YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

INEC annual meetingGranada, May 25-26, 2000

Universitat de les Illes Balears andIMEDEA (CSIC-UIB)

Area de Microbiología Departamento de Biología y

Departamento de Recursos NaturalesVicente J. Benedí

Locust bean or guar? Locust bean or guar? Molecular methods for detecting additions Molecular methods for detecting additions

of guar gum to locust bean gumof guar gum to locust bean gum

Page 2: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

E 410 vs. E 412: what the EC says (I. Definitions)Off. J. of the E.C. L334, 09.12.98

E 410Locust bean gum is the ground endosperm of the seeds of the natural strains of carob tree, Cerationia siliqua (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannansE 412Guar gum is the ground endosperm of the seeds of the natural strains of guar plant, Cyamopsis tetragonlobus (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans

Page 3: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

E 410 vs. E 412: what the EC says (II. Identification) Off. J. of the E.C. L334, 09.12.98

E 410A. Positive tests for galactose mannoseB. Microscopic examination (see next slide)C. Solubility: soluble in hot water, insoluble in ethanol

E 412A. Positive tests for galactose mannoseB. Solubility: soluble in cold water

Page 4: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

E 410 vs. E 412: what the EC says (II. Identification)

B. Microscopical identification(Place some…containing 0.5% iodine and…and examine under the microscope.)

Locust bean gum contains long stretched tubiform cells, separated or highly interspaced. Their brown contents are much less regularly formed in guar gum. Guar gum shows close groups of round to pear shaped cells. Their contents are yellow to brown.

E 410 E 412

Page 5: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

E 410 vs. E 412: what the EC says (II. Identification)

Control LBGControl Guar gum

A B

Page 6: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Other methods from literature

• Methods based on the polysaccharide composition• Galactose to mannose ratios

• Methods based on the polysaccharide composition and structure• Lectin assays

Page 7: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Mannose to galactose ratios (I)

• EC says nothing in E 410 and E 412 descriptions

• But when describes E 417 says that mannose:galactose ratios are– 3:1 for E 417

– 4:1 for E 410

– 2:1 for E 412

(m-m-m-m-m-m-m-m-m-m-m-m)nIg Ig Ig Ig

(m-m-m-m-m-m-m-m-m-m-m-m)nIg Ig Ig IgIg Ig

(m-m-m-m-m-m-m-m-m-m-m-m)nIg IgIg

Page 8: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Mannose to galactose ratios (II)

• 4:1 for E 410; 2:1 for E 412• But, different ratios have been described:

– 3.0:1 and 1.5:1 (Preuss and Their, Z Lebensm Unters Forsch, 175:93, 1982)

– 2.7:1 and 1.4:1 (Angelini et al, Riv Soc Ital Alim, 13:479, 1984) – 3.7:1 and 2.3:1 (Cheetham et al, Carbohyd Pol 6:257, 1986)

– 3.7 to 7.7:1 depending on the solubilization temperature of E 410 (Lopes da Silva and Gonzales, Foof Hydrocol. 4:277, 1990)

Page 9: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Mannose to galactose ratios (III)

• Variations difficult demonstration of E 412 presence in E 410/E 412 mixtures

• Furthermore, man:gal ratios will be affected if other food additives (e.g., man from E 415)

• Also, man and gal can be present in processed foods, thus affecting the man:gal ratios

Techniques are cumbersome and require complex extractions

Page 10: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Lectin assays• Lectins are plant proteins which bind polysaccharides• Different lectins bind different polysaccharides• Patel et al. (Leatherhead Food RA)

immobilized lectin

lectin binds guarbut not LBG

bound guar is detected with the

same lectin labeled with an

enzyme

LBG

GUAR

color readings

lectinguar

LBGenzyme

support

Page 11: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Enzyme-Linked Lectin Assay (ELLA)

LBG Guar Tara E 410 commercial samples

Opt

ical

den

sity

1.2

0.8

0.6

0.4

1.0

0.2

0

buffer

Page 12: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Development of new (DNA-based) methodsE 410Locust bean gum is the ground endosperm of the seeds of the natural strains of carob tree, Cerationia siliqua (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannansE 412Guar gum is the ground endosperm of the seeds of the natural strains of guar plant, Cyamopsis tetragonlobus (L.) Taub. (family Leguminosae). Consists mainly of a high molecular weight hydrocolloidal polysaccharide, composed of galactopyranose and mannopyranose units combined through glycosidic linkages, which may be described chemically as galactomannans

