Genometry
Gregg Helt Cyrus Harmon
Genometry
• Motivation and Purpose • Points of Reference • Genometry interfaces • Genometry manipulations • Genometry implementation • Representation examples • Prototype apps • Current status, future work
Motivation and Goals • Desire for a more unified data model to represent
relationships between biological sequences, such as: – Annotations – Alignments – Sequence composition
• More networked, less hierarchical (genome-centric, transcript-centric)
• Simplicity • Expressivity / Flexibility • Memory and Computational Efficiency • Use by others to provide core functionality for various
Affy projects
Points of Reference
• com.neomorphic.bio models • Genisys DB and Genisys IDL • EBI mapping models • Apollo data models • BioPerl • BioJava • Closest similarity to bio alignment models and
Genisys alignment models
Basic Annotations
Transcript T Genome G
Transcript T
G: 1000..5000
Exon E1 G:1000..1200
Exon E2 G:3000..3500
Exon E3 G:4500..5000
Genometry Annotations – Specify All Coordinates
Transcript T Genome G
Transcript T
G: 1000..5000 T:0..1200
Exon E1 G:1000..1200
T:0..200
Exon E2 G:3000..3500
T:200..700
Exon E3 G:4500..5000 T:700..1200
Genometry Annotations – All coordinates are relative to BioSeqs
Transcript T Genome G
TranscriptAnnot T1 G: 1000..5000
T:0..1200
ExonAnnot E1 G:1000..1200
T:0..200
ExonAnnot E2 G:3000..3500
T:200..700
ExonAnnot E3 G:4500..5000 T:700..1200
Transcript T
Genome G
Genometry Annotations – SeqSpans encapsulate a range along a BioSeq
Transcript T Genome G
TranscriptAnnot T1
ExonAnnot E1
ExonAnnot E2
ExonAnnot E3
Transcript T
Genome G G: 1000..5000
T: 0..200
G:1000..1200 T:0..200
G:3000..3500 T:200..700
G:4500..5000 T:700..1200
Genometry Core Core • BioSeq
– length, residues (optional)
• SeqSpan – start, end, BioSeq
• SeqSymmetry – SeqSpans (breadth) – SeqSymmetry parent / child hierarchy (depth)
Expressiveness of Core Core
• “Standard” annotations • Singleton annotations • Alternative Splicing • Pairwise alignments • Annotations with depth > 2 • Annotations with breadth > 2 • Indels • Structure of analyzed sequence • Fuzzy locations • All without explicit pointers from BioSeq to annotation
Genometry Modelling of Insertions and Deletions #1a
G:1000..1006 T:7..18
G:1000..1017
T:0..6 G:1006..1017
T:0..18
…AGGCAATTAATTGATCCAGGTG……GAGTCCGAATAGGGTTAGCG…
GCAATTCAATTGATCCAG TCCGAATAGGTTAGCG
G:2000..2017 T:18..34
G:2000..2010 T:28..34 T:18..28
G:2011..2017
G:1000..2017 T:0..34
insertion in transcript relative to genome (deletion in genome relative to transcript)
deletion in transcript relative to genome (insertion in genome relative to transcript)
Genome G
Transcript T
Genometry Modelling of Insertions and Deletions #1b
G: g0..g2 T:t0..t2
…AGGCAATTAATTGATCCAGGTG……GAGTCCGAATAGGGTTAGCG…
GCAATTCAATTGATCCAG TCCGAATAGGTTAGCG
G:g3..g5 T:t3..t5
G:g3..g4 T:t4..t5 T:t3..t4
G:g4+1..g5 G:g0..g1 T:t0..t1 T:t1+1..t2
G:g1..g2
G:g0..g5
T:t0..t5
insertion in transcript relative to genome (deletion in genome relative to transcript)
deletion in transcript relative to genome (insertion in genome relative to transcript)
Genome G
Transcript T
t0 t1 t1+1 t2
g0 g1 g2 g3 g4 g4+1 g5
t3 t4 t5
Genometry Modelling of Insertions and Deletions #2
G:g0..g1 T:t0..t1 T:t1+1..t2
G:g1..g2
G: g0..g2 T:t0..t2
…AGGCAATTAATTGATCCAGGTG……GAGTCCGAATAGGGTTAGCG…
GCAATTCAATTGATCCAG TCCGAATAGGTTAGCG
G:g3..g5 T:t3..t5
G:g3..g4 T:t3..t4 T:t4..t5
G:g4+1..g5
G:g0..g5
T:t0..t5
insertion in transcript relative to genome (deletion in genome relative to transcript)
deletion in transcript relative to genome (insertion in genome relative to transcript)
Genome G
Transcript T
T:t1..t1+1 “C” :0..1
t0 t1 t1+1 t2
g0 g1 g2 g3 g4 g4+1 g5
t3 t4 t5
G:g4..g4+1 “G” :0..1
Genometry Modelling of Insertions and Deletions #3
