Pyrosequencing
Experience from Mumbai, India
Camilla Rodrigues MD
Consultant Microbiologist
Hinduja Hospital,Mumbai
India
Mumbai ……maximum city
With increasing drug resistance, DST is vital
Liquid Culture
& DSTMolecular Tests
Solid Culture
& DST
Suspected MDR Case
Rapid diagnosis with DST is fundamental
Slo
w
Fas
t
1-2
D
India’s PMDT Scale up
Diagnostic algorithm for DR TB
Guidelines on Programmatic Management of DR TB in India 2017
Beyond Xpert & LPA : Sequencing in the DR TB world
- Sanger Sequencing
- Pyrosequencing (PSQ)
- Targeted NGS
- Whole Genome Sequencing
PSQ Outline
• Principle & Cost
• Clinical applications
• Challenges
What is pyrosequencing ?
Real time diagnostic DNA “ sequencing by synthesis ”
based on actual short segment sequencing (<100bp )
at a speed of 1 min / nucleotide
Unlike Sanger sequencing ( chain termination with dideoxynucleotides),
PSQ relies on pyrophosphate detection on nucleotide incorporation
Can produce clinically relevant results in < 6 hrs from clinical samples
Flexible & adaptable to regional prevalence specifics & new mutations
• DNA extraction
• PCR amplification of 8 specific targets
• Post PCR, biotinylated ss DNA template is
coupled to streptavidin coated beads
• Pyrosequencing
• Software analysis search for 100% identity match in
target library containing all expected mutations
1. Iterative dNTP dispensation only 1 at a time the order determined by known mutations
2. Incorporation of dNTP generates PPi .
3. PPi reacts with substrate & triggers a series of
chemical reactions catalyzed by enzymes.
4. Nucleotide incorporation catalyses a flash of light
5. Apyrase degrades unincorporated dNTP & ATP
6. Pyrogram shows a sequential event of dNTPs
incorporated
Pyrosequencing : cascade of enzymatic reactions
Pyrogram
10
Target: inhA
promoter
100% match with
wild type sequence.
<Sequence read
<Nucleotide Dispensation
Detecting a rpob mutation
Query 1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
Library1 TGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCC 42
Complementary nucleotide to the base strand is accompanied
by release of pyrophosphate (PPi) which generates light
12
Target Location Mutations Length
M tuberculosis
complexIS6110 - 24
Isoniazid
katG 312 – 316 5 13
inhA promoter - 4 to -20 7 17
ahpC- oxyR - 4 to -23 5 24
Rifampicin rpoB 507-521
522-533
32 45
35
Fluoroquinolone gyrA 88-96 13 25
SLI
KAN,AMK,CAPrrs 1397-1406 2 10
KAN eis -6 to -47 5 42
PSQ : detecting > 64 mutations in < 6 hrs
PyroMark Q24 PyroMark Q96 ID PyroMark Q96 MD PyroMark Q48/ Q96
MD Automated
Throughput 1–24 samples 1–96 samples 1–96 samples 10–960 with automation
option
Running volume 25 µl 40 µl 12 µl 12 µl
Read lengths SQA ~50 – 100 bp
SNP ~10 – 100 bp
AQ ~10 – 100 bp
CpG ~10 – 120 bp
SQA ~50 – 70 bp
SNP ~10 – 100 bp
AQ ~10 – 100 bp
CpG ~10 – 120 bp
SNP ~10 – 100 bp
AQ ~10 – 100 bp
CpG ~10 – 150 bp
SNP ~10 – 100 bp
AQ ~10 – 100 bp
CpG ~10 – 150 bp
Main applications Genetic testing
Epigenetics
Microbilogy
Genetic testing
Epigenetics
Microbiology
Epigenetics
Genetic testing
Epigenetics
Genetic testing
(SNP/AQ only in batch mode)
Sensitivity 5% limit of detection 10% limit of detection 2% limit of detection 2% limit of detection
PSQ : Instrumentation
PSQ : cost
Equipment :
Pyromark Q 48 : approx INR 50 lakhs
Q 96 : approx INR 75 lakhs
Consumables :
TB & XDR detection :approx INR 4500 per sample with controls
PSQ Outline
• Principle & Cost
• Clinical applications
• Challenges
BMC Infect Dis 2016;16:458
: implications for global implementation
PTB : PSQ Sequencing success by Smear & Culture
BMC Infect Dis 2016;16:458
PSQ success for each target region stratified by smear and culture
What do we use Pyrosequencing for ?
