Nimes ECA Course27 February 2012
Plant Molecular Cytogenetics
Trude [email protected]
www.molcyt.comIncluding talk slides!
www.molecularcytogenetics.comUserID/PW ‘visitor’
The most popular garden varieties are sterile, diploid or triploid interspecific hybrids
‘Golden Yellow’ triploid 2n=3x=14C. flavus 2n=2x=8 (8 yellow) C. angustifolius 2n=2x=12 (6 green)
Orgaard, Jacobsen & HH
‘Stellaris’ hybrid diploid 2n=2x=10C. flavus 2n=2x=8 (4 green)
C. angustifolius 2n=2x=12 (6 blue)
Metaphase I in triploid Golden Yellow Crocus
In many metaphase I cells of this triploid, we see four bivalents from pairing of the four pairs of C. flavus (2n=2x=8)-origin chromosomes, with the six chromosomes from C. angustifolius (2n=2x=12) present as univalents. Alternative configurations also seen.
Antibodies below to meiosis components
Plant genome sizes vary over a 2350-fold range
Plant Molecular CytogeneticsPlant chromosomesPlant genomes and their sizesDNA components of a chromosomeRetroelementsChromosomes and sources of genetic markers
Chromosome and genome paintingPolyploids and cereal chromosome evolutionPlant breeding and aliens
Part I:
Part II:
Centromere Telomere
Somatic metaphase chromosomes
Arabidopsis Human Pine
Darwin: The final paragraphof “The Origin”
It is interesting to contemplate … many plants of many kinds … and to reflect that these elaborately constructed forms, so different from each other
… .have all been produced by laws acting around us … from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved.
OBJECTIVESFundamental and Practical
Explain major structures and features of the DNA in plant genomesUnderstand the structure of chromosomes and genomesExplain the nature and origin of molecular markersUnderstand key events in evolution and generation of diversity including induced mutations
OBJECTIVES Fundamental and Practical
Understand how genomes and diversity can be manipulated and exploited Relate genome information and models to the applications in the genome of particular speciesDecide which molecular markers are appropriate for various applications Introduce the concept of superdomestication into breeding programmes and consider solutions to major problems facing breeders and farmersUse the literature relating to genomics, genetics and plant breeding and communicate it in writing
The Genome and ChromosomesThe DNA is organized in multiple chromosomesEach is a single, linear DNA moleculeThe DNA is packaged around proteins (histones)The nuclear chromosome has special sequences at its ends
There are separate genomes in the plastids and mitochondriaThere can be viral and bacteria-like genomes in the nucleus and cytoplasm
Genes!
Repetitive DNA-Sequences form the largest part of the genome
Arabidopsis thaliana>25% 145 MbpSugar beet Beta vulgaris 63% 758 MbpBroad bean Vicia faba 85% 12000 MbpRye Secale cereale 92% 8800 MbpOnion Allium cepa 95% 15100 Mbp
These species are all diploid – 2x
Species Repetitive DNA Genome size
Human Homo sapiens 35% 3000 Mbp
Arabidopsis thaliana 2n=10
Arabidopis suecicaHybrid A. arenosa (pAa214 green) X A. thaliana (180bp
red)
Kamm, HH et al.
ancestral
A B C D
High-copy number High-copy number High-copy number High-copy number
E F
Low-copy number Low-copy number
New species-specific variants
High copy spp: homogenized old (ABC) or new (D) variants
Low copy spp: most old variants in low copy number (EF)
See Kuhn, HH et al. 2009. Heredity& 2008. Chr. Res.
Organelle sequences
from chloroplasts or
mitochondriaSequences from
viruses, Agrobacterium or
other vectors
Transgenes introduced with molecular biology
methods
Genes, regulatory and non-coding single copy
sequences
Dispersed repeats:Transposable Elements
Repetitive DNA sequences
Plant Nuclear Genome
Tandem repeats
DNA transposons copied and
moved via DNA
Retrotransposons amplifying via
an RNA intermediate
Centromeric repeats
Structural components of chromosomes
Telomeric repeats
Simple sequence repeats or
microsatellites
Repeated genes
Subtelomeric repeats
45S and 5S rRNA genes
Blocks of tandem repeats at discrete
chromosomal loci
DNA sequence components of the plant nuclear genomeHeslop-Harrison & Schmidt 2012. Encyclopedia of Life Sciences
Other genes
Derivative chromosome 1R of Lines 7-102 and 7-169Derivative chromosome 1R of Lines 7-102 and 7-169
04/13/23
Oil Palm
32 chromosomes DAPI; TTTAGGG telomere; 45S rDNA (1 major pair + minor)
5S rDNA (1 major + minor)
RepetitiveSequences
The majority of the genomic DNA in most species (95% sometimes)Tandem RepeatsSimple Sequence Repeats Dispersed RepeatsFunctional RepeatsRetroelements
RetrotransposonsClass I transposable elementsRNA intermediate
DNA transposonsClass II transposable elements
Cut-and-paste
Genome Specificity of a CACTA (En/Spm) Transposon
B. napus (AACC, 2n=4x=38) – hybridized with C-genome CACTA element redB. oleracea (CC, 2n=2x=18) B. rapa (AA, 2n=2x=20) Alix & HH 2008
Triticale:wheat x ryehybrid
Total genomic DNA can be used as a probe to distinguish
• Genomes in Genomes in sexual hybridssexual hybrids
• Alien Alien chromosome chromosome introgressionintrogression
dpTa1
Aegilops ventricosaDDNN
ABDN
AABBDDNN MarneAABBDD
CWW1176-4
Rendezvous
Piko
VPM1 Dwarf A
96ST61
Virtue
×
×
×
×
Hobbit
× {Kraka × (Huntsman × Fruhgold)}
Triticum persicum Ac.1510AABB
Inheritance of Inheritance of Chromosome Chromosome
5D5D
rRNA gene expression in Triticale
Four expression sites Six gene sites
Modification of DNA Methylation
Methylation widely implicated in gene expression controlTreat with 5-azacytidine
N at carbon-5 position not C so –CH3 cannot be added
Effect of treatment on Triticale
Ag-NOR methodsee www.methods.molcyt.com methods page
Copyright restrictions may apply.
Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
Adpg2-1
Glu-1
Xpsr161
Xpsr957
Xpsr381
5SrRNANor-1
(d) Em
Gli-1
Tri-1
Physical map vsGenetic map
Genes are often clusteredGenes (and recombination)
are often distal
Wsm-1: only effective source of resistance to Wsm-1: only effective source of resistance to WSMVWSMV
dpTa1 digoxigenin
IWG genomic DNA biotin
Wild banana species:Musa acuminata – A genome Musa balbisiana – B genomeBasic chromosome number n=x=11 Genome size c. 550 MbpMost cultivated hybrids are 2n=3x=33
Retroelement Markers
Retrotransposon LTRLTR
Retrotransposon LTRLTR
RetrotransposonLTR LTR
Retrotransposon LTRLTR
Insertion
IRAP – InterRetroelement PCR
Retrotransposon LTRLTR
RetrotransposonLTR LTR
IRAP diversity in Musa
Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant BiolNair, Teo, Schwarzacher, HH 2006 Euphytica Desai, Maha…, HH et al. in prep.
13/04/23
TCCCTGAG: 8-bp TSD.30-bp TIRs
273-bp hAT
ACCCACCTGGCTCTTGTGTCATACCATTGAAAAGCCGATTATATTTGTCCCCATTCATCCAAAAGATCCCTGAGCAAGGTCTGCCATACCGTACCGTACCGGCGTTTCGACCCGGGCTCGGTACGGTACCGGTGTACCGGGCAGTACATCAGGGTGTACCGAATGGTACACCCTGATGTACCGAACAATTTTATACTTTTTCATACTGTAGCAGTGCTACAGTATAATACTGTAGCACTGTAGCGGTATCGGGCGGTCCGCGTACCGGTAACCTGTCGGACCGGTACATACCGCCCGGTATCGGCGGTACGCTTCGGTATGACAGACCTTGTCCCTGAGTATATATCTCTTTTCTAAATTTATGACCACTCCAAGGCAACTTGCCAAAGAAAATGAAAAGAAGAAAAAAATTAGGGGAATGAAGATTCTCCACAATTCCTTATTCTTTGATTTGAGATAAATAATGTCCATAGTAAAACATATCTTATGATCATCATTGCTGATTAATCAAAATACCTGATTCTATAGTCTCAAGCTTTAGTGGTCAAAACACATTCGC
TSD TIR TIR TSD
hAT1 in Musa acuminataF and R primers indicated by blue arrows in sequence
Musa balbisiana
Mu
sa
acu
min
ata
41
a)
b)
13/04/23 42
HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
1KB800600400200
hAT1 insertion sites in Musa diversity collectionhAT486F and hAT037RTop bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only
Nuclear Copies of Banana Streak Virus in Banana
DNA Fibre Hybridization
EvolutionEpigeneticsDevelopment
PhenotypeMultiple abnormalities
Genetic changes non-reverting
Changes seen, some reverting
(Male/Female)Normal Differentiation
CauseChromosomal loss, deletion or
translocationGene mutation / base pair changes
Telomere shorteningRetro)transposon insertion Retrotransposon activation
SSR expansionMethylation
HeterochromatinizationChromatin remodellingHistone modification
From Chromosome to Nucleus
Pat Heslop-Harrison [email protected] www.molcyt.com
United Nations United Nations Millennium Development Goals- MDGsMillennium Development Goals- MDGs
• Goal 1 – Eradicate extreme Goal 1 – Eradicate extreme poverty and hunger poverty and hunger
•Goal 2 – Achieve universal primary educationGoal 2 – Achieve universal primary education
• Goal 3 – Promote gender equity Goal 3 – Promote gender equity and empower womenand empower women
• Goal 4 – Reduce child mortalityGoal 4 – Reduce child mortality• Goal 5 – Improve maternal Goal 5 – Improve maternal
health health • Goal 6- Combat HIV/AIDS, malaria Goal 6- Combat HIV/AIDS, malaria
and other diseasesand other diseases• Goal 7 - Ensure environmental Goal 7 - Ensure environmental
sustainabilitysustainability• Goal 8 - Develop a global Goal 8 - Develop a global
partnership for developmentpartnership for development
Conventional Breeding
Superdomestication
Cross the best with the best and hope for something better
Decide what is wanted and then plan how to get it- variety crosses- mutations- genepool
- genes
50 years of plant breeding progress
CytoGenomics …
The genepool has the diversity to address these challenges …New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool
Nimes ECA Course27 February 2012
Plant Molecular Cytogenetics
Trude [email protected]
Website: www.molcyt.com orwww.molecularcytogenetics.com
UserID/PW ‘visitor’To download full text of papers