Designing the Next-Generation Oncolytic Vaccinia Virus
by
Tiffany Yun-Yee Ho
A thesis submitted in conformity with the requirements for the degree of Master of Science
Institute of Medical Science University of Toronto
© Copyright by Tiffany Yun-Yee Ho 2017
ii
Designing the Next-Generation Oncolytic Vaccinia Virus
Tiffany Yun-Yee Ho
Master of Science
Institute of Medical Science
University of Toronto
2017
Abstract
Many oncolytic viruses (OVs), such as double-deleted vaccina virus (vvDD), are engineered
with enhanced tumor-selectivity based on increased cell proliferation in cancer cells. We
proposed that OVs with improved tumor efficacy and equal tumor-selectivity could be generated
by exploiting the dysregulated immune response in tumors. Vaccinia virus (VV) proteins that
inhibit the interferon response are redundant for replication in tumors, which often already have
a decreased interferon response. We deleted VV immunomodulatory genes (N1L, K1L, K3L,
A46R, or A52R) from VV and compared these candidate VVs to vvDD. Candidate VVs
demonstrated equal or superior in vitro viral replication, spread, and tumor cytotoxicity in colon
cancer cells compared to vvDD and were potent against ovarian cancer cells. At doses 20-1000
times less than the vvDD treatment dose, the best in vitro candidate VVs (∆K1L, ∆A46R,
∆A52R VVs) demonstrated tumor-selectivity and equal or prolonged survival in mouse models
of peritoneal carcinomatosis.
iii
Acknowledgements
The work described in this dissertation would not have been possible without the support and
guidance of several people. First, I would like to thank my principal investigator and mentor, Dr.
Andrea McCart. Beyond the constant guidance and opportunities provided to me as a scientist,
your calm demeanor and patience were instrumental for me to continue on confidently despite
numerous hurdles throughout this project. When I would fret about the smallest setbacks, you
kept my eyes on the big picture until the end. I would also like to thank my committee members,
Dr. Eleanor Fish and Dr. Christine Allen, for their feedback and encouragement that pushed me
to think critically about my research.
To the members of the McCart lab, past and present, I would like to offer my deepest gratitude
for going above and beyond whenever I needed help. To Dr. Kathryn Ottolino-Perry, your
immense knowledge and enthusiasm whenever I asked for help, even when you had graduated,
were indispensible throughout my time here. To Dr. Sergio Acuna and Lili Li, I will be forever
grateful to you for going out of your way to teach and help me with my project, especially for
long and arduous experiments when you, too, were busy.
My time as a graduate student was made much more enjoyable thanks to the support from friends
and family. First and foremost, I would like to thank my family who supported my pursuit in
every way possible from planning events around my experiment schedule. A special thank you is
owed to my brother for letting me hog the most isolated corner in the house (his room) to work
and study, sometimes to the point of being exiled to Waterloo. To my friends working on the 4th
floor of the Canadian Blood Services building, knowing that I would see you downtown made
the commute much more bearable. Our discussions about everything from cute raccoons and the
newest food fad to hardcore science concepts certainly made incubation times more interesting.
Lame jokes and painfully nerdy analogies with you kept my sanity while learning and doing a
project that, at times, felt overwhelming. Thank you for being my hiding place when I needed
one, both literally and figuratively. We complemented each other much too well to be from
separate labs. Our trials throughout our graduate journey had an uncanny resemblance and it was
comforting to lean on someone who understood. To my many other friends who braved every
extreme weather condition to deliver bubble tea as consolation or celebrate my smallest victories
iv
over dinner, the foodie in me is forever grateful. Though the chronicles of my graduate journey
and my description of every confounding situation won‘t be published in a book, our online
conversations will be a testament of how you listened to my every rant and went out for food
with me at the smallest sign of a food craving.
It has been put into my heart to also acknowledge and thank God for being there throughout my
journey here before and during my graduate studies, and certainly, He will be there after it. He
had fashioned every trial, success, and circumstance has fallen into place to give me these friends
that I cherish and experiences that have fostered growth. He has been faithful and I await the
next adventure He has in store.
v
Statement of Contributions
Tiffany Y. Ho generated the ∆N1L-, ∆K1L-, ∆K3L-, and ∆A46R- deleted vaccinia viruses. She
also designed and carried out experiments, analyzed the data, and wrote the thesis. Nan Tang
generated the ∆A52R-deleted vaccinia virus and the vvDD-R2R-Luc virus described in this
dissertation. Lili Li generated viral stocks and assisted in carrying out the experiments. Dr. J.
Andrea McCart designed the shuttle plasmids for all vaccinia viruses generated in this project,
conceived and designed the experiments, and supervised the study.
vi
Table of Contents
Acknowledgements ...................................................................................................................... iii
Statement of Contributions .......................................................................................................... v
Table of Contents ......................................................................................................................... vi
List of Figures .............................................................................................................................. xii
List of Tables .............................................................................................................................. xiv
List of Abbreviations .................................................................................................................. xv
Chapter 1: Introduction ............................................................................................................... 1
1.1 Oncolytic Viruses............................................................................................................ 1
1.1.1 Overview ................................................................................................................... 1
1.1.2 History and Development ......................................................................................... 2
1.1.3 Mechanisms of Tumor-Specificity ........................................................................... 3
1.1.4 Mechanisms of Action .............................................................................................. 5
1.1.5 Vaccinia Virus .......................................................................................................... 8
1.1.5.1. Clinical Safety of VV as a Smallpox Vaccine ................................................... 8
1.1.5.2 Vaccinia Virus Biology ..................................................................................... 9
1.1.5.3 Advantages of Vaccinia Virus as an Oncolytic Virus ..................................... 12
1.1.5.4 Double-deleted vaccinia virus - vvDD ............................................................ 13
vii
1.1.6 Oncolytic Viruses in Clinical Trials ....................................................................... 14
1.1.6.1 Vaccinia Virus in Clinical Trials ..................................................................... 17
1.2 Host Immune Response Against Viruses ...................................................................... 19
1.2.1 Overview ................................................................................................................. 19
1.2.2 Pathogen Recognition ............................................................................................. 20
1.2.2.1 Toll-Like Receptors ......................................................................................... 20
1.2.2.1.1 MyD88-Dependent Pathway ....................................................................... 21
1.2.2.1.2 TRIF-Dependent Pathway (MyD88- Independent Pathway) ...................... 22
1.2.2.2 Cytosolic PRRs ................................................................................................ 22
1.2.2.3 PRR Recognition of WR VV ........................................................................... 23
1.2.3 NFкB ....................................................................................................................... 26
1.2.4 Interferons ............................................................................................................... 28
1.2.4.1 Overview ......................................................................................................... 28
1.2.4.2 IFN Signaling Pathway .................................................................................... 29
1.2.5 Protein Kinase R (PKR) .......................................................................................... 32
1.3 VV Evasion of Innate Immunity ................................................................................... 33
1.3.1 Overview ................................................................................................................. 33
1.3.2 VV TLR Inhibitors .................................................................................................. 33
1.3.3 VV NFкB Inhibitors ............................................................................................... 35
viii
1.3.4 VV PKR Inhibitor ................................................................................................... 36
1.4 Dysregulation of IFN Induction and Signaling Pathways in Cancer Cells ................... 37
1.4.1 Overview ................................................................................................................. 37
1.4.2 TLRs in Cancer ....................................................................................................... 37
1.4.3 NFкB in Cancer ...................................................................................................... 38
1.4.4 PKR in Cancer ........................................................................................................ 39
1.5 Peritoneal Carcinomatosis (PC) .................................................................................... 40
1.5.1 Overview ................................................................................................................. 40
1.5.2 PC Tumor Origin and Incidence ............................................................................. 40
1.5.3 Colorectal Cancer (CRC) ........................................................................................ 41
1.5.4 Ovarian Cancer ....................................................................................................... 41
1.5.5 Pathophysiology and Biology of PC ....................................................................... 42
1.5.6 Treatment of CRC PC and Ovarian PC .................................................................. 43
1.5.7 Clinical Need .......................................................................................................... 45
1.6 Aims and Hypothesis .................................................................................................... 47
1.6.1 Rationale ................................................................................................................. 47
1.6.2 Hypothesis............................................................................................................... 47
1.6.3 Specific Aims .......................................................................................................... 48
ix
Chapter 2: Materials and Methods ........................................................................................... 49
2.1 Cell Lines ...................................................................................................................... 49
2.2. Vaccinia Viruses ........................................................................................................... 49
2.3. Creation of the Candidate Vaccinia Virus Deletion Mutants ....................................... 50
2.4. Viral DNA Extraction and PCR .................................................................................... 51
2.5. Virus Stock Production ................................................................................................. 52
2.6. Virus Plaque Assay ....................................................................................................... 53
2.7. Viral Replication ........................................................................................................... 53
2.8. Viral Cytotoxicity ......................................................................................................... 54
2.9. Measuring Viral Spread by Red fluorescent protein (RFP) Expression ....................... 54
2.10. Tumor Spheroid Generation, Infection, and Analysis .................................................. 54
2.11. Mice .............................................................................................................................. 55
2.12. In vivo Toxicity Studies ................................................................................................ 55
2.13. Syngeneic Model .......................................................................................................... 56
2.14. Xenograft Model ........................................................................................................... 56
2.15. Biodistribution .............................................................................................................. 56
2.16. Statistical Analysis ........................................................................................................ 57
Chapter 3: Results....................................................................................................................... 58
3.1 Aim 1: Generate VV-deletion mutants via homologous recombination ...................... 58
x
3.2 Aim 2: Compare candidate VV deletion mutants to vvDD in terms of in vitro viral
replication, cytotoxicity, and spread in colon and ovarian cancer cell lines. ............................ 71
3.3 Aim 3: Characterization of the candidate VV deletion mutants to vvDD in terms of in
vivo tumor-selectivity, toxicity and efficacy in mouse models of PC. ..................................... 92
Chapter 4: Discussion ............................................................................................................... 103
4.1. General Discussion ..................................................................................................... 103
4.2. Project Summary ......................................................................................................... 113
4.3. Experimental Challenges and Limitations .................................................................. 113
4.3.1. Tumor Spheroids ................................................................................................... 113
4.3.2. In vitro to In vivo translation ................................................................................. 115
4.3.3. Mouse Models ....................................................................................................... 116
4.3.4. Intraperitoneal Tumor Implantation ...................................................................... 117
4.3.5 IFN Sensitivity in Tumors .................................................................................... 118
4.4. Future Directions ........................................................................................................ 119
4.4.1. Determining the Mechanisms of Action ............................................................... 119
4.4.2. Potential Treatment for Other Cancer Types ........................................................ 121
4.4.3. Improving VV Delivery ........................................................................................ 121
4.4.4. Combination Therapy ........................................................................................... 122
4.4.5. Deletion of Other VV Immunomodulatory Genes................................................ 123
4.5. Final Remarks ............................................................................................................. 124
xi
References .................................................................................................................................. 125
xii
List of Figures
Figure 1.1. Vaccinia virus (VV) enacts multiple mechanisms of action against tumors. ............... 7
Figure 1.2. Vaccinia virus life cycle. ............................................................................................ 12
Figure 1.3 Interactions between pathogen recognition receptors (PRR) and vaccinia virus (VV)
inhibitory proteins. ........................................................................................................................ 26
Figure 1.4. The interferon (IFN) signaling pathway and the vaccinia virus (VV) inhibitors. ...... 32
Figure 3.1. Schematic diagram of shuttle plasmid and final construct of candidate VV deletion
mutant using ∆N1L VV as an example. ....................................................................................... 59
Figure 3.2. Confirmation of pvX-R2R-LUC plasmid. .................................................................. 60
Figure 3.3. Left and right flanking DNA fragments of VV N1L gene as generated by PCR. ...... 61
Figure 3.4. Confirmation of pVX-R2R-Luc with left-flanking DNA insertion. .......................... 62
Figure 3.5. Confirmation of the final shuttle plasmid. .................................................................. 63
Figure 3.6. Sample images of CV-1 cells after transfection/infection and subsequent rounds of
re-infection with recombinant VV. ............................................................................................... 65
Figure 3.7. PCR confirmation of the absence of parental virus from recombinant VV plaques. . 68
Figure 3.8. PCR confirmation of candidate viral stocks. .............................................................. 70
Figure 3.9. Replication of candidate VVs and vvDD in monolayers of colon and ovarian cancer
cell lines. ....................................................................................................................................... 74
Figure 3.10. Viral spread of VV deletion mutants and vvDD in monolayers of colon and ovarian
cancer cell lines. ............................................................................................................................ 76
Figure 3.11. Quantification of viral spread in monolayers of colon and ovarian cancer cell lines.
....................................................................................................................................................... 77
xiii
Figure 3.12. Cytotoxicity of vvDD and candidate VVs towards colon and ovarian cancer cell
lines. .............................................................................................................................................. 81
Figure 3.13. Viral spread of candidate VVs and vvDD in MC38 tumor spheroids. ..................... 83
Figure 3.14. Viral spread of candidate VVs and vvDD in DLD-1 spheroids. .............................. 84
Figure 3.15. MC38 spheroid size after treatment with candidate VVs or vvDD. ......................... 86
Figure 3.16. Clonogenic assay of tumor spheroids treated with candidate VVs or vvDD. .......... 89
Figure 3.17. Determining the IP MTD of candidate VVs in nude and C57BL/6 mice. ............... 94
Figure 3.18. Biodistribution of candidate VVs and vvDD in tumor-bearing mice. ...................... 99
Figure 3.19. Efficacy of candidate VVs and vvDD in a syngeneic model of PC. ...................... 100
Figure 3.20. Efficacy of candidate VVs and vvDD in xenograft models of PC. ........................ 102
xiv
List of Tables
Table 2.1. Primers for producing inserts for the shuttle plasmid .................................................. 51
Table 3.1. Summary of the in vitro assays comparing candidate VVs to vvDD .......................... 91
xv
List of Abbreviations
AFP – alpha-fetoprotein
APC – adenomatous polyposis coli
ARID1A – AT-rich interaction domain 1A
ATCC – American Type Culture Collection
BCA – bicinchonic acid
Bcl-2 – B-cell lymphoma 2
bp – base pair
BRAF – v-raf murine sarcoma viral oncogene homolog B1
BSA – bovine serum albumin
CARD – caspase-recruitment domain
CD150 – cluster of differentiation 150
CD20 – cluster of differentiation 20
CD38 – cluster of differentiation 38
CD4 – cluster of differentiation 4
CD44 – cluster of differentiation 44
CD46 – cluster of differentiation 46
CD8 – cluster of differentiation 8
xvi
cDC – conventional dendritic cell
CEV – cell-associated enveloped virus
CEV – cellular-associated enveloped virion
Cox2 – cyclooxygenase 2
CRC – colorectal cancer
CrKL – v-crk sarcoma virus C10 oncogene homology (avian)-like
CRS – cytoreductive surgery
CTNNB1 – catenin beta 1
d – day(s)
DAI – DNA-dependent activator of interferon-regulatory factor
DAMP – damage-associated molecular pattern
DC – dendritic cells
DIC – differential interference contrast
DMEM – Dulbecco‘s Modified Eagle Medium
DMSO – dimethyl sulfoxide
DNA – deoxyribonucleic acid
dpi – days post-infection
ds – double-stranded
EEV – enveloped extracellular virion
xvii
EEV – extracellular enveloped virus
EGF – epidermal growth factor
EGFR – epidermal growth factor receptor
eIF2α – eukaryotic initiation factor 2 alpha
EMT – epithelial-mesenchymal transition
EPIC – early post-operative intraperitoneal therapy
ERK – extracellular signal-related kinase
FADD – Fas-associated protein with death domain
FBS – fetal bovine serum
GAF – interferon γ activation factor
GAG – glycosaminoglycan
GAS – gamma-activated sequence
GDP – guanine diphosphate
GM-CSF – granulocyte macrophage colony stimulating factor
GTP – guanine triphosphate
h – hour(s)
HBSS – Hank‘s buffered saline solution
HCC – hepatocellular carcinoma
HIPEC – hypothermic intraperitoneal chemotherapy
xviii
HMGB1 – high mobility group box 1
hpi – hours post-infection
HSP90 – heat shock protein 90
HSV – herpes simplex virus
IEV – intracellular enveloped virion
IFI16 - IFNγ-inducible protein 16
IFN - interferon
IFNAR1– interferon α receptor
IFNGR – interferon γ receptor
IFNLR – interferon λ receptor
IKK – IκB kinase
IL-1 – interleukin 1
IMV – intracellular mature virion
iNOS – nitric oxide synthase
IP – intraperitoneal
IPS-1- interferon β promoter stimulator 1
IRAK – interleukin 1 receptor kinase
IRF – interferon regulatory factor
ISG – interferon-stimulated genes
xix
ISGF3 – interferon-stimulated gene factor 3
ISRE – interferon-stimulated regulatory elements
IT – intratumoral
IV – intravenous
JAK – Janus kinase
KRAS – Kirsten rat sarcoma viral oncogene homolog
LD50 – lethal dose 50
LGP2 – laboratory of genetics and physiology -2 protein
MAL – MyD88 adaptor-like protein
MAPK – mitogen-activated protein kinases
MDA5 – melanoma differentiation-associated gene 5
Mda7 – melanoma-differentiation associated gene 7
MOI – multiplicity of infection
mRECIST – modified Response Evaluation Criteria in Solid Tumors
MTD – maximum tolerable dose
mTORC – mammalian target of rapamcycin complex
MTS – 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-
tetrazolium
MV – measles virus
MVA – modified vaccinia Ankara
xx
MyD88 – myeloid differentiation factor 88
NDV – Newcastle disease virus
NF-κB – nuclear factor kappa-light-chain-enhancer of activated B cells
NK – natural killer
NLR – nucleotide-binding oligomerization domain (NOD)-like receptor
NYVAC – New York vaccinia virus
OV – Oncolytic virus
PACT – PKR (protein kinase R)-associated factor
PAMP – pathogen-associated molecular pattern
PC – peritoneal carcinomatosis
pDC – plasmacytoid dendritic cells
pfu – plaque-forming units
PIK3CA – Phosphatidylinositol-4, 5-biphosphate 3-kinase catalytic subunit alpha
PKC – protein kinase C
PKR – protein kinase R
Poly HEMA – poly(2-hydroxyethylmethacrylate)
PRR – pathogen recognition receptors
RFP – red fluorescent protein
RHD – Rel-homology domain
xxi
RIG-1 – retinoic-acid inducible gene-1
RIP – receptor interacting protein
RLR – retinoic acid inducible gene 1 (RIG-1)-like receptor
RPMI 1640 – Roswell Park Medical Institute medium
RV – reovirus
SARM – Sterile-α and armadillo motif-containing protein
SD – standard deviation
SEM – standard error of the mean
ss – single-stranded
STAT – signal transducer and activator of transcription
TAB – TAK1 (TGFβ ( transforming growth factor β) – activated kinase 1)-binding proteins
TAK1 – TGFβ ( transforming growth factor β) – activated kinase 1
TBK1 – TRAF family member-associated NFκB activator-binding kinase 1
TGFβ – transforming growth factor β
TIC – tubal intraepithelial carcinoma
TICAM -1 – toll-like receptor adaptor protein 1
TIR – Toll/interleukin 1 receptor homology
TIRAP – TIR (Toll/interleukin 1 receptor homology)-domain containing adaptor protein
TK – thymidine kinase
xxii
TLR – Toll-like receptor
TNFα – tumor necrosis factor α
TRADD – tumor necrosis factor receptor type 1 – associated death domain
TRAF – tumor necrosis factor receptor-associated factor
TRAM – TRIF (toll receptor associated activator of interferon)-related adaptor molecule
TRBP – trans- activation response RNA-binding protein
T-reg – regulatory T-cells
TRIF – toll receptor-associated activator of interferon
T-Vec – talimogene laherparepvec
TYK2 – tyrosine kinase
VEGF – vascular endothelial growth factor
VGF – vaccinia growth factor
VIPER – viral inhibitor peptide of toll-like receptor 4
VSV – vesicular stomatitis virus
VV – Vaccinia virus
vvDD – double-deleted vaccinia virus
WR – Western Reserve
xgprt – xanthine-guanine phosphoribosyltransferase
ZBP1 – Z-DNA binding protein 1
1
Chapter 1
1 Introduction
1.1 Oncolytic Viruses
1.1.1 Overview
Chemotherapy and radiotherapy are often used as a non-surgical means to treat many
malignancies today; however, these treatments are considerably non-specific and have many
detrimental side effects. The aim of oncolytic virotherapy is to use replication-competent viruses
to kill tumor cells while leaving normal cells unscathed. Several viruses have been examined as
potential virotherapy agents such as Newcastle disease virus (NDV), reovirus (RV), measles
virus (MV), herpes simplex virus (HSV), vesicular stomatitis virus (VSV), and vaccinia virus
(VV). Some viruses usually replicate in non-human hosts but are found to be naturally
oncotropic (e.g. NDV, RV) while other oncolytic viral vectors have enhanced tumor-selectivity
based on engineered attributes (e.g. VV, VSV, MV) (Antonio Chiocca, 2002). Many factors
determine host susceptibility to virus infection including: receptor expression, proliferation rate,
response to cell death signals, and the host immune response against viruses. The hallmarks of
individual cancer cells often overlap with characteristics that a virus seeks to induce to benefit
the infection. Thus tumor cells can be an ideal environment for viral replication and lysis. Some
of these characteristics include: increased cell proliferation, nucleotide synthesis, and protein
synthesis and decreased apoptosis and interferon-mediated antiviral responses (Ilkow et al.,
2014). Many oncolytic viruses (OV) in the clinic are engineered to more selectively replicate in
tumors based on increased cell proliferation rates (McCart et al., 2001; Breitbach et al., 2015).
