YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Home Field Advantage: Why the Pittsburgh Steelers Don’t Like

Playing in DenverBrian Couch, Liz Flaherty, Carly Jordan,

Susan Jorstad, Desirée Salazar, Roberto Tinoco, Rich Wilson

Facilitators: Lisa Elfring and Ralph Preszler

Page 2: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Topic: Gene Expression: Linking Genes to Phenotypes

Context: Majors General Biology, 150+ students, mixed preparation, high DFW rate, different fields (ex, pre-health), diverse socioeconomic and ethnic groups, students at a state university

Prior Knowledge: Protein structure, Mendelian genetics, transcription, translation

Page 3: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Unit Learning Goals:–Understand the link between gene and

phenotype–Understand how a mutation in DNA

affects the amino acid sequence–Understand that a change in amino acid

sequence can result in changes in protein function–Develop science process skills

Page 4: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Teachable Tidbit Learning Outcomes:A. Give examples of how genotypic changes can lead to phenotypic changes (1) B. Given a wild type and mutant amino acid and/or mRNA sequences, identify the type of mutation that occurred (2) C. Compare and contrast the effects of different mutations on the resulting amino acid sequence (4)D. Design an experiment to test how amino acid sequence affects protein function (5)E. Draw a concept map that illustrates the relationships between genes and phenotypes (5)F. Interpret graphical data about biological phenomenon (4)

Page 5: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver

Page 6: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,
Page 7: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Q1: What is Ryan’s genotype?

A. He is homozygous for the normal allele.B. He is heterozygous. C. He is homozygous for the mutant allele.D. He is hemizygous.

Page 8: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Q2: Which of the following contributes to sickle cell disease in Ryan?

A. O2 levels

B. Mutated DNAC. Abnormal proteinD. All of the aboveE. Not enough information

Page 9: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,
Page 10: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

GROUP ACTIVITY!

Let’s take a closer look at Ryan’s DNA!

Page 11: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

GROUP ACTIVITY!

Let’s take a closer look at Ryan’s DNA!

Ryan’s normal allele 5’ … CTATGGTGCACCTGACTCCTGAGGAGAAGT … 3’ Ryan’s mutant allele 5’ … CTATGGTACACCTGACTCCTGTGGAGAAGT … 3’

Page 12: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Q3: Rank the following mutations (from low to high) with regards to the severity of their impacts on the final protein: 1) nonsense early in sequence2) silent 3) missense mutation of valine for alanine 4) missense mutation of valine for lysine.

A. 1, 2, 3, 4B. 2, 3, 4, 1 C. 1, 2, 4, 3D. 2, 3, 1, 4E. 2, 4, 3, 1

Page 13: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,
Page 14: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Q4: In each of Ryan’s red blood cells, what type of hemoglobin proteins are present?

A. Normal and mutant hemoglobinB. Mutant hemoglobinC. Normal hemoglobinD. None since they lack nucleusE. It depends on oxygen levels

Page 15: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Take-Home ActivityTr

eatm

ent T

ype

Targets

For each treatment type, place an X in the box(s) that the treatment will resolve.

Page 16: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Alignment and Assessment

• See hand-out

Page 17: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Diversity

• Highlight role model from an under-represented group

• Disease range vs. homework question• Inequality in access to healthcare• Pedagogical diversity: group work, think-pair-

share, data interpretation, concept maps, visual-auditory

Page 18: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Assessment examples – Clicker questions and exam questions (concept map and experiment)

Page 19: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Learning Objective

Assessment Active learning Low Order/High Order

Diversity:

Diversity

Alignment

Page 20: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Think-Pair-ShareHow could this amino acid substitution change the shape of the protein and the cell?

Image Source: Berkley’s “Understanding Evolution” Image Source: www.medindia.net

Protein Cell

Page 21: Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar,

Mutation


Related Documents