(i) Smear Positive Samples with a LPA WT band present
but no corresponding mutant band or LPA indeterminate
(ii) Smear negative TB : PTB & EPTB
(iii) Resolving discordant Xpert & MGIT DST
(iv) Confirming RIF Resistant in Xpert MTB detected very low
20
Resistant Phenotype Reference
Genes
DR conferring
mutations
No(%) Detected ONLY
WT absent
Only WT absent
with no Mutant
band
INHR kat G
inhA
S315T1/ S315T2
C15T
A16G
T 8C
1728 (87%)
202 ( 9.2%)
27 (1.23%)
katG 315
inhA -15
-16
-8
49(2.23%)
-
-
RIFR rpob D516V
H526Y
H526D
S531L
32 ( 1.4%)
6 ( 0.2%)
4 ( 0.18%)
1717 (93%)
WT 1 : 505-509
WT 2 : 510-513
WT 2/3 : 510-517
WT 3/4 : 513-519
Wt 4/5 : 516-522
WT 5/6 : 518-525
WT 7 : 526-529
WT 8 : 530-533
-
12(0.5%)
8 (0.3%)
13 (0.5%)
6 (0.27%)
-
52 (2.3%)
21 (0.95%)
OFXR gyrA
gyrB
A90VS91P
D94A
D94N/Y
D94GD94H
N538D/ E540G
318 (26%)14 (1.1%)
30 (2.4%)
21 (1.73%)
423 (64%)12 (1%)
2 (0.1%)
gyrA
WT1 : 85-90
WT2 : 89-93
WT3: 92-97
gyrB WT1 : 538-540
-
-
48 (3.96%)
4 ( 0.3%)
KANR
KANR /AMKR / CAPR
eis
rrs
C14T
A1401GG1484T
4 (0.33%)
106 (94%)
eisWT1: G37T,
WT2: -10-14 : WT3 : -2
rrs WT 1: 1401-1402
WT2 1484
5 (0.4%)
44 (3.63%)
9 (0.8%)
HNH 2017 : DR conferring mutations detected by MTBDRplus & MTBDRsl
Comparison of PSQ, GenotypeMTBDR & MGIT DST
Incremental increase in
SNP identification
RIF : 13%
FQL : 8.2%
Tuberculosis 2018 ;110:86-90
Drug Number PSQ mutations / confidence
Rifampicin rpoB 13 / 100 L511(1) Minimal
Q513K (2) High
D516Y (1) Moderate
D516Y+533gag (1) Moderate
H526P(1) Moderate
H526C (1) High
H526L (1) High
S531Q (1) High
L533P (4) Moderate
FQL gyrA 5 / 61 G88C+S95T(1) High
94gtc +S95T(1) ?
Phenotypic MGIT Susceptible with PSQ mutations
Tuberculosis 2018 ;110:86-90
What do we use Pyrosequencing for ?
(i) Smear Positive Samples with a LPA WT band present
but no corresponding mutant band or LPA indeterminate
(ii) Smear negative TB : PTB & EPTB
(iii) Resolving discordant Xpert & MGIT DST
(iv) Confirming RIF Resistant in Xpert MTB detected very low
Case 1 PM 32 F
Miliary TB : DOTS for 3 months
A month later developed seizures
Tuberculomas found
Sputum Xpert MTB / RIF R
Smear negative : LPA indeterminate
TB MGIT culture done
Case 1 : Sputum Pyrosequencing
Rifampicin R Fluoroquinolone R
rpob S531L gyrA D94G
Isoniazid R
katG S315T
Global Consortium for Drug resistant TB Diagnostics (GCDD) funded by NIH, USA : Grant #5U01AI082229
Case 1 ….
