YOU ARE DOWNLOADING DOCUMENT

Please tick the box to continue:

Transcript
Page 1: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Generate a DNA Barcode and Identify SpeciesIs there something fishy about what you’re eating?

Bio-Rad Biotechnology Explorer Fish DNA Barcoding Kit and DNA Barcoding Sequencing Module

Page 2: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com2

Instructors - Bio-Rad Curriculum and Training Specialists

Damon Tighe, [email protected]

Sherri Andrews, [email protected]

Leigh Brown, M.A. [email protected]

Page 3: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com3

Workshop Timeline

Introduction

Fish DNA extraction

Gel electrophoresis

DNA visualization with UViewTM

Bioinformatics and species identification

Inquiry Questions

Page 4: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com4

Diversity of Life

It is estimated that there are 10 -100 million species of organisms on Earth

Only about 1.7 million species have been formally identified

Current limitation to studies of biological diversity - humans are limited in their ability to recognize and recall morphological variation

Few taxonomists can even reliably identify a collection of ~1000 species

How do we complete the task of identifying the remaining species, let alone recognizing them once they are identified?

Solution – Create a genetic based identification system (DNA barcode)

Page 5: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com5

Visual Classification

Some distinct species are not easy to differentiate by eye…

vs

or

Page 6: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com6

What is DNA Barcoding?

A worldwide effort (International Barcode of Life, iBOL) exists to “barcode” or generate standard genetic sequence identification of all species on Earth.

CCCTCCTA

What is a barcode?– UPC (Universal Product Code) Symbol – 11 variable positions

with 10 possible numbers– Ability to assign a unique identifier to over 100 billion items

What is a DNA barcode?– Use of a designated DNA sequence to serve as a unique species identifier– Ideal sequence is constrained by overall conservation (preserve gene function), but

still has substantial sequence variation which differentiates species

Page 7: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com7

Barcode Of Life (BOL) iBOL

– International Barcode of Life Project– Hub is at Biodiversity Institute of Ontario (BIO) at U Guelph – Goal to generate 5 million barcodes representing 500,000 species– Currently: 2 million barcodes representing 300,000 species in the database

– Opportunity to contribute to the global initiative to barcode life on Earth!

Page 8: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com8

Be a citizen scientist!

Participate in the largest biodiversity cataloging project ever undertaken and help build a genetic registry of life

Design a market study to look at local food supply, or local flora and fauna

Axolotl / Mexican salamander (critically endangered)

Page 9: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com9

“Sushigate”

2008, two 11th graders in New York did a market substitution study Surveyed 60 samples collected from 4 restaurants and 10 grocery stores Of the 60 samples, 54 could be genetically identified 13 of the 54 were mislabeled (23%)! 2/4 restaurants and 6/10 grocery stores had sold mislabeled fish

Page 10: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com10

“Sushigate”

7/9 samples listed as Red Snapper were mislabeled, and included substitutions: Acadian redfish from North Atlantic, Pinjalo from SE Asia, Lavender jobfish from So. Pacific, Nile perch from Africa, and Atlantic Cod.

Spotted Goatfish (restricted to the Caribbean) sold as Mediterranean Red Mullet White Bass (farmed freshwater fish) sold as Sea Bass Smelt Roe sold as Flying Fish Roe White (albacore) tuna sushi was Mozambique tilapia (commonly farmed)

Page 11: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com11

Food Fraud in the News

Page 12: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com12

DNA Barcode Region Defined

Genes Designated as Barcode Regions: Fungi

– ITS – nuclear ribosomal internal transcribed spacer region Plants – 2 genes required

– rbcL – chloroplast ribulose-1,5-bisphosphate carboxylate– matK – chloroplast maturase K

Animals– COI – mitochondrial cytochrome C oxidase subunit I

Why COI?– Mitochondrial genome lacks introns– Limited exposure to recombination– Haploid mode of inheritance– Universal primers are robust– Hundreds to thousands of mitochondria/cell – this

means many more copies of the COI gene in your sample!

MitochondrialDNA

Page 13: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com13

Applications of DNA Barcoding

What did I eat last night (and is it what they said it was)?

What did I catch

yesterday?

What is the genetic

signatureof this rare

species?

