & Lab Report 19
However, to lend further evidence supporting or refuting the handicap hypothesis would
require a different study design and more time in the field.
Cortisol has been shown to weaken the individual’s immune system (e.g. Weyts et
al., 1997). In our research, we can see that there were basically no significant positive
relationships between cortisol and EPG of any parasite species. We think it’s possible that the
influence of cortisol is not strong enough to show an obvious difference between the
individuals in our sample set. Stress-induced immune suppression may be subtler than we can
measure and it is not clear where the boundaries lie in immune suppression (Sapolsky, 2002).
Our results showed a negative relationship between cortisol and Oesophagostomum
aculeatum EPG in females (see Fig. 9). One possible explanation could be that cortisol has a
negative relationship with female dominance status, while Oesophagostomum aculeatum
appears to have a positive relationship with social rank (MacIntosh et al., 2012). We could
not test this hypothesis here. We predicted that males and females would have different levels
of cortisol, due to mating season sex differences in levels of stress, but found instead that
levels of cortisol were approximately the same for both sexes. However, one confound we
could not control for was separating mating females from non-mating females, or females
with and without infants, since we did not collect these data.
If neither testosterone nor cortisol are significantly associated with EPG across
males and females, then what are some other possible explanations? Social networks have
been found to correlate with parasite infection in Yakushima macaques (see MacIntosh et al.,
2012). Essentially, the individuals that share the most contact with other troop members will
acquire heavier parasitic infections. Age-related differences were also previously shown to be
an important factor when considering respective species differences in EPG counts
(MacIntosh et al., 2010), and was a factor we could not control for here. There are also sex
differences in strategies during inter-group encounters (Majolo et al., 2005). Japanese
macaque males have been reported to participate more during inter-group interactions and
also migrate between groups throughout their lifetimes, which through more exposure may
raise the possibility of parasitic infection.
Ultimately, our lack of a clear sex bias does not coincide with prior studies (see
MacIntosh et al., 2010). In our research, we simply collected all samples we found, and we
mostly were not able to collect more detailed information such as individual identification
and troop name that could have allowed for inter-troop analysis. Furthermore, we had a small
sample set and only collected fecal samples for approximately a 5-day period. The focus of
the research described in this report was primarily that of a field and lab course with
Yakushima Field & Lab Report 20
anywhere between 8 – 12 participants at any given part of the course, who were relatively
new to the research techniques being introduced. As such, it is probable that the individual
accumulation of variance in collection and analytical methods created noise in our data. It is
also possible that in certain periods there is no Yakushima macaque sex difference in parasite
infection. However, given several fundamental confounds in this study we are not confident
to assert our results but would rather share them as anecdotal information for future studies.
We think that individual identification, group identification, and repeated fecal sample
collection throughout the mating season would yield more promising and accurate results for
further discussion on Yakushima macaque sex biased parasitism in the mating season.
A note on sex determination from fecal samples:
Some sex determination DNA analysis results were incongruent with the results of our own
field observations. For example, the results of some hosts that were judged female by direct
observation turned out to be male in our DNA analysis, and vice versa. The most plausible
explanation for this contradiction is contamination by human males, during processing and/or
analysis. There are other possible reasons that may offer an explanation, such as that DNA
concentrations may not have been high enough. We checked the concentration of nucleic acid
in our samples, especially the results that were incongruent with our own observational data
but they were not so low compared with other samples. The concentration of nucleic acid
could be that of any species. This means that if a sample had cross-species contamination the
concentration rate may have still been high. Another possibility is that the quality of extracted
DNA may be low. Our method for taking and storing fecal samples may not be the most
effective for DNA analysis. We collected fecal samples by inserting sterilized swabs into the
center of the feces. However, previous studies report that DNA collection may be most
effective by taking the sample from the surface of feces, since cells from the lining of the gut
are more likely to be found there (e.g. Inoue, 2015). Furthermore, some samples took hours
or even a few days before DNA stabilization. This may have declined the quality of the
sample. For future studies, we recommend preparing storage tubes with lysis buffer and
collecting genetic information from the surface of the feces in order to increase genetic
information available, which may be useful during lab analysis.
Yakushima Field & Lab Report 21
Acknowledgements
The authors of this report would like to sincerely thank Dr. Hideki Sugiura and Dr. Andrew
MacIntosh for leading the field course in Yakushima and sharing their knowledge on the
island; Dr. Claire Watson for support in the field; Ms. Liesbeth Frias for teaching and
managing the field laboratory; Dr. Kodzue Kinoshita and Dr. Takashi Hayakawa for teaching
and leading the laboratory work at Kyoto University Primate Research Institute; Dr. Takushi
Kishida and Ms. Yo Sato for assistance in the lab. The research described in this report would
not have been possible without the support of the Leading Graduate Program in Primatology
and Wildlife Science (PWS), Kyoto University.