The oncolytic viruses generated through this project were designed to exploit the decreased
interferon-mediated antiviral responses to confer enhanced tumor-selectivity in VV.
2
1.1.2 History and Development
As early as the mid-1800s, there were several reports of tumor regression in cancer patients
naturally infected with viruses (Kelly and Russell, 2007). In one of the most widely cited cases,
Dock describes a temporary but dramatic 70-fold decrease in leukocyte count during an
influenza infection in a 42-year old woman with leukemia (Dock, 1904). Reports of cancer
remission was also noted to occur concurrently with measles, varicella, and hepatitis infections
(Kelly and Russell, 2007). Though highly unethical, the first attempts to exploit viruses for
therapeutic gain in cancer treatments started in the beginning of the 20th
century by injecting
cancer patients with infectious bodily fluids or tissues derived from patients with ongoing
infections (Kelly and Russell, 2007). These naturally-occurring viruses were coined first-
generation oncolytic viruses. In the 1950s and 60s, tissue culture techniques allowed for more
reliable production of viruses, adaptation of wildtype viruses to become more oncotropic by
multiple passages in tumor cells, and the investigation of the therapeutic efficacy of oncolytic
viruses in animal models. Yet, interest for oncolytic virotherapy dwindled in the 1970s and 80s
due to dose-limiting toxicities or the lack of therapeutic efficacy in first-generation OVs and no
alternative methods to improve them (Kelly and Russell, 2007; Cattaneo et al., 2008).
Beginning in the early 1990s, the advent of recombinant DNA techniques coupled with a deeper
understanding of virology and cancer biology led to the development of second-generation
oncolytic viruses which have genetic manipulations that enhance tumor-selectivity of a first-
generation oncolytic virus. One of the first genetically-engineered oncolytic viruses to be used in
humans was ONYX-015, which is derived from a hybrid of Ad2/Ad5 serotypes of adenovirus.
The deletion of p53-inhibitory protein, E1B-55kD, was proposed to limit the replication of the
adenovirus to p53-deficient cells such as tumors because the majority of human cancers have lost
p53 pathway function (Bischoff et al., 1996; Kirn, 2001). Although the exact mechanism of
selectivity has been debated (Dix et al., 2001; Kirn, 2001) and the clinical efficacy was minimal
(Kirn, 2001), clinical trials with ONYX-015 became the proof of principle that OVs can be
systemically delivered safely and infect and replicate in tumors within humans (Kirn, 2001).
3
In addition to genetic manipulations to enhance tumor-selectivity, third-generation oncolytic
viruses are armed with therapeutic genes to improve potency and efficacy. Several arming
strategies have been employed to 1) improve virus spread, 2) enhance the immunostimulatory
effect of the virus on the host against the tumor, 3) disrupt tumor vasculature, 4) or work in
combination with other cancer therapies by encoding a prodrug-converting enzyme (Kirn and
Thorne, 2009). One promising example of a third-generation OV is Pexa-vec (JX-594) which is a
Wyeth strain VV with a deletion in its thymidine kinase (TK) gene to enhance its tumor-
selectivity and armed with human granulocyte-macrophage colony stimulating factor (GM-CSF)
to drive the proliferation of white blood cells and stimulate the host immune response against the
cancer during virus infection (Kim et al., 2006b; Breitbach et al., 2015). Preclinical and clinical
testing of Pexa-vec has demonstrated safety, anti-cancer immunity stimulation, and improved
survival (9 months) of late-stage heptacellular carcinoma patients treated with a high dose
Pexa-vec compared to the low dose cohort (Heo et al., 2013).
1.1.3 Mechanisms of Tumor-Specificity
OVs are tumor-selective based on intrinsic and/or engineered attributes. Many attributes in
cancer cells are already congruent with the characteristics that create an optimal environment for
virus entry, replication, and cytotoxicity (Ilkow et al., 2014). For example, adenovirus type II
(Segerman et al., 2003) and measles virus binds to the cell surface receptor CD46 for entry,
which is commonly upregulated in cancer cells (Anderson, 2004).
In addition to the intrinsic characteristics that make certain viruses preferentially infect and kill a
tumor cell, researchers also engineer OVs to build upon its natural tumor tropism. Engineered
OV tumor-selectivity usually employs one or more of the following strategies: 1) deleting genes
that are redundant for replicating in tumor cells but remain essential for replication in normal
cells, 2) redirecting viral entry by altering the proteins involved to target ligands commonly
overexpressed or uniquely found in tumors, 3) and subjecting genes essential for viral replication
under the control of a cancer-specific promoter (Cattaneo et al., 2008).
4
The first strategy could be employed in almost all OVs which are complex enough to express
genes that are redundant for successful propagation in tumors. One of the most popular strategies
is to exploit the pool of available nucleotides in actively dividing cells such as tumors cells, but
not quiescent normal tissues (Ilkow et al., 2014). Large viruses such as HSV and orthopoxviruses
express proteins to increase nucleotide synthesis to support its viral replication and virion
assembly, ensuring self-sufficient replication even in quiescent cells. Deletion of whole or
subunits of virally-encoded proteins that skew DNA synthesis, such as the ICP6 gene that
encodes the large subunit of ribonucleotide reductase from HSV-1 and HSV-2 (Chung et al.,
1999) or the thymidine kinase (TK) gene from VV (Puhlmann et al., 2000), restricts viral
replication to occur selectively in actively dividing cells such as tumor cells. However, deleting
genes in OVs that restrict its replication in actively dividing cells often compromises its potency
against quiescent tumour-initiating cells.
Another promising strategy involves exploiting the defective host immune response against
viruses in tumors. An estimated 65-70% of all cancers have some defects in interferon (IFN)
signaling, crippling the ability of the tumor cell to fight against a virus infection (Stojdl et al.,
2003). Viruses often express proteins to counter host antiviral mechanisms which may not be
necessary to infect a tumor cell. Engineered tumor-selectivity on the basis of this strategy could
be subtle, as in VV which expresses many immunomodulatory proteins (discussed in Section
1.3.), or dramatic, as in VSV which becomes vastly sensitive to interferon when its matrix M
protein is mutated (Stojdl et al., 2003).
The second strategy is to affect viral entry based on tumor cell-surface proteins (Cattaneo et al.,
2008; Verheije and Rottier, 2012). However, this approach is limited to viruses that require
specific known proteins for viral entry such as measles virus (Anderson, 2004) or adenovirus
(Zhang and Bergelson, 2005). For viruses that use unknown host-cell receptors for entry or have
complex viral entry mechanisms, such as HSV (Akhtar and Shukla, 2009) or poxviruses
(Schmidt et al., 2012), this method would not be suitable. Nevertheless, this strategy has been
shown to elicit tumor-selectivity when it is amenable. For example, single chain fragment
variable (scFv) antibodies have been incorporated into the measles virus receptor to retarget the
5
virus to other receptors commonly expressed on the surfaces of tumor cells instead of its natural
receptors, such as CD46 (Anderson, 2004) and CD150 (Tatsuo et al., 2000), CD20 (non-
Hodgkins lymphoma) (Bucheit et al., 2003) and CD38 (myeloma) (Peng et al., 2003).
The tumor-selectivity of oncolytic viruses can also be engineered at the transcriptional level by
putting essential viral genes for replication under the control of a cancer-specific promoter, thus
restricting viral propagation to specific cancers (Cattaneo et al., 2008; Antonio Chiocca, 2002).
This approach is widely used in large DNA viruses such as HSV-1 and adenovirus (Antonio
Chiocca, 2002). A prime example is the oncolytic adenovirus CN706 where the viral early gene,
E1A, is downstream of the prostate-specific antigen promoter, which causes the virus to
selectively replicate in prostate cancer cells (Rodriguez et al., 1997). Other adenoviruses have
been reprogrammed by subjecting E1A under the control of other tumor tissue-specific promoters
such as alpha-fetoprotein AFP (hepatocellular carcinoma) (Li et al., 2001) and uroplakin-II
(bladder cancer) (Zhang et al., 2002).
1.1.4 Mechanisms of Action
OVs are attractive anti-cancer agents due to the multiple mechanisms OVs employ that lead to
tumor cell death (Figure 1.1) (Kirn and Thorne, 2009). When the field of oncolytic virotherapy
was in its infancy, tumor debulking via direct viral killing of cancer cells was accepted as the
main mechanism of anti-cancer efficacy. Indeed, a variety of viruses, such as NDV (Wakamatsu
et al., 2006), encode distinct proteins that cause cell lysis. Interestingly, VV can induce apoptosis
in melanoma cell line Mel526 (Greiner et al., 2006), yet ovarian cancer cell lines (A2780,
SKOV3, TOV21G) undergo programmed necrosis (Whilding et al., 2013). Since VV encodes
many genes, it is possible that VV induces cell death via many mechanisms depending on cell
type and VV strain. Many OVs have also been engineered with cytotoxic proteins to aid in
tumor-killing.
6
Further investigations suggest that an interplay between the virus and the host immune system in
the tumor microenvironment also work together to kill tumors. In addition to infecting the tumor
itself, VV and VSV specifically infect tumor vasculature leading to neutrophil attraction and
eventual vascular occlusion that cuts off the tumor blood supply, causing tumor necrosis
(Breitbach et al., 2011b; Breitbach et al., 2013; Angarita et al., 2013).
The last mechanism involves overcoming the immunosuppressive tumor microenvironment and
changing it into an immunostimulatory setting that allows for the development of an anti-tumor
adaptive response and subsequent long-term immunological memory (Kirn and Thorne, 2009).
Viral infection of tumors and surrounding tissue activates the interferon signaling cascade
mediated by pathogen-associated molecular patterns (PAMPs) recognized by pattern recognition
receptors (PRR) such as Toll-like receptors (TLRs), RIG-like receptors (RLRs) and Nod-like
receptors (NLRs). The infection can induce immunologic cell death which triggers the release of
damage-associated molecular patterns (DAMPS) such as calreticulin, high mobility group box 1
(HMGB1), and heat shock protein 90 (HSP90) (Guo et al., 2014). In concert, these pathways
lead to the release of a plethora of inflammatory cytokines to counteract the immunosuppressive
tumor microenvironment, enabling plasmacytoid dendritic cells to prime naive T-cells with the
tumor antigens that were released along with the viral antigens during tumor cell lysis, initiating
the host adaptive immunity against the cancer cells and the eventual immunological memory that
leads to long-term immunity (Workenhe and Mossman, 2014; Guo et al., 2014; Melcher et al.,
2011; Bartlett et al., 2013).
7
Figure 1.1 Vaccinia virus (VV) enacts multiple mechanisms of action against tumors. VV has multiple anti-
tumor mechanisms. First, it can directly infect, replicate and lyse tumor cells. VV can also specifically infect tumor
endothelial cells which lead to vascular collapse either by the direct infection or the infiltration of neutrophils that
cause occlusion. Last, tumor cell infection and lysis leads to the release of proinflammatory cytokines, danger
signals, and tumor and VV antigens, which can change the immunosuppressive environment into a pro-
inflammatory environment that induces an anti-tumor innate and adaptive immune response. This environment can
also induce DC maturation and antigen presentation, priming long-term anti-tumor immunity. [Reprinted with
permission by McMillan Publishers [NATURE REVIEWS CANCER] (Kirn, D. and Thorne, S. Targeted and armed
oncolytic poxvirus: a novel multi-mechanistic therapeutic class for cancer), Copyright 2009. (Kirn and Thorne,
2009)
8
1.1.5 Vaccinia Virus
Vaccinia virus (VV) was most famously involved with the global eradication of smallpox;
however its origins still remain elusive. Originally, Edward Jenner isolated cowpox from
milkmaids to use as a vaccine against smallpox (Riedel, 2005). Vaccination is usually
administered via dermal scarification (Damon, 2013). After more than 130 years of passaging the
virus, it became clear that the live vaccine had become a distinct virus from cowpox and was
henceforth called vaccinia virus. There are many strains of vaccinia virus which vary in
virulence towards humans and other mammals including: Wyeth, Lister, Copenhagen, Western
Reserve, TianTian, modified vaccinia Ankara (MVA), and NYVAC (Kirn and Thorne, 2009).
Today, VV is also investigated for its potential as an oncolytic virus.
1.1.5.1. Clinical Safety of VV as a Smallpox Vaccine
As a result of its global use as a smallpox vaccine, the safety profile of vaccinia virus is well-
documented (Lane et al., 1970; Belongia and Naleway, 2003). Transmission usually occurs
through accidental inoculation to close contacts (Silva et al., 2010). Vaccinia pathophysiology
can be mild or serious and systemic. Mild, self-limited symptoms include satellite lesions, fever,
muscle aches, regional enlargement of lymph nodes, headache, nausea, rash, and soreness at the
vaccination site (Belongia and Naleway, 2003). A re-investigation of the smallpox vaccination in
the U.S. military has also associated mild myocarditis to vaccinia (5.5/10 000 vaccinations)
(Morgan et al., 2008). More serious adverse events such as death (1/million vaccinations),
progressive vaccinia (1.5/ million vaccinations), eczema vaccinatum (39/million vaccinations),
postvaccinial encephalitis (12/ million vaccinations), and generalized vaccinia (241/million
vaccinations) are infrequent (Belongia and Naleway, 2003; Lane et al., 1970). However, serious
adverse events are often limited to immune-immature and immunodeficient individuals such as
infants or older adults with defects in their cell-mediated immunity, respectively (Belongia and
Naleway, 2003).
9
1.1.5.2 Vaccinia Virus Biology
VV is part of the Poxviridae family and the Orthopoxvirus genera. The virus is characterized by
a double-stranded DNA genome within a brick-shaped particle of approximately 300 x 240 x 120
nm. Its 192 kb genome containing about 200 non-overlapping genes is arranged such that genes
crucial for viral replication are in a central conserved region while immunomodulatory and other
host interaction genes are at its end regions, flanked by two inverted terminal repeats that form a
hairpin loop at the ends. Within the virus, VV also encapsidates viral proteins such as DNA
polymerase, early transcription factors, DNA-dependent RNA polymerase, and capping proteins
to facilitate its replication in the cytoplasm and comprise its viral transcriptosome (Moss, 2013).
VV exists as two infectious forms: intracellular mature virus (IMV) and extracellular enveloped
virus (EEV). IMV is surrounded by a single lipoprotein membrane while EEV has an additional
host-cell derived membrane. The two forms of VV have different surface proteins and structural
differences determine the role and function of IMV and EEV forms within the VV life cycle
(Smith et al., 2002; Roberts and Smith, 2008). Most VVs are in its IMV form and are released
after cell lysis, but a small amount of EEVs can be released prior to lysis for long-range
dissemination (Roberts and Smith, 2008). The two forms are also antigenically different where
IMV has many targets for antibody neutralization but the A5 protein is the only known EEV
surface protein that induces neutralization (Putz et al., 2006). Laboratory stocks of VVs are in
IMV form as the isolation process damages the delicate outer lipoprotein layer in EEVs.