G:g0..g1 T:t0..t1 T:t1+1..t2
G:g1..g2
G: g0..g2 T:t0..t2
…AGGCAATTAATTGATCCAGGTG……GAGTCCGAATAGGGTTAGCG…
GCAATTCAATTGATCCAG TCCGAATAGGTTAGCG
G:g3..g5 T:t3..t5
G:g3..g4 T:t3..t4 T:t4..t5
G:g4+1..g5
G:g0..g5
T:t0..t5
insertion in transcript relative to genome (deletion in genome relative to transcript)
deletion in transcript relative to genome (insertion in genome relative to transcript)
Genome G
Transcript T
T:t1..t1+1 G:g1..g1
t0 t1 t1+1 t2
g0 g1 g2 g3 g4 g4+1 g5
t3 t4 t5
G:g4..g4+1 T:t4..t4
Genometry Modelling of Insertions and Deletions #4
G:g0..g1 T:t0..t1 T:t1+1..t2
G:g1..g2
G: g0..g2 T:t0..t2
…AGGCAATTAATTGATCCAGGTG……GAGTCCGAATAGGGTTAGCG…
GCAATTCAATTGATCCAG TCCGAATAGGTTAGCG
G:g3..g5 T:t3..t5
G:g3..g4 T:t3..t4 T:t4..t5
G:g4+1..g5
G:g0..g5
T:t0..t5
insertion in transcript relative to genome (deletion in genome relative to transcript)
deletion in transcript relative to genome (insertion in genome relative to transcript)
Genome G
Transcript T
t0 t1 t1+1 t2
g0 g1 g2 g3 g4 g4+1 g5
t3 t4 t5
T:t1..t1+1 G:g1..g1
“C”:0..1 T:t4..t4
G:g4..g4+1
“G”:0..1
Modelling SNPs with Genometry: Two Approaches
SeqB : 0..n
SeqA : 0..x SeqB : 0..x
“T” : 0..1 SeqB : x..x+1
SeqA : 0..m
SeqA : x+1..m SeqB : x+1..n
SeqA : x..x+1 …GGCAAGGAATGATC… SeqA x x+1
…GGCAAGGAATGATC… SeqA
SeqB …GGCAAGTAATGATC…
x x+1
SeqA = reference chromosome SeqB = exactly same as reference chromosome, except for one SNP
I. SNPs as annotations of differences between sequences
II. SNPs as gaps in similarity between two sequences
T
SeqB : x..x+1 SeqA : x..x+1 …GGCAAGGAATGATC… SeqA
SeqB …GGCAAGTAATGATC…
x x+1
“T” : 0..1 SeqA : x..x+1 …GGCAAGGAATGATC… SeqA
T
x x+1
I.a. annotation of just reference seq
I.b. annotation of reference seq w/ variant base
I.c. annotation of reference and variant seq
Modelling SNPs with Genometry: Two Approaches
SeqB : 0..n
SeqA : 0..x SeqB : 0..x
“T” : 0..1 SeqB : x..x+1
SeqA : 0..m
SeqA : x+1..m SeqB : x+1..n
SeqA : x..x+1 …GGCAAGGAATGATC… SeqA x x+1
…GGCAAGGAATGATC… SeqA
SeqB …GGCAAGTAATGATC…
x x+1
SeqA = reference chromosome SeqB = exactly same as reference chromosome, except for one SNP
I. SNPs as annotations of differences between sequences
II. SNPs as gaps in similarity between two sequences
T
SeqB : x..x+1 SeqA : x..x+1 …GGCAAGGAATGATC… SeqA
SeqB …GGCAAGTAATGATC…
x x+1
“T” : 0..1 SeqA : x..x+1 …GGCAAGGAATGATC… SeqA
T
x x+1
I.a. annotation of just reference seq
I.b. annotation of reference seq w/ variant base
I.c. annotation of reference and variant seq
Sequence-oriented annotations • AnnotatedBioSeq
– Contains a collection of SeqSymmetries that annotate the sequence
– Interfaces to retrieve annotations covered by a span within the sequence
Annotation Networks • Can traverse networks of annotations, alternating between
AnnotatedBioSeqs and SeqSymmetries
protein2mRNA proteinSpanB
mrnaSpanB
mRNA2genomic genomicSpanC mrnaSpanC
Annotated GenomicSeq G
Annotated mRNASeq M
Annotated ProteinSeq P
m2gSub0 gSpanC0 mSpanC0
m2gSub1 gSpanC1 mSpanC1
m2gSub2 gSpanC2 mSpanC2
domainOnProtein proteinSpanA
= AnnotatedBioSeq = SeqSymmetry
Sequence Composition
• CompositeBioSeq – Contains a SeqSymmetry describing the mapping
of BioSeqs used in composition to the CompositeBioSeq itself
Sequence Composition Representations
• Sequence Assembly / Golden Path / etc. • Piecewise data loading / lazy data loading • Genotypes • Chromosomal Rearrangements • Primer construction • Reverse Complement • Coordinate Shifting
Genometry Modelling of Reverse Complement
Sequence B = reverse complement of Sequence A
BioSeq A length: x
Composite BioSeq B
length: x
A:0..x B:x..0
Sym AB composition
AGGCAATTAATTGATCCAGGTGGAGTCCGAATAGGGTTAGCGA
TCGCTAACCCTATTCGGACTCCACCTGGATCAATTAATTGCCT
SeqA
SeqB
MultiSequence Alignments • MultiSeqAlignment