Page 13: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

DNA and its building blocks

Page 14: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Examples of languages (messages)

English

MusicalScore

Morsecode

Chinese

DNA

Page 15: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

DNA vs. amino acid information

Page 16: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

DNA information is conserved

Page 17: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

The Polymerase Chain Reaction

Page 18: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Amplification step of the PCR

Page 19: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Seeds as sources of DNA• Germination of seeds (carob and guar)• Extraction of DNA from fresh tissues• PCR amplification of extracted DNA• Electrophoretic analysis of amplification products

Marker 1 Marker 2

LBG

LBG

GUAR

GUAR

Page 20: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Unveiling the Markers sequences

Marker 1 Marker 2

LBG

LBG

GUAR

GUAR

• Isolation of markers from gel• Sequencing

GUAR sequence (Marker 1)ACCTTCCTCTTCAGCATTGTTCCAAAGGCATCCACTTGGACGCCTTCCTAGTAACAGCTACGGAGTGTTCGTCAGGCTGGGCACTTGAACAAAACGAATAAATCCCAACCAAACCCCGCACAGTTTTGTGCGGCTGGAAGGAAACCAACCCTCAACAGACGGAACGCACCGAAAGAGAATCGGAAATTGTTTGGGTGGCCGCGATGTGCGCGGTTCCTTTGAATTGANAAGACACGCGGGAACGGTCGGGCCATTGCCACGACACATCCAACNCAAATCTATGTACTTAGTTTTACTGAGAGCCGTTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCGT

CAROB TREE sequence (Marker 1)ACCTTCCTCTTCAGCATTGTTCCAAAAGCATCCACTTGGACACCTTCCTAGTAACAGCTACGGAGTGTTTTGCTTGCTGGACGCTTAACCAATTTGATAGCCCCCGCCCCCCGCACGCAGGAGGGTTCGGAGGTACAGCCCTCCGCGGACACCGGGGGGCGGTGAGCACGATGGAGCTGGTTTTTTGATTGGGACCGCAAATTGCGCGGTTCCTTGATGTTGGTCACTCGCACGAGGGCTACTGGACCATTGCCGCTAGCTAGCTACTCGCAGCACTGTAAGAATAGGTTTTACTGAGAGCCATTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCGT

Page 21: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Marker 1 restriction analysis

BcnI ClaI HaeIII

LBG

GUAR

LBG

GUAR

LBG

GUAR

PCR amplification and digestion

Page 22: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Marker 2 restriction analysis

SmaI XhoI HaeIII

LBG

GUAR

LBG

GUAR

LBG

GUAR

Page 23: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Markers sequences

Marker 1 Marker 2

LBG

LBG

GUAR

GUAR

• Isolation of markers from gel• Sequencing

GUAR sequence (Marker 1)ACCTTCCTCTTCAGCATTGTTCCAAAGGCATCCACTTGGACGCCTTCCTAGTAACAGCTACGGAGTGTTCGTCAGGCTGGGCACTTGAACAAAACGAATAAATCCCAACCAAACCCCGCACAGTTTTGTGCGGCTGGAAGGAAACCAACCCTCAACAGACGGAACGCACCGAAAGAGAATCGGAAATTGTTTGGGTGGCCGCGATGTGCGCGGTTCCTTTGAATTGANAAGACACGCGGGAACGGTCGGGCCATTGCCACGACACATCCAACNCAAATCTATGTACTTAGTTTTACTGAGAGCCGTTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCGT

CAROB TREE sequence (Marker 1)ACCTTCCTCTTCAGCATTGTTCCAAAAGCATCCACTTGGACACCTTCCTAGTAACAGCTACGGAGTGTTTTGCTTGCTGGACGCTTAACCAATTTGATAGCCCCCGCCCCCCGCACGCAGGAGGGTTCGGAGGTACAGCCCTCCGCGGACACCGGGGGGCGGTGAGCACGATGGAGCTGGTTTTTTGATTGGGACCGCAAATTGCGCGGTTCCTTGATGTTGGTCACTCGCACGAGGGCTACTGGACCATTGCCGCTAGCTAGCTACTCGCAGCACTGTAAGAATAGGTTTTACTGAGAGCCATTGCCTATAGAGCCGAGAGCGTAGCTACTTCTTGCGTCGT

