YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Reverse Genetics in Drosophila

I. P elements in reverse geneticsA. P element insertional mutagenesis projects

B. Using P elements to make mutations

II. RNA interferenceA. Basics of RNAi

B. RNAi methods in flies

III. Targeted gene replacement

Page 2: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

target geneenhancer

lacZ white

enhancer trap: expresses Gal in same pattern as target gene

P element constructs

Page 3: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

UASwhite

controlled misexpression: expresses target gene in Gal4-dependent manner

P element constructs

GAL4 white

GAL4 enhancer trap: expresses Gal4p in same pattern as target gene

Page 4: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

yellowwhite

insulators: block enhancers and position effects on expression

P element constructs

Page 5: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

P{PZ} enhancer trap 523

P{lacW} enhancer trap 1176

P{Gal4} Gal4 expression 141

P{EP} UAS-controlled expression

P{SUPor-P} insulator

263

2076

P{GT1} gene trap 511

Mapped P element Insertion Lines(Bloomington Stock Center, as of 11/12/02)

4690

Page 6: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

w P{w+}P element onX chromosome

Sb 2-3+

P transposase(chromosome 3)

dominantmarker

Transposition of P Elements

w

+;

Y

P{w+}

new insertion on autosome

w P{w+} Sb 2-3+

;Y

w

screen forred-eyed sons

Page 7: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Spradling et al. (1995)

P elements rarely insert into coding sequences

Page 8: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

w ; P{w+} Sb 2-3+

P element onchromosome 3

P transposase(chromosome 3)

dominantmarker

w

Excision of P Elements

Sb 2-3

P{w+}w

Y;

w

+;

Y

P{w+}**

screen for loss of w+, indicating excision

Page 9: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

white

P transposase

...ATGCCAAACATGATGAAATAACATAAGGTGGTCCCGTCG...

...TACGGTTTGTACTACTTTATTGTATTCCACCAGGGCAGC...

31-bp P inverted repeat8-bp target site

P transposase

...ATGCCAAACATGATGAAATAACATA

...TACGGTTT17-nt 3’ overhang

Page 10: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

different products, depending on: template for repair

extent of repairgap widening before repair

non-homologousend-joining homologous

recombination

(double-strand break)

Page 11: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

whi

internal deletion of P element (w-)sometimes alters expression of target gene

A. Repair using sister chromatid as a template

white

restoration of P element (w+)

B. Repair using homologous chromosome as a template

precise excisionuseful for proving that phenotypes are due to P element insertion

Page 12: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

C. “Imprecise excision”

exonuclease

repair

deletion of flanking DNA

Page 13: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

RNA Interference

dsRNA

Dicer endonuclease

21-23 bp (or nt) siRNA

destroy mRNA

find complementary mRNA

(RISC complex)

Page 14: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Functions for RNA Interference

Repression of repeated genes (e.g., transposable elements)Defense against viruses (plants)

Developmental control of gene expression (small temporal RNAs)

X chromosome inactivation (mammals)

Silencing of mating type loci and centromeric regions (S. pombe)DNA elimination in macronuclei (Tetrahymena)

Experimental manipulation of gene function.

Page 15: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

RNAi Methods in Drosophila

1. Addition of dsRNA to cell culture

2. Injection of dsRNA into embryos

3. Expression of hairpin RNA in vivo.

UAS

Gal4

RNA

dsRNA

Page 16: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Gene Targeting Technologies

S. cerevisiaeGenerate linear targeting DNA by PCR

Transform suitable strain

Plate on medium for positive selection (10-

8?)M. musculus

Generate targeting DNA by cloning, cutting

Transform ES cells

Conduct positive and negative selections (typical = 10-7)

Page 17: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Gene Targeting in Drosophila

ProblemsNo culture system for germline stem

cellsDNA introduced by injection in single embryos

Existence of DNA repair in early development questionable

Solution (Rong and Golic)Generate linear DNA in vivo:

Obtain stable transformants of donor construct

Use FLP – FRT system to excise donor DNA from chromosome

Use I-SceI to linearize donor DNA

Use visible marker gene to screen for potential homologous gene replacements

Page 18: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

FRT

FLP Recombinase Catalyzes Exchange BetweenTarget Sequences (FRTs)

FLP recombinase

crossover

Page 19: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

FRTFRT

Intrachromosomal Recombination Between Tandem FRTsResults in Excision from the Chromosome

extrachromosomal circlewith 1 FRT

chromosome with 1 FRT

Page 20: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

5' ATTACCCTGTTATCCCTAAATT 3'3' TAATGGGACAATAGGGATTTAA 5'

5' ATTACCCTGTTAT CCCTAAATT 3'3' TAATGGGAC AATAGGGATTTAA 5'

I-SceI

I-SceI makes a double-strand break at an 18-bptarget sequence

Page 21: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

FRTFRT

donor construct (integrated P element)

I-SceI site

FLP recombinase

extrachromosomal circular donor

Page 22: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

I-SceI endonuclease

DSB

*

*

integration

tandem duplication

Page 23: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

w+ *

FLP recombinaseI-SceI endonuclease

*

*w+

integration

Page 24: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

*w+

I-CreI endonuclease

*w+

DSB

I-CreI site

*

Repair of a DSB between direct repeats

Tandem Duplications can be Reduced to Single Copy

Page 25: Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II.

Reverse Genetics in Drosophila

I. P elements in reverse geneticsA. P element insertional mutagenesis projects

B. Using P elements to make mutations

II. RNA interferenceA. Basics of RNAi

B. RNAi methods in flies

III. Targeted gene replacement


Related Documents