– Alignments sliced “horizontally” -- each “row” in an alignment is a CompositeBioSeq whose composition maps another BioSeq to the same coord space as the alignment
• Can also slice vertically (synteny)
Alignment Representations • Can represent same alignment as either MultiSeqAlignment or Synteny • Transformation from horizontal slicing (MultiSeqAlignment) to vertical
slicing (Synteny)
Complete Genometry Core Models
• Mutability • Curations
Genometry Manipulations
• Symmetry Intersection (AND) • Symmetry Union (OR) • Symmetry Inverse (NOT) • Symmetry Mutual Exclusion (XOR) • Symmetry Transformation / Mapping
Symmetry Combination Operations
SymA SymB
XOR(A, B)
AND(A, B)
OR(A, B)
NOT(A)
NOT(B)
Genometry Transformations
• Every symmetry of breadth > 1 describes a mapping between different sequences
• Therefore every symmetry can be used to transform coordinates of other symmetries from one sequence to another
• Because sequence annotations, alignments, and composition are all based on symmetries, can use any of them as mappings
• Discontiguous linear mapping algorithm • Results of transformation are also symmetries
Coordinate Mapping
(note that domain mapped to spliced transcript only overlaps two of the three exons, hence only end up with two children for resulting domain2genomic symmetry)
Example – mapping domain from protein coords to genomic coords
protein2mRNA proteinSpanB
mrnaSpanB
mRNA2genomic genomicSpanC mrnaSpanC
Annotated GenomicSeq G
Annotated mRNASeq M
Annotated ProteinSeq P
m2gSub0 gSpanC0 mSpanC0
domain2genomic proteinSpanA
d2gSub0 pSpanA0 mSpanA0 gSpanA0
domain2genomic proteinSpanA mrnaSpanA
domain2genomic proteinSpanA mrnaSpanA
genomicSpanA
d2gSub1 pSpanA1 mSpanA1 gSpanA1
transform via protein2mRNA
transform via mRNA2genomic
m2gSub1 gSpanC1 mSpanC1
m2gSub2 gSpanC2 mSpanC2
domainOnProtein proteinSpanA
= AnnotatedBioSeq (BioSeq)
= SeqSymmetry (SeqAnnot)
“Growing” domain2genomic result
= MutableSeqSymmetry
mRNA2genomic genomicSpanC mrnaSpanC
m2gSub0 gSpanC0 mSpanC0
m2gSub1 gSpanC1 mSpanC1
m2gSub2 gSpanC2 mSpanC2
domain2genomic proteinSpanA mrnaSpanA
domain2genomic proteinSpanA mrnaSpanA
d2gSub0 mSpanA0
domain2genomic proteinSpanA mrnaSpanA
d2gSub0 mSpanA0 pSpanA0
domain2genomic proteinSpanA mrnaSpanA
d2gSub0 mSpanA0 pSpanA0 gSpanA0
d2gSub0 pSpanA0 mSpanA0 gSpanA0
domain2genomic proteinSpanA mrnaSpanA
genomicSpanA
d2gSub1 pSpanA1 mSpanA1 gSpanA1
domain2genomic proteinSpanA mrnaSpanA
d2gSub0 mSpanA0 pSpanA0 gSpanA0
d2gSub1 mSpanA1 pSpanA1 gSpanA1
step1b step1c step1a
step 2
step1 (loop2) [a,b,c]
Step 2 “roll up”
Step 1a “sit still”
Step1b “roll back”
Step1c “roll forward”
Step 1 Details of “split” mapping
Transformations Applications
• Mapping Affy probes to genome • Mapping contig annotations to larger genomic assemblies • Mapping protein annotations to genome • Mapping genomic annotations to proteins and transcripts
(SNPs, for example) • Sequence slice-and-dice with annotation propagation • Propagation of annotations across versioned sequences (such
as Golden Path) • Deep mappings (for example, SNP to genomeA to transcriptB to
proteinC to homolog proteinD to transcriptE to genomeF to putative SNP location in genomeF – symmetry path of depth 5)
• Etc., etc.
Prototypes & Applications
• GenometryTest • Generic Genometry Viewer • ProtAnnot (Ann) • GPView (Cyrus) • AlignView (Eric) • ContigViewer (Peter, Barry) • Unibrow (Transcriptome Group)
Genometry Summary
• Genometry presents a unified model for location-based sequence relationships
• Sequence annotation, composition, and alignment are all based on SeqSymmetry
• Provides powerful genometry manipulations -- any SeqSymmetry can be used to map other SeqSymmetries across sequences / coordinate spaces
• Work in progress