References Ader, R., Felten, D., Cohen, N. (1991) Psychoneuroimmunology, 2nd edition. San Diego: Academic Press. Bambino, T. H., & Hsueh, A. J. (1981). Direct Inhibitory Effect of Glucocorticoids upon Testicular Luteinizing Hormone Receptor and Steroidogenesis in Vivo and in Vitro*. Endocrinology, 108(6), 2142-2148. Bush, A. O., Lafferty, K. D., Lotz, J. M., & Shostak, A. W. (1997). Parasitology Meets Ecology on Its Own Terms: Margolis et al. Revisited. The Journal of Parasitology, 83(4), 575. https://doi.org/10.2307/3284227 Cumming, D. C., Quigley, M. E., & Yen, S. S. C. (1983). Acute Suppression of Circulating Testosterone Levels by Cortisol in Men*. The Journal of Clinical Endocrinology & Metabolism, 57(3), 671–673. Delves, P. J., & Roitt, I. M. (2000). The immune system. New England Journal of Medicine, 343(1), 37–49. Evans, M. R., Goldsmith, A. R., & Norris, S. R. (2000). The effects of testosterone on antibody production and plumage coloration in male house sparrows (Passer domesticus). Behavioral Ecology and Sociobiology, 47(3), 156–163. Girgis, N. M., Gundra, U. M., & Loke, P’ng. (2013). Immune regulation during helminth infections. PLoS Pathog, 9(4), e1003250. Greenman, C. G., Martin II, L. B., & Hau, M. (2005). Reproductive state, but not testosterone, reduces immune function in male house sparrows (Passer domesticus). Physiological and Biochemical Zoology, 78(1), 60–68. Inoue, E. (2015). DNA . �����, (0). Klein, S. L., Hairston, J. E., DeVries, A. C., & Nelson, R. J. (1997). Social environment and steroid hormones affect species and sex differences in immune function among voles. Hormones and Behavior, 32(1), 30–39. Klein, S. L. (2000). Hormones and mating system affect sex and species differences in immune function among vertebrates. Behavioural processes, 51(1), 149-166. MacIntosh, A. J., Hernandez, A. D., & Huffman, M. A. (2010). Host age, sex, and reproductive seasonality affect nematode parasitism in wild Japanese macaques. Primates, 51(4), 353-364. MacIntosh, A. J., Jacobs, A., Garcia, C., Shimizu, K., Mouri, K., Huffman, M. A., & Hernandez, A. D. (2012). Monkeys in the middle: parasite transmission through the social network of a wild primate. PLoS One, 7(12), e51144. Majolo, B., Ventura, R., & Koyama, N. F. (2005). Sex, Rank and Age Differences in the Japanese Macaque (Macaca fuscata yakui) Participation in Inter‐Group Encounters. Ethology, 111(5), 455-468. Matsubayashi, K., & Enomoto, T. (1983). Longitudinal studies on annual changes in plasma testosterone, body weight and spermatogenesis in adult Japanese mankeys (Macaca fuscata fuscata) under laboratory conditions. Primates, 24(4), 521-529.
Yakushima Field & Lab Report 22
McEwen, B. S. (2000). The neurobiology of stress: from serendipity to clinical relevance. Brain research, 886(1), 172-189. Muehlenbein, M. P., & Watts, D. P. (2010). The costs of dominance: testosterone, cortisol and intestinal parasites in wild male chimpanzees. BioPsychoSocial Medicine, 4(1), 1. Rivier, C., & Rivest, S. (1991). Effect of stress on the activity of the hypothalamic-pituitary-gonadal axis: peripheral and central mechanisms. Biology of Reproduction, 45(4), 523–532. Sapolsky, R. M. (1997). The trouble with testosterone: And other essays on the biology of the human predicament. New York, NY: Scribner. Sapolsky, R. M. (2002) Endocrinology of the stress response. In Becker JB, Breedlove SM, Crews D, McCarthy MM, eds, Behavioral Endocrinology. MIT Press, Cambridge, MA, 409–450. Schuurs, A. H. W. M., & Verheul, H. A. M. (1990). Effects of gender and sex steroids on the immune response.pdf. J. Steroid Biochem., 35(2), 157–172. Turnbull, A. V., & Rivier, C. L. (1999). Regulation of the hypothalamic-pituitary-adrenal axis by cytokines: actions and mechanisms of action. Physiological reviews, 79(1), 1-71. Viau, V. (2002). Functional cross-talk between the hypothalamic-pituitary-gonadal and-adrenal axes. Journal of Neuroendocrinology, 14(6), 506–513. Weyts, F. A. A., Verburg-van Kemenade, B. M. L., Flik, G., Lambert, J. G. D., & Bonga, S. W. (1997). Conservation of apoptosis as an immune regulatory mechanism: effects of cortisol and cortisone on carp lymphocytes. Brain, behavior, and immunity, 11(2), 95-105. Wingfield, J. C., & Sapolsky, R. M. (2003). Reproduction and resistance to stress: when and how. Journal of Neuroendocrinology, 15(8), 711–724. Zahavi, A. (1975). Mate selection—a selection for a handicap. Journal of theoretical Biology, 53(1), 205-214