Page 14: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com14

Fish DNA Barcoding Kit Start to Finish

DNA BARCODE

Page 15: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com15

DNA Barcoding Kit Workflow

Fish sample Extract genomic DNA

Gel electrophoresis

Sequencing,Sequence Analysis

PCR amplification

Page 16: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com16

Barcoding Overview

Page 17: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com17

Barcoding Overview

Page 18: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com18

Barcoding Overview

Page 19: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com19

DNA Extraction Overview

+ Resuspension + Lysis Buffer Buffer

Incubate10 minat 55oC

Bind DNAto column

(Matrix Solution)

+ Neutralization Buffer

Wash columnwith Wash buffer

Elute DNA

Page 20: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com20

Quick Guide – Fish Prep

Cut a piece of fish approximately the size of a pencil eraser-head, from your first fish sample. Slice it until finely minced. Transfer the sample into microcentrifuge tube 1.

Label tubes “1” for fish sample 1, “2” for fish sample 2. Also label with your initials. 1

2

1

1

2

Page 21: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com21

Quick Guide – Fish Prep

Using a new cutting implement, cut a piece of fish approximately the size of a pencil eraser-head, from your second fish sample. Slice it until finely minced. Transfer the sample into microcentrifuge tube 2. 2

Add 200 l of Resuspension to your two tubes and flick several times to ensure full submersion of the fish in the resuspension solution.

3

4

Page 22: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com22

Quick Guide – DNA Extraction

Add 250 µl of Lysis to each tube and mix gently by inverting tubes 10 times to mix contents.

Incubate samples at 55oC for 10 min. The samples do not need to be shaken during incubation.

5

6

Page 23: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com23

What is happening during DNA extraction?Where is the DNA at each step?

Resuspension– buffered solution with chelating

agents to destabilize cell membranes– DNA: pellet (fish) or supernatant?

Lysis– alkaline solution that disrupts

membranes, releases DNA, denatures DNA

– DNA: pellet (fish) or supernatant? Heating

– helps to break down tissue to recover more DNA

Neutralization– solution that counteracts the effects of

alkalinity, renatures smaller pieces of DNA, helps precipitate DNA and remove detergents

– DNA: pellet (fish) or supernatant?

mitoDNA

nuclearDNA

Page 24: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com24

What is happening during DNA extraction?Where is the DNA at each step?

Matrix– silica based suspension that binds

DNA but not RNA or proteins– DNA: column or flow through?

Wash– removes other small particles in the

prep that are nonspecifically bound to the Matrix

– DNA: column or flow through?

Elute– low ionic strength buffer or water

releases DNA from the silica– DNA: column or flow through?

mitoDNA

pelleted proteins,membranes, etc

Page 25: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com25

Quick Guide – DNA Extraction

Add 250 l of Neutralization to each tube and mix gently by inverting tubes 10 times to mix. A visible cloudy precipitate may form.

Centrifuge the tubes for 5 min at top speed (14,000 x g) in the microcentrifuge. A compact pellet will form along the side of the tube. The supernatant contains the DNA.

7

8

Page 26: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com26

Quick Guide – DNA Extraction

Snap (do not twist!) the bottoms off of the spin columns and insert each column into a capless 2 ml microcentrifuge tube. Label columns 1 and 2 + your initials.

Transfer the entire supernatant (500–550 µl) of each fish sample into the appropriately labeled spin column. Try not to get any of the particulates into the spin column because they will clog the column and prevent you from continuing.

9

10

1 2

1 2

Page 27: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com27

Quick Guide – DNA Extraction

Thoroughly mix the tube labeled Matrix to make sure particulates are completely resuspended before use.

Add 200 l of thoroughly resuspended Matrix to the first column and pipet up and down to mix.

Using a new pipet tip, add 200 l of thoroughly resuspended Matrix to the second column and pipet up and down to mix.

Centrifuge the columns for 30 sec at full speed.Remove flow through to waste.

11

12

13

1 2

1 2

Page 28: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com28

Quick Guide – DNA Extraction

Repeat wash step andcentrifugation as shown above.

Add 500 µl of Wash and wash the samples by centrifugation for 30 sec.Remove flow through to waste.

14

15

Wash

1 2

Page 29: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com29

Quick Guide – DNA Extraction

Centrifuge columns for a full 2 min to remove residual traces of Wash and dry out the samples

Remove the spin columns and discard the 2 ml microcentrifuge wash tubes. Place the spin column for each sample into a new capless 2 ml tube.