VV has a broad host range owing to its versatile cell attachment and entry mechanisms. An
unprecedented number of at least 16 proteins on the IMV membrane are involved in VV entry: 4
for cell binding, and 12 for membrane penetration (Laliberte et al., 2011); after initial cell contact
and before EEV entry, the non-fusogenic dissolution of the second outer membrane reveals the
IMV surface (Law et al., 2006). The cellular entry receptor for VV is still unknown but laminin
(Chiu et al., 2007) or ubiquitously-expressed cell-surface glycosaminoglycans (GAGs) such as
heparan sulfate (Chung et al., 1998) or chondroitin sulfate (Hsiao et al., 1999) have been shown
10
to be important but not always necessary to facilitate VV binding depending on cell type (Carter
et al., 2005; Chiu et al., 2007). IMV can enter cells by endocytosis (Townsley et al., 2006) or
fusion with the plasma membrane (Carter et al., 2005), however VV attachment and primary
mechanisms of entry are dependent on the host cell type and VV strain (Whitbeck et al., 2009;
Bengali et al., 2009).
Vaccinia virus has a complex morphogenic pathway (Figure 1.2) (McFadden, 2005; Roberts and
Smith, 2008). After cell entry, the virus core is released into the cytoplasm and transported by
microtubules to the perinuclear region (Carter et al., 2003) where the virus-associated
transcriptosome begins the early transcription process. Early genes express proteins that initiate
DNA replication, modify the host cell environment, and evade the host antiviral response. Then,
intermediate genes encode regulatory factors for late gene transcription which are involved in
producing proteins for new virus particles and a set of enzymes packaged into the new virion for
the next infection cycle (reviewed in (Broyles, 2003) ). Concomitantly, viral progeny are formed
in the cytoplasm away from cellular organelles, termed ―viral factories‖. The first visible
progeny are lipid- and protein-containing crescent-shaped immature virions that eventually grow
into oval or spherical shapes that encapsulate the virus core. The virion becomes the
characteristic brick-shaped IMV after proteolytic cleavage packages the VV DNA genome inside
the structure (Smith et al., 2002). The morphogenesis of most virions remain in the cytosol as
IMV until cell lysis, but a small percentage are transported by microtubules to become wrapped
in a membrane derived from either endosomes (Tooze et al., 1993) or the Golgi complex
(Schmelz et al., 1994) to become the EEV intermediate, intracellular enveloped virus (IEV), and
transfer to the cell periphery. At the periphery, actin tail formation pushes the cell-associated
enveloped virus (CEV) towards adjacent cells or releases the virion as free EEV (Smith et al.,
2002).
11
Vaccinia Virus Life Cycle
12
Figure 1.2. Vaccinia virus life cycle. The entire VV life cycle occurs in the cytoplasm by a complex pathway.
There are two forms of infectious VV particles: IMV and EEV, which is an IMV particle wrapped in an extra cell-
derived membrane. The cell-surface glycoproteins also differ between these two forms with IMV containing more
antigenic proteins. Entry of IMV by endocytosis or fusion is mediated by several VV proteins that interact with cell-
surface GAGs. EEV sheds its outer layer before entry. VV particles are transported to the perinuclear space by
microtubules to undergo early, intermediate, and late protein synthesis in ‗viral factories‘. After maturation, most
IMV stay in the cytosol until lysis. Some IMV are wrapped in a endosome- or Golgi-derived membrane to form IEV
which is pushed to the cell surface to form CEV which may be pushed further away by actin polyermization to
release free EEV particles. Abbreviations: VV – vaccinia virus, IMV – intracellular mature virus, EEV, extracellular
enveloped virus, GAG – glucosaminoglycan, IEV – intracellular enveloped virus, CEV – cell-associated enveloped
virus. [Reprinted with permission from McMillan Publishers: [NATURE REVIEWS MICROBIOLOGY]
(McFadden, G. Poxvirus tropism. 3(3): 201-213), Copyright 2005. (McFadden, 2005)
1.1.5.3 Advantages of Vaccinia Virus as an Oncolytic Virus
There are many attributes that make vaccinia virus a good candidate as an oncolytic virus:
The VV life cycle is spent entirely in the cytoplasm so the risk of integrating the viral
genome into the host chromosome is minimal (Moss, 2013)
VV has a broad host tropism allowing for its investigation as an anti-cancer agent in
numerous preclinical animal models and its application in humans (McFadden, 2005)
Vaccinia virus, unlike most OVs, remains stable in the blood after intratumoral (IT) and
intravenous (IV) injection. After initial tumor infection, some progeny is released in the
EEV form, which has an extra cell membrane layer with host complement control
proteins that protects the virus from immune recognition by complement or antibodies in
the blood (Vanderplasschen et al., 1998), allowing better delivery to tumors.
13
The VV genome can be easily engineered by standard DNA manipulation techniques. Up
to 25kb of DNA sequence can be inserted without deleting anything from its genome. VV
also has many non-essential genes that may also be deleted from its genome. Naturally
encoded or synthetically-developed promoters that drive high gene expression in VV are
also of merit (Damon, 2013; Guse et al., 2011).
VV has an excellent safety profile in humans which was demonstrated during its use in
the smallpox eradication program. Clinical information such as adverse events and
symptoms upon VV infection are extensively documented (Belongia and Naleway, 2003;
Lane et al., 1970).
1.1.5.4 Double-deleted vaccinia virus - vvDD
vvDD is a Western Reserve vaccinia virus with two non-essential gene deletions from its
genome: thymidine kinase (TK) and vaccinia growth factor (VGF) (McCart et al., 2001). Single
deletions of these genes from the VV genome have been shown to attenuate VV in normal cells
compared to wildtype WR VV (Buller et al., 1988a; Buller et al., 1985), but the double-deletion
works synergistically to further enhance VV tumor selectivity while maintaining wild-type
replication ability in tumors (McCart et al., 2001).
In humans, TK1 catalyzes the conversion of nucleoside thymine to thymidine monophosphate
(dTMP) in the salvage pathway in order to maintain of pool of nucleosides for dividing cells.
Human TK1 expression is mainly limited to the S-phase in normal cells (Sherley and Kelly,
1988) so VV expresses its own TK to ensure a supply of nucleotides to facilitate viral replication
at all stages of the cell cycle (Black and Hruby, 1991). Hence, the deletion of TK from VV
restricts viral replication to cells intrinsically expressing TK; an optimal host would be tumor
cells as many malignancies have been reported to constantly express TK at high levels (Topolcan
and Holubec, 2008). The deletion of VV TK- have been shown to reduce virulence (Buller et al.,
14
1985). Additionally, a TK-deleted vaccinia virus expressing luciferase was at least a 672-fold
higher in vivo luciferase expression in tumors compared to normal tissues (Puhlmann et al.,
2000).
Viral VGF is a secreted homologue of epidermal growth factor (EGF) that specifically binds to
the EGFR in uninfected adjacent cells to stimulate DNA replication and cellular proliferation
(Buller et al., 1988b; Stroobant et al., 1985), thereby preparing an optimal environment for
subsequent viral infection and replication. The deletion of VGF renders VV replication
dependent on inherently-initiated mitotic status. The LD50 of the VGF- VV for intracranial
injection in mice was 1000-fold higher than the wildtype WR VV (Buller et al., 1988a).
The potential of vvDD as an oncolytic agent has been tested both clinically and pre-clinically. In
one of its first pre-clinical evaluations, vvDD replication in normal tissues was similar or lower
than wildtype, TK-, and VGF-deleted VV replication in systemically-treated nude tumor-bearing
mice while maintaining a similarly high viral load within tumors (McCart et al., 2001). Its safety
was further supported in non-human primate studies where vvDD was significantly less toxic
than wildtype WR VV after intradermal injection, isolated limb perfusion, and IV treatment
(Naik et al., 2006). Its clinical efficacy is discussed in Section 1.1.6.1 below.
1.1.6 Oncolytic Viruses in Clinical Trials
No less than 96 clinical trials were initiated are ongoing for the investigation oncolytic viruses in
the clinic since January 2008 (Pol et al., 2015). Engineered vectors include but are not limited to
adenovirus, coxsackievirus, herpes simplex virus, measles virus, Newcastle disease virus,
reovirus, vaccinia virus, and vesicular stomatitis virus (Russell et al., 2012). Clinical trials offer
valuable information in terms of safety, adverse events, and therapeutic efficacy in humans.
15
The majority of clinical trials with OVs are in phase 1 and 2 with a primary endpoint to
determine the safety of the virus, dosing routes and schedules and the maximum tolerable dose
(MTD); though, efficacy was evaluated as a secondary endpoint. Current oncolytic viruses were
shown to be clinically safe and MTDs are often restricted by manufacturing limitations rather
than dose limiting toxicities (Russell et al., 2012; Miest and Cattaneo, 2014). Predominantly, the
side effects of local and systematic oncolytic virotherapy treatment have been transient and
tolerable with scant reports of serious adverse events. The most common treatment-related
adverse events were grade 1/2 flu-like symptoms such as fever, malaise, headache, and chills
(Lichty et al., 2014; Miest and Cattaneo, 2014). More severe toxicities are dependent on the virus
construct in addition to dosing routes (e.g. intravenous, intratumoral, intraarterial, or
intraperitoneal (IP)). For example, low-grade intravascular coagulation and transient
transaminitis was related to IV adenovirus (ONYX-015) treatment (Small et al., 2006;
Nemunaitis et al., 2001) while IV VV (JX-594) was associated with transient transaminitis and
cutaneous pustules (Heo et al., 2013). To date, there were no reports of treatment-related death
with oncolytic virotherapy (Russell et al., 2012; Liu et al., 2007). Overall, the safety profile and
adverse events of oncolytic virotherapy compare favourably in contrast to other phase I oncology
trials (Horstmann et al., 2005).
Environmental shedding is a concern that is unique to oncolytic virotherapy as a cancer
treatment: there is a possibility the virus may be released into the environment from the treated
patient, then mutate and regain wildtype pathogenicity; however current clinical data do not
support this concern (Liu et al., 2007; Buijs et al., 2015). Out of the clinical trials that evaluate
the presence of virus in urine, feces, or saliva, very few detect infectious particles (Liu et al.,
2007). Among the trials that report evidence of viral shedding in the urine, as an example, virus
levels were low and shedding was transient (Laurie et al., 2006; Deweese et al., 2001; Kimball et
al., 2010; Comins et al., 2010). For example, less than 50 infectious particles/ml of oncolytic
adenovirus CV706 were found in the urine for up to 29 days (Deweese et al., 2001). To date,
there are no reports of viral transmission to untreated contacts.
16
The host immune response is a major determinant of effective oncolytic virotherapy in patients.
In addition to direct tumor lysis, viral infections in the tumor can cause acute local inflammation
that redirects the host immune response towards long-term anti-tumor immunity. Alternatively,
the host response may prematurely eradicate the virus before a sufficient anti-cancer vaccination
effect can be mounted (Chiocca and Rabkin, 2014). Pre-existing neutralizing antibodies and
premature sequestration of the virus by the liver or spleen are recognized as significant barriers
to oncolytic virus delivery and efficacy (Russell et al., 2012). However, clinical data do not
always support this idea. For example, the presence of pre-existing antibodies against VV did not
affect JX-594 replication, safety, or anti-tumor effect of either IT (Heo et al., 2013) nor IV
treatment (Breitbach et al., 2011a). Immunological evaluation has also been highly suggestive of
treatment-stimulated anti-tumor immunity. Studies report a proportional increase in immune-
reactive lymphocyte subsets (such as cytotoxic CD8+ Tcells and natural killer) cells, neutralizing
antibodies, and/or infiltrating lymphocytes concurrent with tumor response with treatments with
reovirus (White et al., 2008), Newcastle Disease virus (Laurie et al., 2006), VV (Kim et al.,
2013), HSV (Kaufman et al., 2010), and adenovirus (Hemminki et al., 2015).
A few oncolytic viruses have been tested in more advanced phases of clinical trials which have
begun to discern therapeutic efficacy and survival advantage. Frontrunners include H101 (E1B-
deleted replication-selective adenovirus) (Xia et al., 2004), CG0070 (adenovirus armed with
granulocyte-macrophage colony stimulating factor (GM-CSF)) (Burke et al., 2012), T-Vec
(ICP47 and ICP34.5-deleted HSV expressing GM-CSF) (Andtbacka et al., 2015), and JX-594
(TK-deleted VV expressing GM-CSF) (Heo et al., 2013; Breitbach et al., 2011a). Recently,
talimogene laherparepvec (T-Vec) became the first oncolytic virus to be approved by the Food
and Drug Administration (FDA) for cancer treatment. T-Vec is an engineered HSV armed with
the immunomodulatory protein, GM-CSF, which will be used as an IT immunotherapy for
melanoma patients with unresectable lesions (Greig, 2016). In its phase III IT trial with patients
with advanced melanoma, the T-Vec treatment was compared to GM-CSF injections and was
reported to improve the durable response rate (16.3% v.s. 2.1%, p<0.01), overall response rate
17
(26.4% v.s.5.7%), and median overall survival (23.3 months v.s. 18.9 months; hazard ratio 0.79,
p=0.051) (Andtbacka et al., 2015).
1.1.6.1 Vaccinia Virus in Clinical Trials
To date, three oncolytic vaccinia viruses are being tested in clinical trials: JX-594 (a.k.a.
Pexavec, a TK-deleted Wyeth strain VV expressing GM-CSF and β-galactosidase marker gene)
(Heo et al., 2013; Breitbach et al., 2011a), vvDD (TK and VGF-deleted Western Reserve VV)
(Zeh et al., 2015; Downs-Canner et al., 2016) and GL-ONC1 (a.k.a. GLV-h168, a F14.5, TK,
and A56R-deleted Lister strain VV expressing GFP marker gene) (Pol et al., 2015).
Clinical investigations of IT and intravenous JX-594 treatment in solid tumors (e.g. melanoma
(Hwang et al., 2011), hepatocellular carcinoma (HCC) (Heo et al., 2013), colorectal carcinoma
(Park et al., 2015)) have demonstrated safety and promise as an anti-cancer treatment. The most
common adverse event among patients treated with IT and IV JX-594 were grade1/2 flu-like
symptoms with a minority of patients also presenting treatment-related pustule formation which
resolved within 2-3 weeks with no sequelae. Two patients with late-stage hepatocellular
carcinoma who were administered the highest IT dose (3x109 pfu) experienced grade III
hyperbilirubinaemia and so 1x109 pfu was deemed the MTD (Park et al., 2008). A maximum
feasible dose was determined for other injection routes or malignancies as there were no dose-
limiting toxicities in patients treated at the highest doses for multiple IT injections for melanoma
(up to 108 pfu/treatment up to 8 cycles) (Mastrangelo et al., 1999; Hwang et al., 2011), biweekly
IV infusion for colorectal cancer (up to 3x107pfu/kg) (Park et al., 2015), single IV treatment for
HCC (up to 3x107 pfu/kg) (Breitbach et al., 2011a), or single IT injections in children with solid
tumors (up to 107 pfu/kg) (Cripe et al., 2014). Viral genomes in the blood, infectious viral
particles in the tumor, transgene expression of GM-CSF, antibody induction to the β-
galactosidase marker gene, and tumor response were correlated to viral dose.
18
Tumor responses to JX-594 treatment were evaluated as a secondary endpoint to the clinical
trials. In its landmark trial with metastatic HCC patients, the authors report the first randomized
trial with an oncolytic virus treatment associated with a significant prolonged overall survival of
14.1 months compared to 6.7 months for the high dose group (1x109 pfu) and low dose group
(1x108pfu), respectively (Heo et al., 2013). The overall intrahepatic disease control rate at week
8 was 46% as evaluated by the modified Response Evaluation Criteria in Solid Tumors
(mRECIST) (Heo et al., 2013; Lencioni and Llovet, 2010) Induction of anti-cancer immunity
was also demonstrated in this trial when 11 out of 16 patients evaluated had antibody-mediated
complement-dependent cytotoxicity against 4 HCC cell lines (Heo et al., 2013). This is further
supported by the decrease in tumor size in injected tumors, as well as non-injected tumors in
some patients, in IT clinical trials (Mastrangelo et al., 1999; Hwang et al., 2011; Heo et al.,
2013). Concurrent serial dynamic MRI scans and subsequent histological analysis with patient
samples from this and other HCC clinical trials were conducted and affirmed selective tumor
vasculature disruption as another mechanism of action as alluded by pre-clinical studies
(Breitbach et al., 2007; Breitbach et al., 2013). Currently, clinical trials for IV JX-594 treatment
of renal cell carcinoma and colon carcinoma in combination with irinotecan are ongoing
(Breitbach et al., 2015; Pol et al., 2015).
The double-deleted vaccinia virus, vvDD, has recently been evaluated in phase 1 trials for IT
(Zeh et al., 2015) and IV (Downs-Canner et al., 2016) delivery to treatment-refractory solid
tumors (including colon cancer, pancreatic cancer, hepatocellular carcinoma, melanoma, and
breast cancer). For both, a maximum feasible dose was set at 3x109 pfu as there were no dose-
limiting toxicities and exquisite tumor-selectivity was demonstrated. Notably, a 1mm strip of
normal skin between two large melanoma lesions was spared despite IT injection and evidence
of viral replication in both tumor masses (Zeh et al., 2015). Evidence of immune cell activation
and virus infection in tumors was also reported for both treatments. Virus infection and tumor
response was present in injected and non-injected lesions for some patients treated IT (Zeh et al.,
2015). There were no objective clinical responses in the IV trial, however, some patients had
mixed responses where some lesions regressed or were stable before re-growing (Downs-Canner
19
et al., 2016). Nevertheless, clinical investigation of the true efficacy of vvDD as an oncolytic
virus will require larger patient populations.
Several preclinical examinations suggest GL-ONC1 as a promising oncolytic virus to test in
humans, including a study with human HCC cell lines in mice reported tumor response and the
induction of anti-tumor inflammation (Gentschev et al., 2011). A few clinical trials have since
been completed with GL-ONC1, but results have yet to be published such as: Phase 1 trial of
intrapleural GL-ONC1 in patients with malignant pleural effusion, phase I/II trial with IP GL-
ONC1 in patients with advanced peritoneal carinomatosis, and a phase 1 trial of intravenous GL-
ONC1 with head and neck cancer patients concurrent with cisplatin treatment (Pol et al., 2015).