Page 24: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Carob vs. guar sequences (Marker 2)identicaldifferent P3

GUAR 1 12341324124424432342324441232414311221212441123424 50CAROB 1 12341324124424432342324441234414311221212441123424 50

GUAR 51 41333232443311324213111244323442112323332442334114 100CAROB 51 41311212443341344213111244343442112123332442334134 100

PG22GUAR 101 2233242223432331233122232132323213211233314431322- 149CAROB 101 42332442234321312331222121343434312132333334333321 150

GUAR 150 -43213134111221213211242122-3244121122311333432423 197CAROB 151 22331313232122311324224412223424114122331133212423 200

GUAR 198 21123313412211221124441132421332122122422412334324 247CAROB 201 11323311412241223334444242421132322122324312334324 250

PG21GUAR 248 112414122122112421441142313242433341321242324313-3 296CAROB 251 3--23432212241242344424-31344243342132123442121341 297

PG21GUAR 297 413112111122431311124333nnnn434124234131332-412313 341CAROB 298 43332224112323132242433311342341323242212341412331 347

P4GUAR 342 21143242433134221342432222114333231242111442341413 391CAROB 348 32443222433314421342232222314313231242111442341413 397

P4GUAR 392 4414423224224 405CAROB 398 4414423224224 410

Page 25: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Specific amplification of guar DNA from seeds

Guar seeds Carob tree seeds

100

200

300400

Page 26: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Investigation of DNA extraction from locust bean

and guar gums (E 410 and E 412)Gum Extraction

methodDNA Sugars DNA/sugars PCR

Guar 1 46.87 0.639 1 / 14,000 +30% Guar 1 8.6 0.523 1 / 60,000 +10% Guar 1 10.8 0.541 1 / 50,000 +

Locust bean 1 14.22 0.572 1 / 40,000 —

Guar 2 77.3 1.056 1 / 14,000 +30% Guar 2 156.1 0.361 1 / 2,500 —10% Guar 2 232.5 0.494 1 / 2,000 —

Locust bean 2 509.7 0.721 1 / 1,500 —

Guar 3 4.84 0.013 1 / 3,000 +30% Guar 3 1.72 0.019 1 / 11,000 —10% Guar 3 1.94 0.030 1 / 16,000 —

Locust bean 3 1.72 0.029 1 / 17,000 —

Guar 4 3.21 ND NA —30% Guar 4 0.3 ND NA —10% Guar 4 0.64 ND NA —

Locust bean 4 0.86 ND NA —

Page 27: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Specific amplification of guar DNA from mixtures of LBG and known additions of guar gum

100200300

30% 20% 10% 12% 6% 2% guar+LBG

mixture 1 mixture 2

LBG

GUAR

Page 28: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Specific detection of guar DNA in commercial samples labeled as E 410

300

200

100

Guar

LBG

Commercial sampleslabeled as E 410

Page 29: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Specificity of the amplified products

uncut T a q I X h o I restrictions

Amplification products were • cutted with a restrictase specific of the guar sequence• analyzed by gel electrophoresis

Page 30: Locust bean or guar?  Molecular methods for detecting additions of guar gum to locust bean gum

Molecular methods for detecting additions Molecular methods for detecting additions of guar gum to locust bean gumof guar gum to locust bean gum

Work developed by:Work developed by:• S. Albertí, A. Doménech-Sánchez, V.J. Benedí S. Albertí, A. Doménech-Sánchez, V.J. Benedí • M.L. Hernández, J.A. RossellóM.L. Hernández, J.A. Rosselló

Funded by:Funded by:• Carob S.A.Carob S.A.

With the collaboration of:With the collaboration of:• A. Juan, J. Sansegundo (Carob S.A., lab) A. Juan, J. Sansegundo (Carob S.A., lab) • D. Álvarez, M. Urdiaín (UIB)D. Álvarez, M. Urdiaín (UIB)• C. Murillo and R. Jiménez-Flores (CalPoly, USA)C. Murillo and R. Jiménez-Flores (CalPoly, USA)


Related Documents