16

17

new caplesstube

1 2

1

Page 30: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com30

Quick Guide – DNA Extraction

1 2

Using a fresh pipet tip for each sample, add 100 µl of distilled water to each spin column, being careful not to touch the resin. Elute the DNA by centrifuging for 1 min.

Label two clean 2 ml microcentrifuge tubes (with caps) Fish 1 and Fish 2 and your initials. Transfer the eluted DNA into the appropriately labeled tube.

18

19

1 2

Page 31: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com31

PCR amplification of COI gene

Fish DNA has been extracted

Next step is to amplify a portion of the mitochondrial COI gene

– Generate enough DNA to visualize on a gel– Generate enough DNA to send for sequencing

Assemble reactions of – Template DNA– Primers– Nucleotides– Taq polymerase– Magnesium chloride

Multiple rounds of thermal cycling toamplify DNA

MitochondrialDNA

Page 32: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com32

PCR – Degenerate primers

When trying to amplify DNA from a wide variety of samples (many different fish) using the same primer set, creating degenerate primers is a useful approach

Determine a consensus sequence derived from several species

– Pike: A-C-T-G-G-C-T-T-A-G-C– Carp: A-C-T-G-G-A-T-T-A-G-C– Tuna: A-C-T-G-G-G-T-T-A-A-C– Bass: A-C-T-G-G-T-T-T-A-G-C– Hake: A-C-T-G-G-A-T-T-T-A-C– CONS.: A-C-T-G-G-N-T-T-A-R-C

The consensus/degenerate primers bind to DNA from all of these fish, whereas regular primers would only bind to one

The primers used in our Fish DNA barcoding kit contain degenerate positions to amplify DNA from as many different fish as possible!

Page 33: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com33

Fish Barcoding PCR Primers

Page 34: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com34

PCR – Overview

Heat (94oC) to denature DNA strands

Cool (55oC) to anneal primers to template

Warm (72oC) to activate Taq polymerase, which extends primers and replicates DNA

Repeat 35 cycles

Your PCR products will be given to you now for electrophoresis

Page 35: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com35

Quick Guide - Electrophoresis

Add 2 µl of UView 6x loading dye to each sample, using a new pipet tip each time. Mix samples well.

Load the agarose gel in the following lane order and volumes, using a new pipet tip each time:

Lane Sample 1 EMPTY 2 EMPTY 3 20 µl MWR 4 12 µl (+) E 5 12 µl (–) E 6 12 µl 1 E 7 12 µl 2 E 8 EMPTY

200 V20 min

0.25x TAE

Page 36: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com36

Visualizing DNA after electrophoresis

UViewTM Ethidium Bromide Fast BlastTM

Nontoxic Toxic, Mutagen NontoxicLoading dye + Stain Stain StainInstant Instant Requires wait timeView with UV View with UV View by eyeVery sensitive Most sensitive Less sensitive

Page 37: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com37

Use UV transilluminator to visualize UView or Ethidium Bromide

UViewTM

Ethidium bromide

1 2 3 4 5

1. MW ruler2. (+) control3. (-) control4. Fish 15. Fish 2

Page 38: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com38

Sequencing of PCR products

Page 39: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com39

Bioinformatics – Alignment

What is the longest run of tails I should expect for 100 tosses?

. . . . .

Run

R = log1/p (n)

R = longest runp = probability (for “fair” coins its 0.5)n = number of tosses

Paul Erdos

Paul Erdos‐Alfréd Rényi law

Page 40: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com40

Bioinformatics – Alignment

What is the longest run of tails I should expect for 100 tosses?

. . . . .

Run

R = log1/0.5 (100) = 6.64

Paul Erdos

….so if I get more than 6.64 tails in a row when tossing 100 times, I might wonder if something besides randomness is going on

Page 41: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com41

Bioinformatics – Alignment

If I call alignments tails. What is the longest run of tails I should expect for comparing two 10 bp sequences?