1.2 Host Immune Response Against Viruses
1.2.1 Overview
The host immune response against viral infections is a complex process comprised of the innate
and adaptive immune responses. Interferons (IFNs) are critical for shaping the host response
against invading viruses. When viral components are recognized by the host cell, a cascade of
signaling events result in the production of many inflammatory cytokines, such as tumor necrosis
factor alpha (TNFα) and interleukin 1 (IL-1), chemokines, and type I IFNs, to culminate in pro-
inflammatory and antiviral processes (Kumar et al., 2011). Type I IFNs are important for
regulation of >300 interferon-stimulated genes (ISGs) to create an antiviral environment which
includes: the maturation of dendritic cells for antigen presentation, recruitment of monocytes,
and shaping the appropriate adaptive immune response (Schneider et al., 2014). In terms of the
adaptive immune response, CD8+ T-cells are important for VV clearance (Belyakov et al., 2003),
but the dependency of CD8+ T cells on CD4
+ T-cell help is dictated by infection route (Hu et al.,
2014). Nevertheless, CD4+ T-cells are important for long-term memory against VV (Medeiros-
Silva et al., 2013). Here, the antiviral response against VV is described with a focus on virus
recognition and the type I IFN signaling pathway, especially on the proteins related to this
project: Toll-like receptors (TLR), nuclear factor kappa-light-chain enhancer of activated B cells
(NFκB), and protein kinase R (PKR).
20
1.2.2 Pathogen Recognition
The first step in the host immune response against pathogens is recognition. Currently, 4 main
classes of pathogen recognition receptors (PRRs) were shown to detect VVs: toll-like receptors
(TLRs), retinoic acid inducible gene 1 (RIG-1)-like receptors (RLRs), and nucleotide-binding
oligomerization domain (NOD)-like receptors (NLRs), and cytoplasmic DNA sensors
(Perdiguero and Esteban, 2009; Kumar et al., 2011). TLRs are found either at the cell surface or
endosomal compartments of immune cells and some epithelial cells while RLRs, NLRs, and
DNA sensors are found in the cytoplasm of almost all cells. PRRs recognize pathogen-associated
molecular patterns (PAMPs) that are usually conserved on a pathogen. Signaling cascades via
TLRs, RLRs, and cytosolic DNA sensors result in inflammatory cytokine and type I IFN
expression, while the maturation of IL-1 is dependent on NLR activity against VV (Kumar et al.,
2011). Together, PRR signaling works co-operatively to scale and direct the appropriate
immune response (Tan et al., 2014). It is also important to note that PRRs also recognize danger-
associated molecular patterns (DAMPs) in response to host damage that may arise from viral
replication and lysis (Jounai et al., 2013). Figure 1.3 illustrates the induction pathway used by
PRRs (Perdiguero and Esteban, 2009).
1.2.2.1 Toll-Like Receptors
TLRs are mainly expressed in immunomodulatory cells, such as dendritic cells (DCs),
macrophages, and B cells, though TLRs are also found in some intestinal, respiratory, and
urogenital epithelial cells. To date, 13 TLR receptors have been identified in humans and mice;
10 are found in humans (TLR 1-10) and 12 in mice (TLR 1-9, 11-13). Viral PAMPs are
recognized by TLR2, TLR3, TLR4, and TLR9 in both humans and mice. TLR7 and TLR8
recognize viral single-stranded RNA (ssRNA) in mice and humans, respectively (Kawai and
Akira, 2006; Perdiguero and Esteban, 2009). The TLRs are compartmentalized on the cell
surface or within endosomes, on the basis of where its ligand is expected to appear upon
infection. Hence, TLRs that recognize viral lipoproteins, TLR2 and TLR4, are found on the cell
surface and TLRs that recognize viral nucleic acids, TLR3 (double-stranded RNA, dsRNA),
21
TLR 7/8 (ssRNA), and TLR9 (CpG-containing dsDNA), are compartmentalized in the
endosomes. All TLRs are trans-membrane proteins and have a horseshoe-shaped motif with
leucine-rich repeats for ligand recognition and a cytoplasmic Toll/IL-1 receptor (IL-1R)
homology (TIR) domain for downstream signaling. Upon ligand binding, TLRs dimerize and the
TIR-domains change conformation to recruit TIR-domain-containing adaptor proteins. There are
4 adaptors that promote inflammatory and antiviral responses: myeloid differentiation factor 88
(MyD88), MyD88 adaptor-like protein (MAL; also known as TIR-domain containing adaptor
protein, TIRAP), Toll receptor-associated activator of IFN (TRIF, also known as toll-like
receptor adaptor protein 1, TICAM-1), and TRIF-related adaptor molecule (TRAM)(Xagorari
and Chlichlia, 2008; Koyama et al., 2008). Sterile-α and armadillo motif-containing protein
(SARM) is a TIR-domain-containing adaptor protein that specifically inhibits TRIF-dependent
signaling (Carty et al., 2006). All TLRs are involved in either the MyD88-dependent signaling or
the TRIF-dependent signaling or both. Further, TLR4 is unique as the only TLR that can signal
with all 4 adaptor proteins; After induction of the MyD88-dependent pathway with
MyD88/MAL, TLR4 is endocytosed and interacts with TRIF/TRAM to initiate the TRIF-
dependent pathway (Kagan et al., 2008).
1.2.2.1.1 MyD88-Dependent Pathway
With the exception of TLR3, all TLRs can signal through the MyD88-dependent pathway. Upon
PAMP recognition, TLRs recruit MyD88 and the proteins interact via their TIR domains. While
other TLRs only recruit MyD88 directly upon PAMP recognition, TLR1, TLR2, TLR4, and
TLR6 also recruit MAL (Kumar et al., 2011). Upon MyD88 interaction, death domains of
MyD88 and IL-1 receptor kinase-4 (IRAK4) interact to recruit IRAK1 or IRAK2. Subsequently,
the IRAK complex interacts with the ubiquitin E3 ligase, tumor necrosis factor (TNF) receptor-
associated factor 6 (TRAF6), which activates TGF-β-activated kinase (TAK1). TAK1 can then
activate the members of the mitogen-activated protein kinases (MAPKs) Jnk, p38 and
extracellular signal-related kinases (ERKs) to activate ATF2/cJun. TAK1 can also form a
complex with TAK1-binding proteins TAB1, TAB2, and TAB3 to activate the IκB kinase (IKK)
complex (consisting of IKK-α, IKK-β, and IKK-γ (also known as NFκB essential modulator
22
(NEMO)) to phosphorylate IκB family, marking it for ubiquitination, which ultimately allows
NFκB to translocate into the nucleus. To also translocate into the nucleus, interferon regulatory
factor 5 (IRF5) forms a complex with MyD88 and TRAF6 to translocate to the nucleus while
IRF7 complexes with MyD88, IRAK1, and TRAF6. Together, ATF2/cJun, NFκB, and the IRFs
regulate the transcription of inflammatory cytokines and type I IFNs (Kumar et al., 2011).
1.2.2.1.2 TRIF-Dependent Pathway (MyD88- Independent Pathway)
TLR3 and TLR4 utilize the TRIF-dependent pathway which will ultimately lead to the activation
of pro-inflammatory cytokines and type I IFNs via IRF3, NFκB, and MAP kinases (Koyama et
al., 2008; Perdiguero and Esteban, 2009). While TLR3 interacts only with TRIF at the first step,
TLR4 also recruits TRAM as a bridging adaptor (Fitzgerald et al., 2001). TRIF can complex with
two proteins, the TRAF family member-associated NFκB activator (TANK)-binding kinase 1
(TBK1) and inducible IκB kinase (IKK-i, also known as IKKε), to phosphorylate IRF3 which
will translocate to the nucleus, form a homodimer and initiate IFNβ expression. TRIF can also
activate NFκB by interacting with the receptor interacting protein (RIP) family (RIPI, TRADD,
FADD) with its C-terminus or recruiting TRAF6. These pathways may converge to activate the
highest amount of NFκB. Interaction with TRAF6, as in the MyD88 pathway can also activate
the MAPK pathway (Koyama et al., 2008; Perdiguero and Esteban, 2009).
1.2.2.2 Cytosolic PRRs
In contrast to TLRs which are found mainly in immunomodulatory cells, cytosolic PRRs are
found in almost all cell types. Three groups of cytosolic PRRs recognize viruses: RLRs, NLRs,
and cytoplasmic DNA sensors. RLRs are a class of PRRs made up of 3 RNA helicases that
recognize viral RNA: retinoic-acid inducible gene-1 (RIG-1), melanoma differentiation-
associated gene 5 (MDA5), and laboratory of genetics and physiology-2 (LGP2). RLRs are
found in several types of cells including fibroblasts and conventional DCs (cDCs), but not
plasmacytoid DCs (pDCs). All members have a DexD/H box helicase domain and a C-terminal
23
repressor domain, but only RIG-1 and MDA5 have 2 caspase-recruitment domains (CARD)
while LGP2 has none. RIG-1 recognizes short dsRNA and longer ssRNA with a 5‘-triphosphate
while MDA5 binds to long dsRNA (Wu and Chen, 2014). The role of LGP2 is unclear, but has
been suggested to be a negative regulator of RLR signaling (Rothenfusser et al., 2005). Upon
viral RNA recognition, RLR signaling also initiates the expression of type I IFNs through the
IFNβ promoter stimulator 1 (IPS-1), TRAF3 and IRF3. The activation of NFκB enacted by
RLRs can be induced via the phosphorylation of the IKK complex via either TRAF3 or share
other components of the tumor necrosis factor (TNF) signaling pathway, Fas-associated protein
with a death domain (FADD) and TNFR type I-associated death domain protein (TRADD) (Wu
and Chen, 2014). Different kinds of cytosolic DNA sensors exist depending on cell type, but
these PRRs are also capable of inducing antiviral mechanisms. For example, a protein called
DNA-dependent activator of IFN-regulatory factors (DAI; also known as Z-DNA binding
protein 1 (ZBP1)) has been shown to associate with IRF3 to enable type I IFN expression
(Takaoka et al., 2007). NLRs comprise a family of proteins that recognize a wide range of
PAMPs which ultimately results in the expression of pro-inflammatory cytokines, the formation
of an ―inflammasome‖ that cleaves cytokines such as IL-1β into its mature form via caspase 1, or
the initiation of cell death (Kumar et al., 2011).
1.2.2.3 PRR Recognition of WR VV
The immune response elicited against the parental virus described in this project, WR VV, is not
fully understood, but several groups have reported TLR-dependent and TLR-independent
mechanisms. For example, in response to WR VV, the TLR2/Myd88 pathway was important for
expression of pro-inflammatory cytokines, DC maturation, and CD8 T cell secretion, but the
production of IFN-β was TLR-independent (Zhu et al., 2007). However, not all innate immune
sensing of WR VV has protective effects. TLR4 activation has a protective effect against
pulmonary WR VV infection (Hutchens et al., 2008a), but TLR3 signaling against WR VV
increased virulence and viral replication, partly by inducing an excessive inflammatory response
(Hutchens et al., 2008b). In terms of cytosolic PRRs, WR VV DNA has been shown to induce
the production of IFN-β via the RLR, MDA5, (Delaloye et al., 2009) and activate the NLR AIM2
24
inflammasome cleavage of pro-IL-1β into mature IL-1β (Rathinam et al., 2010). IFN-γ-inducible
protein (IFI16) (Unterholzner et al., 2010) and DAI (Takaoka et al., 2007) are cytosolic DNA
sensors that sense VV DNA.
25
26
Figure 1.3 Interactions between pathogen recognition receptors (PRR) and vaccinia virus (VV) inhibitory
proteins. Toll-like receptors (TLR), RIG-1-like receptors (RLR) and Nod-like receptors (NLRs) sense viral
components and leads to the activation of transcription factors (IRFs, NF-κB, and ATF2/c-Jun) to induce the
expression of type I IFNs and pro-inflammatory cytokines. A46 binds to adaptor molecules MyD88, TRIF, MAL,
and TRAM to inhibit TLR signaling. Downstream IRAK-2 and TRAF6 proteins are inhibited by the VV A52
protein. K7 prevents IRF nuclear translocation. NFκB activation is inhibited by and N1, B14, K1, and M2.
[Reprinted with permission by Mary Ann Liebert Inc. [JOURNAL OF INTERFERON AND CYTOKINE
RESEARCH] (Perdiguero, B. and Estaban, M. The Interferon System and Vaccinia Virus Evasion Mechanisms.
29(9):581-598) Copyright 2009. (Perdiguero and Esteban, 2009)
1.2.3 NFкB
NFκB is a family of transcription factors that are important for regulating the immune response
against es, but it is also a critical regulator of cell cycle and survival in response to a plethora of
stimuli. In mammals, the NFκB family consists of transcriptional activators characterized by a
Rel homology domain (RHD) in its N-terminus: RelA (p65), RelB, c-Rel, NFκB1 (p50), or
NFκB-2 (p52). RelA, RelB, and c-Rel are expressed in their mature form and contain a
transcriptional activator domain at their C-terminus. NFκB-1 and NFκB-2 do not have a
transcriptional activator domain and exist in the cytoplasm as precursor proteins, p105 and p100,
respectively (Gilmore, 2006). The NFκB family forms homodimers and heterodimers via the
RHD to differentially regulate gene expression. The most abundant form is the RelA/p50
heterodimer (Chen et al., 1999). NFκB is usually inactive in the cytoplasm and bound to an IκB
protein (RelA, RelB, c-Rel) or exists in its uncleaved proform (NFκB-1, NFκB-2 ) (Hoesel and
Schmid, 2013).
A variety of stimuli and signal transduction pathways ultimately culminate in NFκB activation.
Inducers range from conditions, such as DNA damage and hypoxia, pro-inflammatory cytokines,
such as IL-1 and TNF-α, or PRR recognition of PAMPs as described above. In the canonical
pathway of NFκB activation, the IKK complex phosphorylates the bound IκB protein (IκBα,
IκBβ, IκBγ or IκBε), marking it for subsequent degradation and releasing the NFκB into the
27
nucleus. In the alternative non-canonical pathway, NFκB is released following proteolytic
cleavage of its precursors into its mature form (NFκB-1, NFκB-2 ) (Hoesel and Schmid, 2013).
Many genes are activated by NFκB, including genes that express proteins that exert antiviral
mechanisms; pro-inflammatory cytokines, chemokines and adherins to facilitate NK cell
recruitment, and proteins related to cell cycle and survival. However, the target genes and the
magnitude at which they are expressed are context-dependent, determined by factors such as cell
type and stimulus. Co-activators, covalent modifications of NFκB, and the structure of the
binding site are also important factors (Smale, 2011; Chen and Greene, 2004; Oeckinghaus et al.,
2011). The expression of some proteins that regulate NFκB activation and repression are also
under the control of a NFκB promoter (Smale, 2011).
With respect to the antiviral mechanisms enacted by NFκB activation, NFκB regulates a
multitude of genes to orchestrate an appropriate immune response. First, it activates the
expression of pro-inflammatory cytokines such as IL-1, IL-6, IL-8, and TNFα (Hoesel and
Schmid, 2013; Santoro et al., 2003), chemokines and adhesion molecules for neutrophil
extravasion, and proteins for antigen presentation such as the major histocompatibility complex
(MHC) (Santoro et al., 2003). Second, enzymes that catalyze the production of molecules that
cause inflammation, such as cyclooxygenase 2 (Cox2) and nitric oxide synthase (iNOS), are also
upregulated by NFκB (Santoro et al., 2003). Third, NFκB is implicated in the survival and
development of innate immune cells, such as DCs. The survival of T- and B-cells during
development was also attributed to anti-apoptotic proteins from NFκB activation (Siebenlist et
al., 2005).
28
1.2.4 Interferons
1.2.4.1 Overview
IFNs are secreted cytokines that initiate and regulate potent antiviral properties (Samuel, 2001;
Teijaro, 2016; Grandvaux et al., 2002), but have also been implicated to have antineoplastic
functions (Fuertes et al., 2013; Zitvogel et al., 2015). There are 3 classes of IFNs, type I-III, that
are differentiated by their signaling receptors. The signaling enacted by the three types of IFNs
culminate in varying types of responses with respect to the regulated gene profile, induction and
scale of antiviral, anti-proliferative, and immunomodulatory processes (Schneider et al., 2014).
Some antiviral effects associated with IFN signaling include increasing the sensitivity of PRRs to
PAMP detection, co-stimulation of CD8+ T-cells resulting in enhanced cytotoxicity and
proliferation, promoting NK cell cytotoxic capacity and DC maturation, and expressing
molecules that inhibit viral entry, replication, translation, and egress (Teijaro, 2016; Schneider et
al., 2014; Crouse et al., 2015). Protein kinase R (PKR) is also one of the proteins involved in
inhibiting viral translation as a result of type I and II IFN signaling (García et al., 2007).
Type I IFNs comprise the largest class of IFNs and signal through a heterodimeric complex of
IFNα receptor 1 (IFNAR1) and IFNAR2, including: IFN-β, IFN-ε, IFN-κ, and 13 subtypes of
IFN-α. PAMP recognition is mostly responsible for the expression of type I IFNs, leading to very
potent antiviral responses. Almost all cells can express IFN-α and IFN-β, but pDCs express the
majority of IFN-α in response to a viral infection (Teijaro, 2016).
IFN-γ is the sole type II IFN. It exists as a homodimer and complexes with two IFN-γ receptor 1
(IFNGR1) subunits and two IFNGR2 subunits to initiate receptor activation. IL-12 and IL-18
induce the expression IFN-γ in immune cells such as CD8+ T-cells, CD4
+ T-cells, NK cells, B-
cells, and professional antigen-presenting cells express IFN-γ, but all cells can respond to IFN-γ.
The antiviral actions of IFN-γ are indirect; its mode of action is primarily regulating immune
cells in both the innate and adaptive immune response. One important function of IFN-γ in
29
response to virus involves skewing the immune response to the cell-mediated (Th1) immune
response (Schroder et al., 2004).
The most recently discovered class, type III IFNs, consists of IFN-λ1, IFN-λ2, and IFN-λ3 (also
known as IL-29, IL-28A, and IL-28B, respectively) and the recently discovered IFN-λ4. These
cytokines signal through a type III IFN-specific receptor, IFN-λ-receptor 1 (IFNLR1), and share
a ubiquitously expressed receptor with cytokines IL-10, IL-22 and IL-26, the IL-10 receptor 2
(IL10-R2) (Wack et al., 2015). Both type I and type III IFNs signal for a strong antiviral
response and activate similar subset of genes targeted against viruses (Schneider et al., 2014),
however all cells respond to type I IFNs while only a subset of cells, such as mucosal epithelial
cells, respond to type III IFNs (Wack et al., 2015).