PreXDR (katG S315T,rpoB S531L & gyrA D94G)
Treated with KAN, CLF, LZD ,PAS, ETH
Follow up well at 6 months
What do we use Pyrosequencing for ?
(i) Smear Positive Samples with a LPA WT band present
but no corresponding mutant band or LPA indeterminate
(ii) Smear negative TB : PTB & EPTB
(iii) Resolving discordant Xpert & MGIT DST
(iv) Confirming RIF Resistant in Xpert MTB detected very low
Case 2
19 year male being treated elsewhere
diagnosed as Pulmonary TB
H300R450E800Z1500
2 months later, developed abscess Left palm
Drained pus, smear + , MGIT culture neg
Case 2 …..
4 Months later developed abscess in Lt ankle
Amikacin & levoflox added
Abscess in Rt forearm, Smear +
MGIT : No growth after 6 weeks
3 months later
Pus from Rt forearm , Smear +
MGIT : No growth at 6 weeks
MTB detected
Isoniazid : katG
No mutations
Isoniazid :inhA
No mutation
Isoniazid ahpC
No mutations
FLQ : no mutations
SLI : rrs
No mutations
Pyrosequencing : No mutations detected
v
RIF : no mutations RIF : no mutations
TB : Treatment failure…
…not always drug resistance
Compliance
Dosage issues
Absorption of drugs
Poor quality drugs
Drug Interactions
Penetration at site
TBM
To date…67 TBM suspects, 46 PSQ + ve,17 MGIT culture + ve, 21 Xpert + ve
• Drug resistance
• Paradoxical response
• Adequate drug penetration • Vasculitis / infarcts
• Hyponatremia
• Brain edema
• Hydrocephalus
• Seizures
• Mixed infections ( HIV )
Dilemmas in the management of TBM / tuberculomas
Penetration of TB drugs
High (>90%): Isoniazid, Pyrazinamide,
Ethionamide
Intermediate (60-90%): Levofloxacin, Moxifloxacin,
Linezolid, Cycloserine
Low (<50%): Rifampicin, Streptomycin,
Amikacin, Capreomycin
Ethambutol
Case 3
AK 16 years
TBM
Started on HRZE & steroids
partial improvement
After tapering of steroids,
c/o severe headache
Intercisternal tuberculomas with exudates
Referred to ID
Case 3 …..
? DRTB or paradoxical response
Xpert : Not detected
PSQ: INH mono R katG 315ACC
•INH replaced with ETH (better CSF penetration & EBA)
•Re started steroids
Patient improved on FU
What do we use Pyrosequencing for ?
(i) Smear Positive Samples with a LPA WT band present
but no corresponding mutant band
(ii) Smear negative TB : PTB & EPTB
(iii) Resolving discordant Xpert & MGIT DST
(iv) Confirming RIF Resistant in Xpert MTB detected very low
• Operator related
• Protocol related
• Heteroresistance
• Inadequate knowledge about mutations
Lung India 2018;35(2):168-170
Repeat Xpert RIF: Resistant
Check LJ for 2 types of colonies Repeat Xpert RIF
Susceptible
Send isolate for WGS
Repeat Xpert RIF : Resistant
Perform PSQ for the exact SNP
Perform RIF MIC at 0.25 /
0.12
Xpert MTB/ RIF : Susceptible
MGIT DST RIF : ResistantXpert MTB / RIF : Resistant
MGIT DST RIF : Susceptible
Repeat Xpert from original MGIT tube
Repeat Xpert RIF: Resistant
Check LJ for 2 types of
colonies (Heteroresistance)
Repeat Xpert RIF
Susceptible
Send isolate for WGS
Repeat Xpert RIF : Resistant
Perform PSQ for the
exact SNP
Perform RIF
MGIT MICs at
0.25 /0.12
Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST
Lung India 2018;35(2):168-170
Mechanisms that underlie resistance
Drug resistance in M. tuberculosis is a mixed bag: significant heterogeneity is present with
low, moderate & high level phenotypic resistance
In high incidence settings
an average of 17% of new TB cases, can be multiply infected
Clin Microbiol Rev 2011; 2 : 314-350. doi: 10.1128/CMR.00059-10.
