Introduction
Piles of Information Flakes of KnowledgeAGCATCCGACTAGCATCAGCTAGCAG
CAGACTCACGATGTGACTGCATGCGTCATTATCTAGTATGAAAAAAGCCATGCTAGGCTAGTCAGCGACATGAGCCATGACTAGCGCAGCATCAGTCATCAGTCAGCGGAGCGAGGAGAGAGAGACGACTGACTAGCATGCACACATGCATGACGTCATGACTGCATGACTGACTGACTGACTGCATGCATGATATTTTTTTTTTCATGCATGCAGCATGCTACCCAGCTACAGTGCACAGCAGGTACGACGCATCAGCATACGTACGGCATGACGACTCAGACTACGCATACGACTACGAC
E. Coli S. cerevisiaeDroso
phila
Data Analysis
Traditional Methods (Experiments & Sequence Homology) The function of a protein
New Computational MethodsFunctional linkages between proteins
What does Functional Linkage mean ?
1) A common structural complex
2) A common metabolic pathway
3) A common biological process
4) All answers are correct
New Computational Methods
Phylogenetic Profile Method Rosetta Stone Method Chromosomal Proximity Method COG Database
Phylogenetic Profile Method
Biologically: Simliar profile likelihood for common pathway or complex
Mathematically: N genomes 2N possible profiles A unique characterization
Why Should it Work ?
Rosetta Stone Method (= Domain Fusion Analysis) Interacting proteins have
homologs in another organism fused into a single protein chain
Rosestta Stone Method
Experimentally: E. coli ~4300 proteins ~6800 pairs similar to a single protein
Biologically:
Why Should it Work ?
Rosestta Stone Method
Validation Tests(E. coli):1) Annotation of proteins from the
SWISS-PROT database (68% vs. 15%)
2) Database of Interacting Proteins (6.4%)
3) Phylogenetic Profile Method (5% vs. 0.6%)
Models’ Success & Failure
+ -+ True
positiveFalse negative
- False positive
True negative
predicted
found
Rosestta Stone Method
False Negatives1) interactions that have evolved
through other mechanisms, i.e. there never was a fusion
2) The fused protein has disppeared during evolution
Rosestta Stone Method
False Positives1) Proteins have been fused to
regulate co-expression2) Can’t distinguish between binding
and non-binding homologs.3) Functional interaction rather than
a physical interaction
Orthologs vs. Paralogs
Orthologs: genes in different species that evolved from a common ancestral gene by speciation
Paralogs: genes related by duplication within a genome
Chromosomal Proximity
Proximate Genes On the same strand Within 300 bp, or - Respective paralogs within 300 bp
Inferred link genes whose orthologs are close in
at least three phylogenetic groups
Chromosomal Proximity
Direct Link two proximate genes that are also
proximate in at least two other phylogenetic groups
Indirect Linkgenes whose orthologs are close in at least three other phylogenetic groups
Chromosomal Proximity
Biologically: Conservation of proximity across multiple genomes Linked function
Logically: How likely is it that two genes are randomly proximate ?
Why Should it Work ?
Chromosomal Proximity
1586 links were detected between ortholog families
KEGG: 80% in the same biological pathway
COG: 67% in the same functional category
Validation:
The COG Database
Clusters of Orthologous Groups COGs creation Each COG contains proteins that
have evolved from an ancestral protein
The COG Database
Current Numbers (2004) 43 Complete genomes 30 phylogenetic groups 2223 phylogenetic patterns 17 functional categories 3307 COGS 74059 proteins, 71% of total
The COG Database
Direct Information Annotation of Proteins
(group and individual) Phylogenetic Patterns Multiple Alignment
How can we use it ?
The COG Database
Detecting Missed Genes Patterns that contain all but one Mostly small proteins
How can we use it ?
Reliability of the Methods
Major validation: Experimentally known linkages
Validation by “keyword recovery” search
references1) Eisenberg D, Marcotte EM, Xenarios I, Yeates TO. Protein function in
the post-genomic era. Nature. 2000 405:823-826. Review2) Marcotte EM, Pellegrini M, Ng HL, Rice DW, Yeates TO, Eisenberg D.
Detecting protein function and proteing protein interactions from genome sequences. Science. 1999 285:751-753.
3) Yanai I, Mellor JC, DeLisi C. Identifying functional links between genes using conserved chromosomal proximity. Trends Genet. 2002 18:176-179.
4) Tatusov RL, Natale DA, Garkavtsev IV, Tatusova TA, Shankavaram UT, Rao BS, Kiryutin B, Galperin MY, Fedorove ND, Koonin EV. The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acids Res. 2001 29:22-28.
5) Tatusov,R.L., Koonin,E.V. and Lipman,D.J. (1997) A genomic perspective on protein families. Science, 278, 631–637.
6) http://www.ncbi.nlm.nih.gov/COG