1.2.4.2 IFN Signaling Pathway
All IFNs signal through the Janus kinase/ signal transducer and activator of transcription
(JAK/STAT) pathway as illustrated in Figure 1.4 (Perdiguero and Esteban, 2009). There are 3
known Janus kinases that are ubiquitously expressed and involved in the IFN signaling pathway:
JAK1, JAK2, and tyrosine kinase 2 (TYK2). In mammals, there are 7 known STAT proteins:
STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6. Inactive forms of JAK
proteins are pre-associated to the cytosolic domain of IFN receptors. When IFNs bind to their
respective receptors, the two IFN receptors are brought close together and the two JAK proteins
are juxtaposed to each other. Additionally, binding with IFN changes the conformation of the
cytosolic domain of the IFN receptors, thereby activating JAK-mediated phosphorylation of the
tyrosine residues on the receptor. The phosphorylation recruits STAT proteins where JAK
proteins also phosphorylate the tyrosine residues on the STAT protein which homodimerize or
heterodimerize to translocate into the nucleus to activate the expression of ISGs. Generally, type
I and III IFNs signal through JAK1 and TYK2 leading to heterodimers of STAT1-STAT2 which
bind to IRF9 to form a complex called IFN-stimulated gene factor 3 (ISGF3). ISGF3 translocates
into the nucleus to bind to IFN-stimulated regulatory elements (ISREs) to activate the expression
30
of type I and III ISGs. On the other hand, type II IFN signals through JAK1 and JAK2 to activate
STAT1 proteins to form a homodimer, called the IFN-γ activation factor (GAF), that translocates
to the nucleus to bind to the gamma-activated sequence (GAS) to initiate the expression of type
II ISGs (Schneider et al., 2014; Perdiguero and Esteban, 2009). Type I IFNs can also activate
homo- and heterodimers of other STAT proteins, as well as a heterodimer between STAT5 and
v-crk sarcoma virus CT10 oncogene homolog (avian)-like (CrKL) (Fish et al., 1999). Further, the
induction profile of ISGs by IFNs are shaped by pathways that either modify the JAK/STAT
pathway or are complementary non JAK/STAT signaling cascades that are simultaneously
induced with IFNs (e.g. PKC (protein kinase C) and MAPK signaling pathways and mTORC1
(mammalian target of rapamycin complex) and mTORC2 pathways) (Fish and Platanias, 2014).
Though type I IFNs signal through the same receptors, different subtypes result in widely
different functional effects. Variations in IFN subtype structure affect receptor-ligand
interactions and conformational changes in the receptor that ultimately determine downstream
signaling cascades (Thomas et al., 2011). Taken together, the induction of physiological effects
by IFN in response to different pathogens is a complex process shaped by simultaneously
activated pathways and differences in IFN subtype binding.
31
32
Figure 1.4. The interferon (IFN) signaling pathway and the vaccinia virus (VV) inhibitors. Antiviral,
antiproliferative and immunoregulatory responses are activated by IFN signaling through the JAK/STAT pathway.
VV encodes B8 and B19 to block IFN binding to the corresponding receptors. K3L and E3L gene products block
PKR activity. VV VH1 phosphatase, a virion component, inhibits STAT1 dephosphorylation. [Reprinted with
permission by Mary Ann Liebert Inc. [JOURNAL OF INTERFERON AND CYTOKINE RESEARCH]
(Perdiguero, B. and Estaban, M. The Interferon System and Vaccinia Virus Evasion Mechanisms. 29(9):581-598)
Copyright 2009. (Perdiguero and Esteban, 2009)
1.2.5 Protein Kinase R (PKR)
PKR is an IFN-induced dsRNA dependent protein kinase involved in many facets of an immune
response. Principally, dsRNA, potentially from the virus replication cycle, activates PKR
leading to autophosphorylation and subsequent phosphorylation of eukaryotic initation factor 2
alpha (eIF2α). The eIF2α phosphorylation interferes with eIF2β exchange of guanine
triphosphate (GTP) to guanine diphosphate (GDP), leading to the inhibition of eIF2 activity and,
ultimately, protein translation. The cessation of protein translation will also shut down viral
protein translation and, therefore, viral propagation. In addition to dsRNA, PKR is regulated by
many activators (PKR-associated factor (PACT), melanoma-differentiation-associated gene 7
(Mda7)) and inhibitors (heat shock protein 70 (Hsp70), trans-activation response RNA binding
protein (TRBP) (García et al., 2007). PKR is also implicated in many inflammation pathways.
First, PKR activates NFκB via the IKK complex (Zamanian-Daryoush et al., 2000), though it
remains controversial whether this activation is mediated by direct contact or kinase activity
(Gil et al., 2001; Bonnet et al., 2000). Most recently PKR may be associated with the NLRP3
inflammasome activation, though its effect is still debated (Yim et al., 2016; He et al., 2013;
Hett et al., 2013; Lu et al., 2012). In addition, PKR can phosphorylate the serine 392 residue of
the tumor suppressor protein, p53 (Cuddihy et al., 1999) and has been suggested to be
important for its tumor-suppressive function (Yoon et al., 2009).
33
1.3 VV Evasion of Innate Immunity
1.3.1 Overview
VV expresses many immunomodulatory proteins to counteract the host immune system to
facilitate successful VV replication (Figure 1.3 and 1.4) (Perdiguero and Esteban, 2009). Several
aspects of the innate antiviral immune response can be inhibited by products of VV
immunomodulatory genes including the complement system, IFN induction, IFN signaling,
NFκB activation, cytokines, chemokines, PKR activation, apoptosis, and NK cell cytotoxicity
(Perdiguero and Esteban, 2009; Smith et al., 2013). Here, we describe the VV genes pertinent
to the project described in this dissertation: TLR inhibitors (A46R, A52R), NFκB inhibitors
(N1L, K1L), and a PKR inhibitor (K3L).
1.3.2 VV TLR Inhibitors
The first step towards an immune response against VV infection is recognition. VV expresses
many early viral genes to counter immediate downstream processes induced by recognition by
PRRs. The VV genes relevant to this project are A46R and A52R which express non-redundant
early VV proteins A46 and A52, respectively, which inhibit a broad range of TLRs.
The full-length A46 is a 240-amino-acid protein that inhibits host TLR and IL-1 signaling
(Bowie et al., 2000; Stack et al., 2005). Specifically, A46 interacts with the TIR-domain
containing proteins such as MAL, TRAM, MyD88, and TRAF, ultimately inhibiting the
activation of NFκB, MAPK, and IRF3 (Bowie et al., 2000). Additionally, A46 does not interact
with SARM, a negative inhibitor of TRIF-dependent TLR signaling (Carty et al., 2006). The
structure of A46 is thought to contain a Bcl-2-like α-helix fold based on bioinformatic
prediction (González and Esteban, 2010) and biophysical examination (Oda et al., 2011;
Fedosyuk et al., 2014). Though Bcl-2 motifs are related to proteins associated in the regulation
of cell death, A46 function is not related to apoptosis (Postigo and Way, 2012). Its structure
34
hides the BH3 groove so that it cannot interact with apoptotic effector proteins (Fedosyuk et al.,
2014). Further, it has also been proposed that A46 may have a binding site for TRAM and a
different binding site for MAL or MyD88 since an 11-amino-acid oligonucleotide derived from
the A46 protein sequence, termed viral inhibitor peptide of TLR-4 (VIPER), could
competitively inhibit A46 interaction with the TIR domain on TRAM but not for MAL or
MyD88 (Lysakova-Devine et al., 2010; Kim et al., 2014). Functionally, the deletion of the
A46R gene from WR VV decreases its virulence after intranasal injection into Balb/c mice
(Stack et al., 2005). When investigated for its role in immunogenicity, the deletion of A46R
from the NYVAC strain of VV increased TNF, IL-6 and IL-8 secretion by human macrophages
in vitro and improved antigen-specific T-cell and B-cell responses in Balb/c mice (Perdiguero et
al., 2013) but its deletion from the MVA strain of VV failed to improve immunogenicity
(Cottingham et al., 2008).
A52 is a 23kDa intracellular protein that also inhibits IL-1 and TLR signaling (Bowie et al.,
2000), but interacts with comparatively more downstream proteins, IRAK2 and TRAF6 (Harte
et al., 2003). A52 also activates the p38 MAP kinase to drive TLR-4 mediated expression of the
immunosuppressive cytokine, IL-10 (Maloney et al., 2005). Recently, A52 was implicated in
influencing the MAPK/AP-1 (c-Jun) pathway as a single protein without infection (Albarnaz et
al., 2016). Structurally, the A52 protein is entirely α-helical with a Bcl-2-like fold. However,
like A46, its structure occludes the BH3 interaction motif so the protein does not interact with
BH3-domain-containing pro-apoptotic proteins, Bid and Bax (Graham et al., 2008; Postigo and
Way, 2012). Similar to A46, when the A52R gene was deleted from WR VV, weight loss and
signs of sickness was significantly reduced following intranasal treatment in Balb/c mice
(Maloney et al., 2005). Though A52 and A46 have very similar structures and overlapping
effects as a result of inhibiting IL-1 and TLR signaling, such as inhibiting MyD88-dependent
NFκB activation, each protein is functionally distinct. A52 is a potent inhibitor of NFκB but not
the TLR3-dependent IRF3. In contrast, A46 is a potent inhibitor of TLR3- and TRIF-dependent
IRF3 activation, but a weak inhibitor of TLR3-mediated NFκB activation (Stack et al., 2005).
35
1.3.3 VV NFкB Inhibitors
NFκB is an important protein in the IFN signaling and induction pathway against viruses
(Perdiguero and Esteban, 2009). As such, VV also counteracts the gene modulation by NFκB
with its own proteins. The VV genes investigated in this study under this category are N1L and
K1L.
The VV N1L gene protein product, N1, exists as a 14kDa intracellular homodimer that inhibits
apoptosis, NFκB and IRF3 activation. The anti-inflammatory effect against NFκB and IRF3
activation was thought to be related to the interaction with the IKK complex and TBK1,
respectively (DiPerna et al., 2004), but whether the N1 protein co-precipitates with the IKK
complex after infection is debated (Chen et al., 2008). The structure of N1 also contains α-
helixes to form Bcl-2-like fold that functionally inhibits pro-apoptotic proteins at its BH3 motif
(Aoyagi et al., 2007). Further, N1 contains separate binding sites for its anti-inflammatory and
anti-apoptotic activity (Maluquer de Motes et al., 2011). The deletion of VV N1L from WR VV
reduced virulence following intranasal and intradermal injection into Balb/c mice (Bartlett et al.,
2002), but virulence is driven by its anti-inflammatory activity more than its anti-apoptotic
properties (Maluquer de Motes et al., 2011). Immunologically, N1 was implicated in reducing
the infiltration of NK cells and increasing the proportion of lymphocytes bearing the early
activation marker, CD69 (Jacobs et al., 2008) .The presence of the N1 was also shown to inhibit
secretion of IFNα, IFNβ, TNFα, and IL-1β in primary human monocytes in vitro (Zhang,
Zhouning et al., 2005).
The K1L gene encodes a protein (K1) that acts as both an NFκB inhibitor and a host range
protein, and its role as both are enacted by the same protein motif (Meng et al., 2009). K1
prevents the degradation of IκBα, which would have allowed NFκB to enter the nucleus and
activate pro-inflammatory and antiviral genes (Shisler and Jin, 2004). Its deletion rendered VV
susceptible to type I interferon signaling (Meng et al., 2009). Further, K1 can inhibit the
36
phosphorylation of PKR in RK13 and HeLa cells (Willis et al., 2009). The structure of K1
consists entirely of ankyrin repeats (7 complete, 2 incomplete) that form a convex shape for
protein: protein interaction (Li et al., 2010). When K1L was deleted from the TianTian strain of
VV, its virulence was significantly reduced compared to VV following intranasal and
intracranial injection (Liu et al., 2013). Host range genes are important for successful viral
replication in different types of cells. Pertaining to VV, either C7L or K1L is usually required
for replication in many human cell lines (Perkus et al., 1990; Gillard et al., 1986). Alternatively
C7L does not affect viral propagation in rabbit kidney RK13 cells, while either K1L or the
cowpox virus gene CP77 are required for successful replication (Ramsey-Ewing and Moss,
1996; Perkus et al., 1990). It is unclear how K1L enables host range, but deletions of different
sets of ankyrin repeats in K1 in a C7L-deleted WR VV mutant were shown to reduce replication
in rabbit RK13 and human HeLa cells (Meng and Xiang, 2006).
1.3.4 VV PKR Inhibitor
One of the proteins activated as a result of IFN signaling is PKR, which is responsible for the
shutdown of protein translation, thereby preventing viral protein production. In this study, the
VV K3L gene which encodes for K3, an inhibitor of PKR, was deleted.
K3 is a 10.5 kDA protein that binds to PKR and prevents eIF2α phosphorylation, thereby
stopping the inhibition of protein translation and potentiating VV propagation (Langland and
Jacobs, 2002). X-ray crystallography reveals two distinct regions that are implicated in PKR
inhibition: a β-barrel with a helix insert region similar to the S1 domain in the K3 protein
structure. Strong sequence homology between the K3 and one third of the eIF2α protein from its
N-terminal, suggests K3 can competitively bind to the eIF2α binding site on PKR. The ability of
K3 to non-competitively inhibit PKR phosphorylation is proposed to be affiliated with the helix
insert region although the mechanism is unknown (Dar and Sicheri, 2002). Deletion of K3L
37
from the Copenhagen strain of VV maintained wildtype replication in HeLa cells but not BHK
cells (Langland and Jacobs, 2002).
1.4 Dysregulation of IFN Induction and Signaling Pathways in Cancer Cells
1.4.1 Overview
Cancer is a result of accumulated mutations that lead to uncontrolled proliferation. Before the
aberrant cells become clinical malignancies, the cancer cells must overcome the host immune
system. Hence, in exchange for immune escape from recognition despite uncontrolled
proliferation, many types of cancer cells have mutations that dysregulate one or many effectors
involved in the IFN induction and signaling pathways (Critchley-Thorne et al., 2009). In a
normal cell, the IFN response and the proteins involved are tightly regulated. Tumors that
escape immune detection often have aberrant expression of function of these key players. Thus,
the VV immunomodulatory genes (described in Section 1.3.) may be redundant for the evasion
of the antiviral immune response. Here, we describe mutations relating to IFN induction and
signaling with a focus on TLRs, NFκB, and PKR.
1.4.2 TLRs in Cancer
TLRs are usually expressed in immune cells and some epithelial cells that line surfaces prone to
pathogen infection. Specifically, alveolar and bronchial epithelial cells, normal keratinocytes
found on skin, and epithelial cells found in the digestive system, and the female reproductive
tract normally express TLRs. Elevated TLR expression is also found or upregulated in a wide
variety of tumors: ovarian (Zhou et al., 2009), colon (Furrie et al., 2005), and melanoma (Goto
et al., 2008). MyD88 mutation in haematological malignancies (Wang et al., 2014) and variants
of TLR in prostate cancer (Sun et al., 2005). In general, the role of TLRs in tumor survival are
thought to be related to downstream effects of enhanced TLR activation leading to pro-tumor
NFκB functions, where activation may be from continuous stimulation of DAMPs associated
38
with dying tumor cells, and TLR-4 mediated IL-10 expression in response to
lipopolysaccharides (Huang et al., 2008; Killeen et al., 2006).
1.4.3 NFкB in Cancer
The tightly-regulated functions of NFκB play important roles in inflammation, immune
response, and cell survival; however, aberrant NFκB expression can drive tumorigenesis, tumor
survival and migration. Persistent activation of NFκB has been observed in a variety of
lymphomas and solid tumors including: B-cell lymphoma (Staudt, 2010), colorectal cancer
(Lind et al., 2001), breast cancer (Sovak et al., 1997), pancreatic cancer (Fujioka et al., 2003),
lung cancer (Chen et al., 2011), and melanoma (Ueda and Richmond, 2006).
Though constant activation by PRRs could cause persistent NFκB activation, the constitutive
induction of NFκB activity could also be caused by direct mutations in the genes encoding
NFκB subunits or the proteins within its signaling pathway, though this phenomenon is more
prevalent in lymphomas. For example, chromosomal rearrangements and deletions have been
observed in the NFκB-2 gene in several lymphomas, including B-cell lymphoma and multiple
myeloma, result in a truncation of the C-terminal ankyrin repeats essential for repressing NFκB-
2 nuclear translocation. The protein processing of the truncated p100 is also associated with a
gain of transcriptional function in distinct target genes (Qing et al., 2007). Though rare, direct
gene mutations of proteins involved in NFκB signaling in solid tumors have also been reported.
For example, mutations in genes encoding NFκB-2, IκBα, IκBε, and IKK-β have been found in
breast cancer (Jiao et al., 2012). Constitutive expression of NFκB can also be induced by
persistent interaction of NFκB activators and oncoproteins as illustrated by the indirect
activation of IKK/ NFκB by the mutated Ras protein through AKT and Raf proteins (Basseres et
al., 2010).
The persistent activation of NFκB has been suggested to have many tumor-promoting roles.
First, NFκB can activate the expression of cytokines (IL-1, IL-6, IL-8, TNF-α), enzymes that
39
catalyze inflammatory products (COX2, iNOS), and chemokines and adherins to attract
neutrophils that secrete reactive oxygen species. Together, a constitutive inflammatory state is
induced which may lead to DNA damage and oncogenic mutations (Hoesel and Schmid, 2013;
Ben-Neriah and Karin, 2011; Kim et al., 2006a). Though NFκB activation may be pro-apoptotic
or anti-apoptotic depending on context (Radhakrishnan and Kamalakaran, 2006), it is also
implicated in prolonging tumor survival by its anti-apoptotic and cell proliferation properties.
Expression of growth factors (Cyclin D1, c-myc, KU70, KU80) and promotion of angiogenesis
(vascular endothelial growth factor (VEGF)) is also related to NFκB activation (Guttridge et al.,
1999; La Rosa et al., 1994)(Hoesel and Schmid, 2013). Further, NFκB can activate the
expression of matrix metalloproteinases (MMPs), thus it is implicated in contributing to
epithelial-mesenchymal transition (EMT) and metastasis (Huber et al., 2004). Last, NFκB in
epithelial cancer cells was postulated to be involved in a crosstalk with tumor-associated
macrophages resulting in the maintenance of anti-inflammatory M2-phenotype after prolonged
tumor growth instead of the inflammatory, anti-tumor M1-phenotype, thereby facilitating tumor
survival and immune escape (Hagemann et al., 2008; Hoesel and Schmid, 2013).