R = log1/0.25 (100) = 3.32

AATCGTACTGAACCATTCAG

¼ chance for getting same base

Sequence lengths multiplied

Page 42: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com42

DNA is not a 4 sided Coin- Account for probability of bases being switched out for each other by a scoring matrix

Match

TransitionTransversionSame base type – Purine for Purine Change of base type – Purine for Pyrimidine

Bioinformatics – Alignment

Page 43: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com43

DNA is not a 4 sided Coin

65555433321A55554433221G44444433221C33333333221T22222222221A

22221111111G11111111111GATTGACTTAAG

Bioinformatics – Alignment

Page 44: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com44

DNA is not a 4 sided Coin

65555433321A5554433221G44444433221C33333333221T22222222221A

22221111111G11111111111GATTGACTTAAG

Bioinformatics – Alignment

Page 45: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com45

Bioinformatics – BLAST tool

ATTCGCAT

Query Database

1) Break into words

2) Find Matches and let go of all the other database words that don’t match

ATTTTCTCGCGCGCACAT

3) Extend from match 1 base at a time until score falls off

4) Use two anchors to define and alignment, compare, score

E-value

Page 46: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com46

Bioinformatics – BLAST tool

E-valueTheoretically, we could trust any result with an E-value ≤ 1

In practice – BLAST uses estimations.• E-values of 10-4 and lower indicate a significant homology.• E-values between 10-4 and 10-2 should be checked (similardomains, maybe non-homologous).• E-values between 10-2 and 1 do not indicate a good homology

Page 47: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com47

Bioinformatics – Linking DNA Barcoding and Protein Profiler

+

Stronger Evidence for Evolutionary Relationship

Compare light chain of myosin sizes Compare E-value for CO1 gene

=

Page 48: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com48

Bioinformatics using BOLD-SDP

Quick Start tutorial available online

BOLD-SDP = Barcode Of Life Data systems – Student Data Portal

Page 49: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com49

Create an Instructor Account

Page 50: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com50

Fill Out Required Information

Page 51: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com51

Receive Two Important Emails – Login and Registration Keys

Registration keys

Page 52: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com52

Log In and Register a New Course

Page 53: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com53

Fill in Course Info,List Students, Receive Class Login

Page 54: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com54

Students Log In and Enter Specimen Info

Page 55: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com55

Enter Specimen Information

Page 56: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com56

View Class Specimen List

Page 57: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com57

Upload Sequencing Data Files

Page 58: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com58

Select PCR and Sequencing Primers Used

Page 59: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com59

Class List Updates with Specimen Records Uploaded

Page 60: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com60

View Data

Page 61: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com61

Uploaded trace files receive data quality assessment

Page 62: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com62

Trace files viewable

Page 63: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com63

Quality Scores

Light blue bars in background represent assigned quality value for each nucleotide (scale on right axis)

High quality valuesExamine peaks

Low quality valueExamine peaks (mixed call – overlap)

Page 64: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com64

Generate contig (“sequence”) from trace files

Page 65: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com65

Examine base calls in contig

Contig sequence

Page 66: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com66

Contig generated, trim primer sequences

Page 67: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com67

Run contaminant check and submit contig

Contig 573 bp with no ambiguous nucleotides

Page 68: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com68

Data summary

contig sequence

translation

barcode generatedfrom data

Page 69: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com69

Search full database for genetic match

Page 70: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com70

Search species database for genetic match

Page 71: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com71

Species match!

Page 72: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com72

Education and DNA Barcoding - Resources

www.educationandbarcoding.org Links to content to aid in classroom presentations Check out ongoing student barcoding campaigns Register your own barcoding campaign! Link to BOLD-SDP workbench (Student Data Portal) Engage in citizen science

Page 73: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com73

Questions to consider:– How important is each step in the lab protocol?– What part of the protocol can I manipulate to see a change in the

results?– Possible variables / questions:

• How will results be affected by the use of different fish sources (fresh, frozen, dried, canned)?

• Will different fish tissue yield better results (muscle vs fin, gills, or scales)?

• Cleanliness and attention to detail during fish processing– How do I ensure the changes I make are what actually affects the

outcome (importance of controls). – Write the protocol. After approval – do it!

Student Inquiry

Page 74: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com74

What materials and equipment do I have on hand, and what will I need to order?– Extra gels, different organisms? – Other supplies depending on student questions– Consider buying extras in bulk or as refills – many have 1

year + shelf life. What additional prep work will I need?

– Order supplies

Student Inquiry - Teacher Considerations

Page 75: Generate a DNA Barcode and Identify Species Is there something fishy about what you’re eating?

Biotechnology Explorer™ | explorer.bio-rad.com75

Student Inquiry - Teacher Considerations