Upper lobectomy specimen
of a 19 year old male with MDR-TB
Understanding heterogeneity
Within the lung, each lesion is
independent & engaged
in various phases of immune battles
at diff metabolic states of TB bacilli
Single infecting strain showed heteroresistance
Mixed infection in presence of hetero resistance could worsen outcome.
Repeat Xpert RIF: Resistant
Check LJ for 2 types of colonies Repeat Xpert RIF
Susceptible
Send isolate for WGS
Xpert MTB/ RIF : Susceptible
MGIT DST RIF : Resistant
Repeat Xpert from original MGIT tube
Repeat Xpert RIF: Resistant
Check LJ for 2 types of
colonies (Heteroresistance)
Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST
Lung India 2018;35(2):168-170
Repeat Xpert RIF Susceptible
Send isolate for WGS
Xpert MTB/ RIF : Susceptible
MGIT DST RIF : Resistant
Repeat Xpert from original MGIT tube
Repeat Xpert RIF
Susceptible
Send isolate for WGS
Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST
Lung India 2018;35(2):168-170
Repeat Xpert RIF : Resistant
Perform PSQ for the exact SNP
Perform RIF MIC at 0.25 /
0.12
Xpert MTB / RIF : Resistant
MGIT DST RIF : Susceptible
Repeat Xpert from original MGIT tube
Repeat Xpert RIF : Resistant
Perform PSQ for the
exact SNP
Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST
Lung India 2018;35(2):168-170
Repeat Xpert RIF : Resistant
Perform PSQ for the exact SNP
Perform RIF MIC at 0.25 /
0.12
Xpert MTB / RIF : Resistant
MGIT DST RIF : Susceptible
Repeat Xpert from original MGIT tube
Repeat Xpert RIF : Resistant
Perform RIF MICs
Discrepant samples : Algorithm for Xpert MTB / RIF & MGIT DST
Lung India 2018;35(2):168-170
Rif R maybe missed for specific rpoB mutations
What do we use Pyrosequencing for ?
(i) Smear Positive Samples with a LPA WT band present
but no corresponding mutant band
(ii) Smear negative TB : PTB & EPTB
(iii)Resolving discordant Xpert & MGIT DST
(iv) Confirming RIF Resistant in Xpert MTB detected very low
Xpert MTB Detected
Caution : False Resistant in MTB Detected VERY LOW
In RIF DST S & Xpert R,
PSQ confirmed no mutations in 10/40
Confirming in RIF R in MTB DETECTED VERY LOW in non MDR suspects
Submitted
PSQ Outline
• Principle & cost
• Clinical applications
• Challenges
PSQ : challenges
• Homopolymers (more than 3-4)
Homopolymer string (mainly T) regions influence synchronized extension & synthesis of DNA strand
causing non uniform sequence peak heights, affecting read length & possibly cause sequence errors
• In Smear negative, low sensitivity of gyrA & rpoB
• Indeterminate readings (instruments issues, mixed population, new minority mutations)
• Technical expertise essential
• PSQ currently standardised for XDR defining drugs
PLoS One 2015 :10(1):e0116798
Higher rates of Pre XDR TB than MDR TB (56.8% vs 29.4%)
Genetic resistance markers
Drug Mechanism of Action Genetic Marker Function Frequency (%)
Drug Mechanism of Action Genetic Marker Function Frequency (%)
Advantages for WGS Sequencing
1) WGS captures complete genetic mutational profile in one test.
2) New mutations identified that relate to adaptive responses (compensatory mutations).
Genetic resistance markers
WGS for DR conferring mutations
XDR drugs : <10% ( LPA WT absent with no mutant)
Oral FLD : Ethambutol , PZA
Oral SLD : Ethionamide, PAS, cycloserine
Re purposed drugs : CFZ, LZD
New Drugs : BDG, DLD
History will judge us not by our scientific
breakthroughs, but how we apply them…