1.4.4 PKR in Cancer
IFN-induced PKR activity is also complex in normal cells; hence its role in cancer remains at
least equally complex. PKR expression in head and neck cancer and some melanoma, colon and
lung cancers was down-regulated and induction of PKR expression improved prognosis
(Marchal et al., 2014). Functional PKR was also an important target for treatment of colon and
breast cancer cell lines with 5-FU to cause tumor cell apoptosis (García et al., 2011). However,
its overexpression in thyroid carcinoma, broncheoalveolar carcinoma, breast cancer, liver
cancer, and some melanoma, colon, and lung cancers suggested PKR did not always have an
anti-tumor role (Marchal et al., 2014). It was postulated that the elevated PKR may be to initiate
NFκB pro-tumor activation as described above (Delgado André and De Lucca, 2007).
40
1.5 Peritoneal Carcinomatosis (PC)
1.5.1 Overview
Peritoneal carcinomatosis (PC) is classified as a type of late-stage peritoneal surface malignancy
wherein cancer cells deposit in the visceral or parietal peritoneal surfaces and constitutes a
tumor burden in the peritoneal cavity. Primary peritoneal surface malignancy is the de novo
occurrence of the metastatic disease and includes peritoneal mesothelioma and primary PC.
Though rare, primary PC can arise from de novo formation and is considered a variant of
ovarian cancer, accounting for 7-14% of ovarian malignancies. More often, secondary PC arises
from primary tumors, colon, ovarian, gastric, and appendiceal origin being most common
(Nissan et al., 2009). For this study, the oncolytic VV candidates generated in this project were
tested in animal models of PC originating from colon and ovarian cancer cell lines.
1.5.2 PC Tumor Origin and Incidence
Secondary PC can arise from a variety of primary tumors. In clinical studies of non-
gynecological PC, 54.6% of PC patients had synchronous PC wherein the most common
symptoms were ascites (34.9%) and bowel obstruction (24.3%) (Chu et al., 1989; Sadeghi et al.,
2000). In a more recent study with 370 patients, EVOCAPE, the distribution of PC tumor
origins were as follows: 33.8% gastric, 31.9% CRC, 15.7% pancreatic, 1.1 % small bowel, 0.8%
liver, 3.2% appendiceal, 1.9% mesothelioma, and 11.6 % of unknown origin (Sadeghi et al.,
2000).
The incidence of PC is usually described in relation to its primary tumor. Approximately 10% of
all CRC cases develop PC during the course of the disease (Kerscher et al., 2013). On the other
hand, PC is found in 5-30% of patients during surgery for gastric cancer (Gill et al., 2011). In
Canada, 65.8% of ovarian cancer patients have late stage spread at the time of diagnosis
(Maringe et al., 2012).
41
1.5.3 Colorectal Cancer (CRC)
Colorectal cancer (CRC) is the third most lethal cancer in Canada. An estimated 9300
Canadians died of colon cancer in 2015. Despite recent advances in early detection, there was
only a modest decrease in mortality (Canadian Cancer Society, 2015). There are many risk
factors associated with sporadic CRC. Many lifestyle choices affect the risk of CRC including
diet and exercise. The incidence of CRC is also higher in migrants and inhabitants of the urban
areas of developed countries with Western culture. Further, non-modifiable risk factors of CRC
include age, family history of CRC, and a history of inflammatory bowel disease (Haggar and
Boushey, 2009).
1.5.4 Ovarian Cancer
Ovarian cancer is the leading cause of death among gynecological malignancies. An estimated
1750 Canadian women died of ovarian cancer in 2015 (Canadian Cancer Society, 2015). Early
detection is difficult as there are no specific symptoms attributed to the early stages of disease
(McLemore et al., 2009). Additionally, Canadian women with late stage (stage IV) epithelial
ovarian cancer have a 5-year relative survival of 18% (Canadian Cancer Society, 2015) . The
etiology of ovarian cancer is not clearly defined, but a number of causes have been proposed.
Risk factors for ovarian cancer include age, family history, chronic inflammation, diet, infertility
drug use, obesity, smoking and asbestos exposure (McLemore et al., 2009).
Most ovarian cancers are of epithelial origin, where rarer types develop into sex-cord stromal,
germ cell-, or mixed cell- type tumors (Kalir et al., 2013). Epithelial ovarian carcinomas can be
broadly categorized into two categories: type I and type II. Type I ovarian carcinomas are
usually low grade tumors. Type II ovarian carcinomas are more frequent and are aggressive,
malignant, high-grade serous tumors that are often found in late stage ovarian carcinoma
(Nezhat et al., 2015)
42
1.5.5 Pathophysiology and Biology of PC
The development of PC can be described by 3 mechanisms: dissemination from the primary
tumor, de novo formation of tumor in the peritoneum, or polyclonal multifocal origin
(Kusamura et al., 2010). Peritoneal seeding is the most common pathway of PC of ovarian
(Masoumi Moghaddam et al., 2012) and gastrointestinal origin (Terzi et al., 2014).
Dissemination can occur via 2 routes: the transmesothelial or translymphatic route (Kusamura et
al., 2010). In the transmesothelial route, the dissemination of PC from primary tumor that has
invaded the serosa can be from the natural sloughing or spontaneous release of viable tumor
cells within the peritoneum. The spontaneous dissemination could be aided by the down-
regulation of adhesion molecules such as E-cadherin. The down-regulation of E-cadherin has
been reported in PC of colon, gastric, and ovarian origin. Alternatively, viable tumor cells may
be accidentally released during surgery from tumor perforation or spillage of resected
lymphatics and blood vessels (Kusamura et al., 2010). Free cancer cells spread through the
lymphatic stomata found in ―milky spots‖ where peritoneal macrophages traverse into the
peritoneal cavity. ―Milky spots‖ are small structures devoid of a capsule, supported by the blood
and lymphatic system, are in contact with the peritoneal membrane, and contain macrophages
and lymphocytes (Sacchi et al., 2007). Cancer dissemination usually occurs in the
abdominopelvic regions where milky spots are found such as the Douglas pouch, greater
omentum, inferior diaphragm, and pelvis (Carmignani et al., 2003).
Adhesion to the mesothelium is facilitated by the elevated expression of adhesion molecules
such as CD44, lymphocyte homing molecules, and members of the integrin superfamily (Jayne,
2003). Subsequent invasion into the mesothelial layer is mediated by cytokine production
leading to the contraction of mesothelial cells and exposure of the submesothelial membrane
(Kusamura et al., 2010). Invasion into the submesothelial membrane is then facilitated by matrix
mellaproteinases to degrade the peritoneal blood barrier (Jayne, 2003). Proliferation of the
newly-attached tumor cells is triggered by paracrine and autocrine loops of growth factors, such
as epidermal growth factor (EGF), and the production of new vasculature via vascular
endothelial growth factor (VEGF) (Masoumi Moghaddam et al., 2012).
43
Primary PC is a more rare form of PC where examples include diffuse malignant mesothelioma.
The mechanism of spontaneous formation of PC is unclear and may be caused by DNA damage
from a variety of effects from environmental stresses, as in the case of asbestos-associated
diffuse malignant mesothelioma (Musti et al., 2006; Toyokuni, 2009; Shukla et al., 2003). In the
last form of PC wherein tumors originate from different multiple gene mutations, as in PC with
ovarian tumors with low malignant potential, the mosaic of mutational differences is possibly
attributed to the spectrum of X-chromosome inactivation patterns between cells (Gu et al.,
2001).
1.5.6 Treatment of CRC PC and Ovarian PC
Until a few decades ago, PC was viewed as a terminal disease and was treated with palliative
surgery. In 1995, Sugarbaker treated PC as a loco-regional disease and proposed peritonectomy,
or cytoreductive surgery (CRS), as a possible treatment. This novel and aggressive surgical
technique involved peritoneum stripping, omentectomy, and resection of all visible tumor even
if it entailed partial or complete organ resection (Sugarbaker, 1995). After surgical resection, the
extent of tumor resection is recorded with the completeness of cytoreduction (CCR) score
(Jacquet and Sugarbaker, 1996). The completeness of resection is an important factor in
treatment outcomes (Verwaal, 2003).
After CRS, chemotherapy drugs heated to 41-43°C could be delivered intraperitoneally
immediately following resection in the operating room (hyperthermic intraperitoneal
chemotherapy (HIPEC)). The heat can increase the cell membrane permeability and drug uptake
in malignant cells (Sticca and Dach, 2003). The chemotherapy agents for intraperitoneal
delivery vary between institutions, but mitomycin C and oxaliplatin is most commonly used for
CRC PC. Different combinations of paclitaxel, cisplatin, doxorubicin, and cyclophosphamide
have been used for intraperitoneal delivery to ovarian PC (Rubino et al., 2012). With
44
intraperitoneal delivery, chemotherapy can be administered at higher doses compared to
systemic therapy (Katz and Barone, 2003). The chemotherapy can also be delivered 1-5 days
post-operatively (early post-operative intraperitoneal chemotherapy (EPIC)) (Rubino et al.,
2012).
The prognosis of patients with CRC PC was grim until recently; a retrospective analysis
determined that the median survival of patients in this category treated with palliative surgery is
7 months (Jayne et al., 2002). Today, the standard treatment of advanced CRC is CRS with
systemic chemotherapy. Modern modalities of chemotherapy include combinations with the
older agents, 5-fluoracil (5-FU) and leucovorin, and the newer chemotherapy agents irinotecan
and oxaliplatin (Nissan et al., 2009). Additionally, CRS with HIPEC and systemic
chemotherapy have been promising in clinical trials compared to CRC PC with the best
supportive chemotherapy (Klaver et al., 2012). In the only randomized phase III trial, patients
treated with the standard care had a median survival of 12.3 months compared to 22.3 months
for patients in the CRS with HIPEC arm (Verwaal, 2003). In the 8-year follow-up report of this
trial, the median disease-specific survival was 12.6 months compared to 22.2 months in the
HIPEC arm. Further stratifications of the HIPEC arm revealed that the 5-year survival was 45%
among patients with no macroscopic disease after CRS (Verwaal et al., 2008). However, it
should be noted that the post-operative mortality in this arm was also 8% and treatment-related
grade 4 morbidity was 45%. (Verwaal, 2003).
Front-line treatment of advanced ovarian cancer, or ovarian PC, is CRS with systemic platinum
(e.g. carboplatin, cisplatin) and taxane combination (e.g. paclitaxel, cycophosphamide) of
chemotherapy. The cancer is generally responsive to this front-line treatment, but 20%-30% of
ovarian cancers are platinum-resistant. Despite treatment of advanced ovarian cancer with CRS
and systemic chemotherapy, the incidence of recurrence still occurs in 60-70% of ovarian cancer
patients (Helm, 2009). Hence, CRS with intraperitoneal chemotherapy is an attractive treatment
for ovarian PC to eradicate microscopic tumor nodules. Three randomized phase III clinical
trials demonstrated superior survival compared to front-line treatment in stage 3 ovarian PC
45
(Alberts et al., 1996; Markman et al., 2001; Armstrong et al., 2006). In the most recent trial, 429
patients were stratified between CRS with systemic chemotherapy or CRS with post-operative
intraperitoneal chemotherapy and systemic chemotherapy. The overall survival was improved
from 49.7 months to 65.6 months. However, there were more severe adverse events in the
experimental treatment group including myelosuppression, neurotoxicity and vomiting
(Armstrong et al., 2006). A number of observational studies have also been published about the
treatment of advanced stage or recurrent ovarian PC with CRS with HIPEC. In general, the
survival benefits associated with the combined CRS and HIPEC treatment were improved or
similar to standard CRS with systemic chemotherapy. Larger randomized trials are ongoing or
proposed to elucidate its true efficacy in ovarian PC (Coccolini et al., 2013).
The treatment-related morbidity and mortality has been a concern for CRS with HIPEC
treatment. To address this, a multi-institutional retrospective review was conducted for this
treatment of non-gynecological PC involving 1290 patients. The overall median survival was 34
months and the 5-year survival was 37%. The mortality and morbidity rates were 4.1% and
33.6%, respectively, and the authors conclude that these rates are similar to major surgical
treatments such as esogophagectomy and pancreaticoduodectomy (Glehen et al., 2010)
1.5.7 Clinical Need
Late stage metastatic disease, such as PC, remains very difficult to treat. Though CRS coupled
with HIPEC or EPIC is a possible treatment for PC patients, the procedure entails significant
post-operative mortality and morbidity rates (Glehen et al., 2010). Additionally, criteria such as
the completeness of resection are important prognostic factors for PC (Verwaal, 2003; Helm,
2009), hence the patient must meet certain eligibility criteria to undergo this aggressive
treatment. The current health of the patient, the tumor burden, tumor grade, and tumor location
are all factors to be considered, though criteria differ between institutions. Only a small
proportion of patients are eligible for CRS with HIPEC treatment. A retrospective study
46
estimates that only 20% of the CRC PC patients would have been eligible (Jayne et al., 2002).
Thus, there is a need for a safe and targeted novel anti-cancer therapy that is effective at every
stage of dissemination. Oncolytic virotherapy (discussed in Section 1.1) may be able to meet
this need.
47
1.6 Aims and Hypothesis
1.6.1 Rationale
Late stage cancers, such as CRC PC and ovarian PC, are often difficult to treat. Though CRS
with HIPEC treatment is promising, the tumor burden is often too high in many PC patients to
derive benefit from this treatment. OVs, such as vvDD, have demonstrated safety and tumor-
selectivity in both pre-clinical and clinical investigations, but increasing OV potency can
improve therapeutic efficacy. Most OVs in the clinic are tumor-selective based on cell
proliferation rates, which may not replicate in and kill slow-growing cancer cells efficiently.
Engineering strategies should exploit a different mechanism of tumor-selectivity.
Many proteins associated with the antiviral IFN response are often dysregulated in
malignancies; therefore VV immunomodulatory genes are redundant for successful replication
in tumors. The VV immunomodulatory genes described in this project (N1L, K1L, K3L, A46R,
and A52R) inhibit major proteins in the IFN induction and signaling pathways that are also
found to be dysregulated in many cancers. Further, these VV genes have previously been shown
to be virulence factors. Therefore, we propose to generate a panel of oncolytic VVs with greater
tumor potency and similar tumor-selectivity compared to vvDD, by deleting one of the
aforementioned genes from WR VV.
1.6.2 Hypothesis
The deletion of VV immunomodulatory genes (N1L, K1L, K3L, A46R, or A52R) will yield an
oncolytic VV with improved potency towards colon and ovarian cancer while maintaining equal
or better attenuation in normal tissue compared to vvDD.
48
1.6.3 Specific Aims
Aim 1: Generate VV deletion mutants via homologous recombination
Aim 2: Compare the candidate VV deletion mutants to vvDD in terms of in vitro viral
replication, cytotoxicity, and viral spread in colon and ovarian carcinoma cell lines
Aim 3: Compare the candidate VV deletion mutants to vvDD in terms of in vivo tumor-
selectivty, toxicity, and efficacy in mouse models of PC.
49
Chapter 2
2 Materials and Methods
2.1 Cell Lines
Human colorectal adenocarcinoma cell line DLD-1, human ovarian cancer cell line A2780, and
normal monkey kidney fibroblast cell line CV-1 were obtained from the American Type Culture
Collection (ATCC; Manassas, Virginia, USA). MC38 murine colorectal adenocarcinoma cell
line cells and C57BL/6 murine sarcoma cell line 24JK were obtained from the National Institute
of Health (NIH; Bethseda, Maryland, USA). Cells were cultured at 37°C and 5% CO2 in media
supplemented with 10% fetal bovine serum (FBS; PAA Laboratories, Etobicoke, ON, Canada)
and 1% penicillin-streptomycin (Invitrogen, GIBCO, Grand Island, New York, USA). All cell
lines were maintained in Dulbecco‘s Modified Eagle Medium (DMEM; Sigma-Aldrich,
St.Louis, Montana, USA) except A2780 cells which were maintained in Roswell Park Memorial
Institute medium (RPMI 1640; in-house Toronto Medical Discovery Tower media, University
Health Network, Toronto, ON, Canada).
2.2. Vaccinia Viruses
Western Reserve (WR) vaccinia virus F13L+ (wildtype virus with lacZ insertions (Roper and
Moss, 1999)) was used as the backbone virus in the creation of our candidate viruses. All
candidate viruses were compared to the previously described virus, vvDD (McCart et al., 2001),
a WR vaccinia virus with a deletion in its thymidine kinase (TK) and vaccinia growth factor
(VGF) genes. Specifically, vvDD-R2R-Luc is used. The viral TK gene is interrupted with a
sequence for red fluorescent protein (RFP) insertion conjoined with Renilla luciferase via a foot-
and-mouth disease virus 2A motif to allow for bicistronic marker expression and the VGF genes
found within the VV inverted terminal repeats are interrupted by a lacZ gene at both ends of the
virus genome (Lun et al., 2009).
50
2.3. Creation of the Candidate Vaccinia Virus Deletion Mutants
Wildtype WR vaccinia virus, F13L+, was used as a backbone virus for the creation of the
vaccinia virus deletion mutants via homologous recombination by using a vaccinia virus shuttle
plasmid. The final candidate viruses were wildtype WR vaccinia viruses with a deletion in one
of the following genes: N1L, K1L, K3L, A46R, or A52R. The shuttle plasmid, pVX-R2R-Luc,
has a RFP gene fused to Renilla luciferase via a foot-and-mouth disease virus 2A motif to
facilitate bicistronic marker expression under the control of a synthetic late promoter pSyn/late
and a xanthine-guanine phosphoribosyltransferase (xgprt) gene under regulation of the early/late
p7.5 promoter. Five hundred base pair gene segments flanking the right and left regions of the
wildtype candidate genes for deletion were generated by polymerase chain reaction (PCR) with
the VJS6 virus DNA (VGF- WR vaccinia virus with lacZ gene insertions). The left flanking
gene segments were digested with MfeI and SpeI and ligated between the MfeI and NheI (which
has compatible ends with an SpeI digestion) on the plasmid. The right flanking gene segments
were digested and ligated between the BssHII and PvuII sites on the plasmid. The final shuttle
plasmids had the RFP/Renilla luciferase fusion and xgprt genes and the promoters mentioned
above flanked with wildtype gene segments from the candidate genes to allow for homologous
recombination. Monolayers of CV-1 cells at 80-90% confluence in a 6-well plate were infected
with 1.25x104 F13L+ (Western Reserve strain vaccinia virus with a lacZ insertion) in 500µl of
low-serum media (2.5% FBS) at 37°C for 2 hours with intermittent shaking every 15 minutes.
The supernatant was removed and a liposomal transfection (Lipofectamine 2000; Invitrogen,
GIBCO) was conducted with OptiMEM media (Invitrogen, GIBCO) containing 2.5 µg shuttle
plasmid DNA and 10 µl liposomes/well at 37°C for 4 hours. The transfection media was
removed and replaced with drugged media (10% FBS) (10 mg/ml xanthine, 149.25 mg/ml
hypoxanthine, 2.5 mg/ml mycophenolic acid; Sigma Aldrich) for selection. After 3 days of
incubation at 37°C, cells were collected in drugged low-serum media (2.5% FBS), subjected to
3 freeze-thaw cycles, sonicated, and serially diluted (1/4, 1/5, and 1/10). Each dilution was re-
infected in duplicate in 500 µl drugged low serum media (2.5% FBS) at 37°C into a monolayer
of confluent CV-1 cells that were incubated with drugged media (10% FBS) in a 6-well plate for
at least 24 hours. After 2 hours, the supernatant was replaced with 2ml agarose/drugged media
51
(10% FBS) overlay and incubated at 37°C. Three days later, the monolayers were observed for
RFP expression and viral plaque formation. Six RFP-positive plaques were isolated and
resuspended in drugged low-serum media (2.5% FBS) for re-infection into another monolayer
of drugged CV-1 cells. After 5-6 rounds of selection, all plaques were positive for RFP for all
candidate viruses.
Table 2.1. Primers for producing inserts for the shuttle plasmid
Virus Left Flanking Insert Right Flanking Insert
N1L Fwd gatccaattg cctaactctt tcgaatactt gatcgcgcgcgtacatacatcgccgtcatc
Rev gatcgctagc ggaagagtca ttcaccatac gatccagctgttatggaggatatgtgaacgc
K1L Fwd gatccaattgtgacgtacatgagtctgagt gatcgcgcgctttgcatgttaccactatca
Rev gatcgctagccgtggatatgatgattctct gatccagctgcagacatggatctgtcacga
K3L Fwd gatccaattgtaccggatctacgttctact gatcgcgcgcataatccttctcgtatac
Rev gatcgctagcggatatatagatgtcaatta gatccagctgtgctgatcctcccattccgt
A46R Fwd gatccaattgcacgataatatcagaggagt gatcgcgcgctgacttacttgtataataag
Rev gatcgctagccttcattacgtatgactaat gatccagctgcagaacatgtagacgaatca
A52R Fwd gatccaattgcgggagacgaggatatagct gatccccgggacgcgtgacaatgatgcggaagaaca
Rev gatccccgggaggcctatagacctctgtacataaaa gatcgacttgagcgtcatctggtagatagaccatcg
Abbreviations: Fwd, forward; Rev, reverse.
2.4. Viral DNA Extraction and PCR
Confluent CV-1 monolayers were infected with half of the suspension of each isolated plaque
from the 5th
or 6th
round of selection (described in Section 2.3) or a small amount from the CV-1
propagation during virus production until complete cytopathic effect was seen. Cells were
washed and collected in 1 ml homemade PCR buffer (50 mM KCl (Sigma Aldrich), 10 mM Tris
52
HCl, pH 8 (Fisher Scientific, Fair Lawn, New Jersey, USA), 2.5 MgCl2, 0.1 mg/ml gelatin,
0.45% Tween 80, and 0.45% NP40 (BioShop, Burlington, Ontario, Canada)). Viral DNA was
released from cells by Proteinase K treatment (ThermoScientific, Lithuana) at 55°C for an hour,
then at 95°C for 10 minutes to deactivate the enzyme prior to PCR. A standard PCR with the
crude viral DNA extract was conducted with the primers originally used to produce inserts for
the shuttle plasmid. Specifically, the forward primer from the left flanking insert and the reverse
primer from the right flanking insert were used (Table 1). PCR validation was conducted after
the 5th
-6th
cycle of selection, after propagation in CV-1 cells during virus stock production and
at the end of the virus stock production (See Section 2.5).
2.5. Virus Stock Production
Half of the suspension of the RFP-positive plaque from the 5th
-6th
cycle of virus selection
(described in Section 2.3) was reinfected into a monolayer of CV-1 cells grown in a 6-well
plate. When complete cytopathic effect was seen, the cells were harvested with a CellScraper
(Sarstedt, Sarstedt AG & Co, Germany) and re-infected into confluent CV-1 monolayers in two
175 cm2 flasks for 2 days and collected. After PCR re-validation with a small amount of cell
suspension (see above), the candidate virus was propagated by reinfecting into thirty 144 cm2
plates of confluent 24JK cells. After 3 days, infected 24JK cells were harvested and centrifuged
at 1500 rpm (342 g) for 10 minutes (SLA-1500 rotor, Sorvall; ThermoScientific). The cell pellet
was resuspended in 20 ml Tris-Cl (pH 9.0), subjected to 3 freeze/thaw cycles and mechanically
homogenized with a sterile Dounce Grinder (Sigma-Aldrich). Ultracentrifugation of the cell
lysate was performed at 25,000 rpm (113,000 g) for 80 minutes (XL-70 Ultracentrifuge, SW 28
rotor; Beckman Coulter, Brea, California, USA) at 4°C over a 36% sucrose cushion. Finally, the
virus pellet was resuspended in Tris-Cl (pH 9.0), aliquoted, and stored at -80 °C.
53
2.6. Virus Plaque Assay
CV-1 cells were seeded in 6-well plates with 3x105 cells/well and incubated at 37°C for 2 days.
Infected samples were subjected 3 freeze/thaw cycles and sonicated to release the virus from the
cells. Viral lysates were serially diluted in low serum media (2.5% FBS) and used to infect the
CV-1 monolayers with 400µl per well at 37°C with intermittent shaking every 10 minutes. Two
hours later, 1.5 ml of media (10% FBS) was added and incubated at 37°C. Two days later, the
cell monolayers were stained with crystal violet and plaques were counted.
2.7. Viral Replication
Tumor cells (DLD-1, A2780) were seeded in 6-well plates until confluent, at which point the
number of cells were determined. MC38 cells were seeded in 6-well plates with 5x105 cells/well
and incubated overnight to achieve 80-90% confluency. Cells were infected at an MOI of 0.1 of
either vvDD or one of the candidate viruses in 0.5ml low serum media (2.5% FBS) at 37°C for 2
hours with intermittent shaking every 10-15 minutes. Cells were supplemented with media (10%
FBS) and incubated at 37°C. Cells and supernatants were harvested in triplicates at each time
point (2, 24, 48, and 72 hours post-infection (hpi) using a Cell Scraper (Sarstedt, Sarstedt AG &
Co, Germany) and stored at -80°C until use. Virus was quantified by viral plaque assays on CV-
1 cells where CV-1 cells were seeded at 3x105
cells/ well in 6 well plates and incubated for 2
days at 37°C until confluency. The virus treated samples were subjected to 3 freeze/thaw cycles
and sonicated on ice before serial dilution in DMEM-2.5% FBS. Subsequently, 0.4ml of the
dilutions were added into a confluent well of CV-1 cells and incubated at 37°C for 2 hours with
intermittent shaking and then supplemented with DMEM-10% FBS and incubated at 37°C. Two
days later, the monolayers were stained with crystal violet and plaques were counted.
54
2.8. Viral Cytotoxicity
MC38 cells were seeded in a 96-well plate with 5x103 cells/well and incubated overnight at
37°C before infection. A2780 and DLD-1 cells were seeded in 96-well plates with 1x104
cells/well and incubated overnight at 37°C before infection. Cells were infected at an MOI of
0.1, 1, or 5 in triplicate with either vvDD or one of the candidate viruses in 25µl of media (2.5%
FBS) for 2 hours at 37°C, then supplemented with 75µl media (10% FBS). Cytotoxicity was
evaluated at 2, 24, 48, and 72 hpi with 3-(4,5-dimethyl-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-
sulfophenyl)-2H-tetrazolium (MTS) cell viability assay (CellTiter96® Aqueous One Solution,
Promega, Madison, Wisconsin, USA) according to the manufacturer‘s protocol. The background
absorbance from medium blanks was subtracted from absorbance values of wells with infected
and mock-infected cells. Relative cell viability was then calculated by dividing the absorbance
of infected wells with the absorbance of the mock-infected wells.
2.9. Measuring Viral Spread by Red fluorescent protein (RFP) Expression
Experiments were conducted as described in the viral replication protocol. Before harvesting the
cell monolayers, fluorescence microscopy was conducted to acquire brightfield and RFP images
(acquired under the Cy3 lens) at 10x magnification using the Zeiss AxioObserver microscope
(Carl Zeiss, Oberkochen, Germany) equipped with a Series 120Q Fluorescence Illumination unit
(EXFO, Quebec City, Quebec, Canada). Images were taken with a Zyla 5.5 sCMOS camera
(Andor Technologies, Belfast, United Kingdom). Percent area infected was measured with the
Fiji ImageJ software with a uniform threshold based on RFP presence within the image.
2.10. Tumor Spheroid Generation, Infection, and Analysis
Spheroids were cultured using tumor cell lines MC38 and DLD-1. Cells were dissociated with
Accutase and seeded at 1,000 cells/well in 96-well round-bottomed plates coated with 1%
polyHEMA (Sigma Aldrich). Plates were subsequently spun at 1,500 rpm for 10 minutes and
55
incubated at 37°C for 72 hours prior to infection. vvDD, one of the candidate VVs (MOI=2) or
media alone DMEM-2.5% FBS was used to infect the spheroids in triplicate for 2 hours at 37°C
and supplemented with media DMEM-10% FBS. Infection was confirmed by RFP expression
visualized with a LSM 700 Confocal Microscope (Carl Zeiss). Tumor spheroid size was
measured with the Fiji ImageJ software. Briefly, brightfield images of the spheroids were
converted to 8-bit greyscale images where spheroids were converted into a binary mask and the
major and minor axis of a fit elliptical were measured. Tumor volume was calculated based on
the following equation assuming spheroid shape: V= 4/3*π ([major axis]/2)([minor axis]/2)2.
Clonogenic assays were also conducted 96 hpi. Approximately 30-50 spheroids were collected,
centrifuged, and disaggregated with trypsin. Live cells were plated in 6-well plates at 25-100
cells/well in duplicate and incubated for 10 days before crystal violet staining. Surviving
fraction was calculated by the number of colonies (>50 cells) divided by the number of cells
originally seeded.
2.11. Mice
Female C57BL/6 mice and NU/NU athymic nude mice (Jackson Laboratory, Bar Harbor,
Maine, USA) were used as syngeneic and xenograft models, respectively. All mice were housed
under standard conditions and given food and water ad lib. Experimental protocols were
approved by the Animal Care Centre, University Health Network, Toronto. Mice were
euthanized by CO2 asphyxiation when signs of morbidity were present including: viral toxicity,
a subcutaneous tumor at the injection site >1.5 cm, difficulty breathing, moribund, cachectic or
inability to obtain food or water.
2.12. In vivo Toxicity Studies
Female C57BL/6 mice or NU/NU athmymic nude mice (n=3) were injected with the indicated
doses of virus in HBSS+0.1%BSA or HBSS+0.1% BSA alone and observed for survival. Body
weight was measured every 2-3 days.
56
2.13. Syngeneic Model
Female C57BL/6 mice were injected intraperitoneally (IP) with 105 MC38 cells in serum-free
media. Twelve days post-tumor injection, mice were injected with the indicated doses of virus in
1 ml Hanks- Buffered Saline Solution (HBSS; Invitrogen, GIBCO) + 0.1% bovine serum
albumin (BSA) or HBSS+0.1% BSA alone. Mice were followed for survival (n=8) or sacrificed
6 days post-infection for biodistribution studies (n=3).
2.14. Xenograft Model
Female NU/NU athymic nude mice were injected IP with either 5x106 DLD-1 cells or 10
7
A2780 cells in serum-free media. Twelve days post-tumor injection, mice were injected with the
indicated doses of virus in HBSS+0.1% BSA or HBSS+0.1% BSA alone. Mice were followed
for survival (n=8) or sacrificed 6 days post-infection for viral biodistribution studies (n=3).
2.15. Biodistribution
Mice from the syngeneic or xenograft model had tumors and virus injected as described above
and then euthanized 6 days post-infection and the tumors, ovaries, kidneys, bowel, liver, spleen,
lung, heart, brain and bone marrow were harvested and stored at -80C° in HBSS. Tissues were
homogenized with the TissueLyzer II (Qiagen, Hilden, Germany), subject to 3 freeze-thaw
cycles, and sonicated prior to the viral plaque assay with CV-1 cells. Titers were normalized to
total protein per sample (mg) measured with the PierceTM
bicichoninic acid (BCA) protein assay
kit (Thermo Fisher Scientific, Waltham, Maryland, USA). Relative titers in normal tissues were
calculated by dividing the normalized tissue titer by the average normalized titer in tumors
infected with the corresponding virus.
57
2.16. Statistical Analysis
Data were analysed by a two-tailed independent samples t-test between candidate VV and vvDD
where applicable. Survival curves were evaluated with the log-rank test. Graphs were generated
with the Prism 5 Software (GraphPad Software Inc., La Jolla, California, USA). Data are
presented as Mean ± SEM.
58
Chapter 3
3 3
3 Results
3.1 Aim 1: Generate VV-deletion mutants via homologous recombination
The first aim of our project was to generate Western Reserve (WR) vaccinia viruses (VVs) with
a single gene deletion of one of our candidate immunomodulatory VV genes (N1L, K1L, K3L,
A46R, and A52R. The shuttle plasmids for vaccinia virus (VV) gene deletions were derived
from a pre-existing plasmid pVX-R2R-LUC. This vector was the same shuttle plasmid used to
generate the vvDD-R2R-Luc as first described by Lun et al. Briefly, relevant features of the
plasmid include 1) a VV synthetic early-late promoter upstream of a gene with RFP conjoined
to Renilla luciferase via the foot-and-mouth disease virus 2A motif to facilitate bicistronic
expression and 2) a xanthine-guanine phosphoribosyltransferase (xgprt) gene for viral selection
under the VV p7.5 promoter, and 3) an ampicillin gene to enable bacterial selection (Lun et al.,
2009). Sequences originally flanking the gene of interest (e.g. N1L) would be cloned into the
plasmid to flank the first 2 elements to create the shuttle plasmid (Figure 3.1 A) that will be used
to generate the desired VV deletion mutant with the DNA construct exemplified in Figure 3.1 B.
59
Figure 3.1. Schematic diagram of shuttle plasmid and final construct of candidate VV deletion mutant using
∆N1L VV as an example. A) Diagram of the shuttle plasmid created to facilitate homologous recombination with
VV to generate deletion mutant interrupted with RFP/Rluc and xgprt genes as illustrated in B. RFP and Rluc are
conjoined by a foot-and-mouth disease virus 2A motif. Abbreviations: RFP: red fluorescent protein, Rluc: Renilla
luciferase, Pse/l: synthetic VV early/late promoter, p7.5: p7.5 VV early/late promoter, xgprt: xanthine-guanine
phosphoribosyltransferase, AmpR: ampicillin resistance.
A)
B)
60
Before manipulating the plasmid, the plasmid preparation was confirmed to be pVX-R2R-Luc
by restriction enzyme digestion with SpeI and MfeI, yielding the expected band sizes of 6kb and
600bp. A second double digestion with BssHII and DrdI yielded the expected sizes of two 2.8
kb and one 1kb bands (Figure 3.2).
Figure 3.2. Confirmation of pvX-R2R-LUC plasmid. Existing DNA plasmid preparations were confirmed to be
pVX-R2R-LUC by 1) a double digest with SpeI and MfeI, which yielded the expected band sizes of 6kb and 800bp
and 2) a double digest with BssHII and DrdI, which yielded the expected band size of two 3.2 kb and one 1kb
bands.
Our strategy was to delete VV genes via homologous recombination by flanking the
aforementioned marker genes in pVX-R2R-LUC with 300-500 bp sequences from either side of
the candidate gene as determined by the Western Reserve (WR) VV genome sequence found in
GenBank (Accession number: NC_006998.1). Shuttle plasmids were made to facilitate the
deletion of the N1L, K1L, K3L, and A46R VV gene. The ∆A52R VV had been made by a
previous lab member, Nan Tang. All subsequent figures pertaining to the creation of shuttle
6 kb-
pVX-R2R-Luc
uncut
500bp-
1 kb-
Cu
t w
ith
Sp
eI +
Mfe
I
Cu
t w
ith
Bss
HII
+ D
rdI
3 kb-
61
plasmids (Figure 3.3 – 3.5) will use the production of ∆N1L VV shuttle plasmid, pVX-N1L-
R2R-Luc, as a representation of the cloning process.
Primers to amplify DNA sequences on the left and right side of the candidate genes were
derived from the VV genome sequence (Table 2.1) to facilitate PCR cloning. The PCR reaction
was performed using the VJS6 (WR VV with a TK gene deletion) viral DNA as template
(McCart et al., 2001). The sizes of the PCR products for the left and right flanking sequences
were confirmed by agarose gel electrophoresis (Figure 3.3). The DNA fragments were named
based on the corresponding candidate gene followed by L or R depending on whether the
sequence flanked the left or right side of the candidate gene, respectively. For example, the PCR
product from amplifying the DNA sequence on the left side of the N1L gene was named ―N1L-
L‖.
Figure 3.3. Left and right flanking DNA fragments of VV N1L gene as generated by PCR. Primers to amplify
the DNA sequences flanking the candidate VV gene, N1L, were designed from the WR VV genome sequence. PCR
products amplified from the VJS6 viral DNA were confirmed by agarose gel. A) Left-flanking DNA, N1L-L
(expected size: 549 bp) and B) Right-flanking DNA (expected size: 519 bp), N1L-R. Neg = negative control (H2O).
The corresponding left DNA fragments were inserted into pVX-R2R-Luc. First, the plasmid was
digested with MfeI and SpeI and the PCR fragments were digested with MfeI and NheI (which
makes compatible ends to SpeI overhangs). After ligation, bacterial transformation and
N1L-L
500 bp-
Neg N1L-R A) B)
1 k
b l
add
er
1 k
b l
add
er
500 bp-
Neg
62
ampicillin selection, at least 3 colonies were tested for the presence of the correct insert via
colony PCR (Figure 3.4 A). The PCR primers used for the colony PCR were the same primers
used to create the insert. Positive clones were grown up for subsequent plasmid DNA isolation
and further confirmed to contain the desired insert by restriction enzyme digestions (Figure 3.4
B). The resulting plasmids from bacterial transformation were named according to the format:
―pVX--<gene name>-L-R2R-Luc‖. For example, the pVX-R2R-LUC plasmid with an N1L-L
insert was called ―pVX-N1L-L-R2R-Luc‖.
Figure 3.4. Confirmation of pVX-R2R-Luc with left-flanking DNA insertion. A) Half a colony of ampicillin-
selected transformants were directly confirmed to contain the left-flanking DNA insert (N1L-L) by colony PCR.
(expected size: 549 bp) Positive control: VJS6 DNA and negative control (Neg): H2O. At least 3 clones were tested
for the presence of the desired partial shuttle plasmid B) Plasmid DNA preparations were confirmed to contain the
desired left side flanking DNA fragment (N1L-L) by a restriction enzyme digest based on a unique or rare cut sites
within the insert and in the pVX-R2R-Luc. Specifically, potential pVX-N1L-L-R2R-Luc plasmid DNA was
digested with HindIII (expected sizes: ~3kb and ~4.5kb)
1 k
b l
add
er
VJS
6
Neg
A) B)
500 bp-
Clone #
1 2 3 4 5
1 k
b l
add
er
4 kb-
pVX-N1L-L-R2R-Luc
Clone #
uncut 1 2 3
pVX-N1L-L-R2R-Luc
63
The plasmid preparation of one clone for each shuttle plasmid was used for subsequent cloning
steps. The right side insert and the vectors with the corresponding left inserts were then double
digested with PvuII and BssHII, ligated together, transformed into bacteria, and the final
transformants were also confirmed by colony PCR first (Figure 3.5 A) and then by restriction
enzyme digestion (Figure 3.5 B). All plasmid preparations were confirmed to be the desired
clones by restriction enzyme digestion of unique or rare sites found in the insert and plasmid.
The final shuttle plasmids to delete the N1L, K1L, K3L, and A46R gene were named pVX-
N1L-R2R-Luc, pVX-K1L-R2R-Luc, pVX-K3L-R2R-Luc, and pVX-A46R-R2R-Luc
respectively.
Figure 3.5. Confirmation of the final shuttle plasmid. A) Half a colony of each transformant was directly used
for colony PCR confirmation for the presence of the right-flanking DNA fragment, N1L-R (expected size: 519 bp).
Negative control (Neg): H2O. B) Plasmid DNA preparations from positive clones in A) were confirmed to contain
the desired right side flanking DNA fragment by a restriction enzyme digest based on a unique or rare cut sites
within the insert and in the pVX-R2R-Luc. pVX-N1L-R2R-Luc DNA from 2 clones digested with HindIII
(expected sizes: ~800bp and ~5.3kb)
500 bp- 500 bp-
pVX-N1L-R2R-Luc
Clone #
1 2 3 4 Neg
500 bp-
1 k
b l
add
er
A) B)
750 bp- 1 kb-
5 kb-
pVX-N1L-R2R-Luc
Clone #
uncut 1 2
64
After confirmation by PCR and restriction enzyme digestion, the shuttle plasmids were
amplified and transfected into F13L+ (wildtype WR VV)-infected CV-1 cells. The cells were
harvested, serially diluted, and re-infected into a new monolayer of CV-1 cells growing in media
supplemented with mycophenolic acid, hypoxanthine, and xanthine. Mycophenolic acid inhibits
the salvage pathway for purine synthesis, specifically, the formation of guanine. If the F13L+
viruses undergo homologous recombination with the shuttle plasmid, in addition to the deletion
of the candidate gene, the recombinant virus will express the RFP/Renilla luciferase marker
gene and the Escherichia coli xgprt gene. The xgprt gene will allow the recombinant virus to
circumvent the inhibition of mycophenolic acid and produce guanine to facilitate its replication,
while the wildtype virus will be able to infect cells, but not replicate (Mulligan and Berg, 1981).
RFP expression was observed in single cells 72h after the transfection/infection. After the initial
re-infection of transfected cell suspension, RFP-expressing plaques were picked 72 hours post-
infection (hpi) (Round 0) and re-infected into new monolayers of mycophenolic acid-treated
CV-1 cells. Subsequent RFP-expressing plaques were picked for at least 5 rounds to dilute out
the parental virus until the whole population was the desired recombinant virus as confirmed by
PCR. Evidence of RFP expression after transfection and a sample RFP-expressing plaque at
round 0 and 5 of selection are presented in Figure 3.6.
65
Figure 3.6. Sample images of CV-1 cells after transfection/infection and subsequent rounds of re-infection
with recombinant VV. CV-1 cells were transfected with the shuttle plasmid, infected with wildtype WR VV
(F13L+) then incubated in media containing mycophenolic acid, hypoxanthine, and xanthine (drugged DMEM).
The transfected/infected monolayer was harvested 72hpi and re-infected into another CV-1 monolayer grown in
drugged DMEM (Round 0). Subsequent RFP plaques were harvested and re-infected into new monolayers for at
least 5 more rounds. Brightfield and fluorescent images (Cy3 filter) were taken with a 10x objective lens at 72hpi
after each round
66
Confirmation that the selected RFP-expressing plaques were free from parental virus was
determined by a PCR reaction, visualized via agarose gel electrophoresis and presented in
Figure 3.7. The same primers used to produce the flanking PCR products for insertion into
pVX-R2R-Luc shuttle plasmid were also used for these confirmation PCR reactions.
Specifically, the forward primer that amplified the left insert and the reverse primer of the right
insert were used. For example, to confirm that the ∆N1L VV was parental free, the PCR
reaction was undertaken with the N1L-L forward and N1L-R reverse primers. In this way, if the
virus is recombinant with the desired interruption of the open reading frame (ORF) of the
candidate VV gene, the expected band as a result of the inserted marker genes would be
approximately 4kb. If parental virus F13L+ was still present in the recombinant virus sample,
the PCR product will be the combined length of both PCR inserts used for cloning and the
wildtype candidate gene sequence left in between (approximately 1kb). Although it is possible
that the PCR reaction can yield the recombinant DNA product, a length of 4kb is very difficult
to achieve in a PCR reaction with standard Taq polymerase, especially with a crude preparation
of viral DNA template. Clones were considered fit for further use based primarily on the
absence of the ~1kb PCR product from the candidate gene in a wildtype WR VV. As expected,
some PCR reactions yielded neither the 4kb nor the 1kb band, such as the ∆K1L VV clone # 4
(Figure 3.7 B). The plaque from this clone was still amplified into viral stocks because the viral
RFP expression and growth in the presence of mycophenolic acid indicated the presence of the
desired virus. For the other viruses, the following clones were used to amplify the desired
recombinant viruses: clone #4 of ∆N1L VV (Figure 3.7 A), clone #6 of ∆K3L VV (Figure 3.
7C), and clone #2 of ∆A46R VV (Figure 3.7 D).
67
-4 kb
-1 kb
∆K1L VV
Clone #
1 2 3 4 5 6 F1
3L
+
pV
X-K
1L
-R2
R-L
UC
Neg
1 k
b l
add
er
A) B)
-4 kb
-1 kb
∆N1L VV
Clone #
1 2 3 4 5 6 F1
3L
+
pV
X-N
1L
-R2
R-L
UC
Neg
1 k
b l
add
er
C) D)
F1
3L
+
pV
X-K
3L
-R2
R-L
UC
-4 kb
-1 kb
∆K3L VV
Clone #
1 2 3 4 5 6 Neg
1 k
b l
add
er
pV
X-A
46
R-R
2R
-LU
C
-4 kb
-1 kb
∆A46R VV
Clone #
1 2 3 4 5 6 Neg
F1
3L
+
1 k
b l
add
er
68
Figure 3.7. PCR confirmation of the absence of parental virus from recombinant VV plaques. CV-1 cells
were infected with one of 6 plaques after round 5 of mycophenolic acid selection. When complete cytopathic effect
(CPE) was observed, cells were harvested and digested with Proteinase K. The samples were tested by PCR for the
absence of parental virus (F13L+). The forward primer from the left flanking DNA fragment and the reverse primer
of the right flanking DNA fragment were used as primers for the PCR reactions. Positive control for parental virus
was viral DNA from F13L+ infected CV-1 cells, and the corresponding shuttle plasmid DNA was used as template
for the positive control for the recombinant band, negative (Neg) control from mock-infected cells. Only viruses for
which a shuttle plasmid was made during this project are tested here: A) ∆N1L VV, B) ∆K1L VV, C) ∆K3L VV,
D) ∆A46R VV.
During and after the process of amplifying the candidate VVs into viral stocks, the same PCR
reaction described in Figure 3.8 was conducted to further confirm that absence of parental WR
VV virus before further use for experimental assays. If there were any parental virus left in the
selected plaques tested above that did not produce a 1kb band, due to some reason such as too
low amounts of parental virus DNA template compounded by inhibitory factors within the crude
DNA preparation, the amplification process will have also amplified the parental virus and
produced a 1kb band in the PCR reaction by the end of the viral stock production. The stock of
∆A52R virus was also tested here. It was confirmed that all stocks of candidate VVs were free
from parental WR VV (Figure 3.8). There is a ~1.5kb DNA fragment produced from the ∆A52R
VV stock, however, since the PCR reaction with the parental virus (F13L+) yielded a product of
~750 bp, the ∆A52R stock is still considered free from parental virus.
69
70
Figure 3.8. PCR confirmation of candidate viral stocks. CV-1 cells were infected with virus stocks amplified
from plaques of candidate VVs. Infected cells were harvested and PCR with the forward primer of the left flanking
insert and the reverse primer of the right flanking insert was conducted to amplify the corresponding wildtype
candidate VV gene (~1kb), or a PCR product reflective of the marker genes interrupting the candidate genes
(~4kb). Negative control (Neg) was mock-infected cells, F13L+ (wildtype WR VV)- infected cells were positive
control for the wildtype product, and the corresponding shuttle plasmids, if available, were the positive controls for
the PCR product expected from the candidate deletion viruses: A) ∆N1L VV, B) ∆K1L VV, C) ∆K3L VV, D)
∆A46R VV, and E) ∆A52R VV.
After confirmation that the virus stocks were free from parental virus, the candidate VVs were
tested in vitro as described below in Aim 2.
71
3.2 Aim 2: Compare candidate VV deletion mutants to vvDD in terms of in vitro viral replication, cytotoxicity, and spread in colon and ovarian cancer cell lines.
The first step in evaluating the potential of our candidate deletion mutants as oncolytic agents
was testing the capability of these novel constructs for viral replication, tumor-killing, and viral
spread, compared to a clinical oncolytic virus such as vvDD. Throughout the study, the viruses
were studied in three cell lines: MC38 murine colon carcinoma, DLD-1 human colon
carcinoma, and A2780 ovarian colon carcinoma. These cell lines were chosen to correspond
with the cell lines used in our mouse models of peritoneal carcinomatosis used in Aim 3.
Candidate VV deletion mutants exhibit replication similar to or more efficient than vvDD
in monolayers of colon and ovarian cancer cell lines.
The replication of candidate VV deletion mutants and vvDD in cancer cell lines was assessed by
infecting monolayers of MC38, DLD-1 or A2780 at a low multiplicity of infection (MOI) of 0.1
(Figure 3.9). Infected monolayers were harvested and stored for subsequent virus quantification
by plaque assay at baseline (or 2h after the pre-infection process), 24 hours, 48 hours, and 72
hours post-infection (hpi) (Figure 3.9).
The replication of vvDD and VV deletion mutants in all cell lines resulted in a 2-3 log-fold
increase in total viral particles by 72hpi. In general, all candidate VVs exhibited similar or better
viral replication compared to vvDD in both MC38 and DLD-1 cells at peak viral titers. The
same can be concluded for most candidate VVs within A2780 cells, with the exception of
∆A46R VV. However, the replication efficiency of all tested VVs in A2780 cells was generally
higher compared to the other two colon carcinoma cells (range of mean viral fold change
compared to baseline at 72hpi: 712.2 – 2177.5 [MC38], 109.4 – 1520.4 [ DLD-1], and 792.0 –
72
4405.2 [A2780]). The ∆K1L VV demonstrated the most efficient replication ability across all
cell lines, with the average fold change in replication being 2.8, 13.9, and 2.3 times higher than
the average fold change of vvDD in MC38, DLD-1, and A2780 cells, respectively (p<0.05).
73
DL
D-1
DLD-1
A27
80
A) B)
MC
38
C) D)
E) F)
74
Figure 3.9. Replication of candidate VVs and vvDD in colon and ovarian cancer cell lines. Monolayers of
MC38 (A, B), DLD-1 (C, D), and A2780 (E, F) cells were infected with vvDD or candidate VVs at an MOI of 0.1.
Viral quantitation was determined by plaque assays at 2, 24, 48, and 72hpi. Data are presented as total plaque –
forming units (pfu) over time (A, C, E) or as fold change relative to baseline pfu at 2hpi (B, D, F). Values are
means of three replicates ± SEM corresponding to one out of three independent experiments (n=3). *p<0.05
compared to vvDD.
75
Candidate deletion mutant VV spread is similar to or better than vvDD in colon and
ovarian cancer cell lines.
The viral spread of the candidate VV deletion mutants was compared to vvDD in monolayers of
colon and ovarian cell lines, infected at an MOI of 0.1, as measured by fluorescence
microscopy. Differential interference contrast (DIC) images and fluorescent images with the
Cy3 lens were taken at 2 (baseline), 24, 48, and 72 hpi. Images at peak viral spread based on
RFP expression are presented: 72hpi of MC38 and DLD-1 cells and 48 hpi of A2780 cells
(Figure 3.10) Viral spread quantification was based on the area of RFP expression relative to the
total area of the image. (Figure 3.11).
The viral spread of all candidate VVs was similar or better than vvDD in all cell lines tested, as
confirmed by both visual assessment and quantitative analysis. Though statistical significance
was only achieved in MC38 cells for these viruses, visual assessment of viral spread confirms
the quantified trend of superior spread of ∆K1L VV, ∆N1L VV, and ∆A52R VV in all cell lines.
The best performer, ∆A52R VV, demonstrated consistently significant superior viral spread in
all cell lines, infecting approximately half of all cell lines at its peak (% infected area: 55.6% ±
6.1% [MC38], 39.7% ± 8.5% [DLD-1], 65.5% ±4.1 % [A2780]). As such, mean ∆A52R VV
spread was 11.8% - 33.7% better relative to vvDD at peak time points in all tested cell lines.
76
Figure 3.10. Viral spread of VV deletion mutants and vvDD in colon and ovarian cancer cell lines. Cell lines MC38, DLD-1 and A2780 were infected with either
the indicated VV deletion mutants or vvDD at an MOI of 0.1 and visualized under fluorescent microscopy with a Cy3 filter at 10x magnification.
vvDD ∆N1L ∆K1L ∆K3L ∆A46R ∆A52R Mock Mock (Brightfield)
MC
38 (
72 h
pi)
DL
D-1
(7
2 h
pi)
A2
78
0 (
48 h
pi)
77
Figure 3.11. Quantification of viral spread in colon and ovarian cancer cell lines. Monolayers of MC38, DLD-1, and A2780 cells were infected with candidate VV
deletion mutants and vvDD at an MOI of 0.1. Fluorescent images were taken with a Cy3 lens at 10x magnification and infected areas were measured by determining the
area with RFP marker expression over total image area, as calculated with ImageJ software, set at a uniform threshold at each time point. Data are a combination of two
independent experiments, each with three replicates, and values are mean ± SEM (n=6). *p<0.05 compared to vvDD (blue circle).
MC38 DLD-1 A2780
78
Candidate VV deletion mutants exhibit equivalent or enhanced cytotoxicity in colon and
ovarian cancer cell lines compared with vvDD.
The cytotoxicity of our candidate VVs were compared to vvDD at multiple infecting doses
(MOI 0.1, 1, and 5) and multiple time points (2, 24, 48, and 72 hpi) in monolayers of colon and
ovarian cancer cell lines. Cell viability was measured via the colorimetric MTS ([3-(4,5-
dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner
salt) assay. The results are shown in Figure 3.12.
Similar to the results of the viral replication experiments, the cytotoxicity of each of our
candidate VVs is either equal to or higher in the colon cancer cell lines, MC38 and DLD-1,
compared to vvDD. The difference in cytotoxicity of all candidate VVs compared to vvDD was
the most dramatic in MC38 cells, where candidate VV treatment at 72hpi at an MOI of 1
dramatically reduced the mean cell viability relative to mock controls by at least 1.92 times
compared to vvDD (range of % viability: 40.1% - 51.4% compared to 95.8% , p<0.05). All the
VVs were very effective at killing A2780 cells, however, cytotoxicity of all candidate VVs and
vvDD in A2780 cells was significant at a low MOI of 0.1 by 72 hpi (mean % viability: 24.6% -
63.0%). The cytotoxicity in all tumor cell lines of all candidate VVs was similar by 72hpi.
Among them, the ∆A46R VV was the most cytotoxic (mean % viability at MOI 1: 40.1%±0.3%
[MC38], 40.3%±2.0% [DLD-1], and 4.8%±1.1% [A2780]).
79
MC38 DLD-1 A2780
MOI = 0.1 A)
80
MC38 DLD-1 A2780
MOI = 1 B)
81
Figure 3.12. Cytotoxicity of vvDD and candidate VVs in colon and ovarian cancer cell lines. Monolayers of MC38, DLD-1 and A2780 were infected at an MOI of
A) 0.1, B) 1, C) and 5 and cell viability was measured at 2, 24, 48, and 72 hpi. Values are means of three replicates ± SEM corresponding to one of two independent
experiments (n=3). *p<0.05 compared to vvDD (blue circle).
C)
MC38 DLD-1 A2780
MOI = 5
82
Candidate VVs exhibit equal or better viral spread in tumor spheroids compared to vvDD.
Tumor spheroids mimic the 3D structure and microenvironment of a tumor and allow for more
relevant and realistic in vitro investigation (Casagrande et al., 2014) of the candidate VVs. In
this study, MC38 and DLD-1 spheroids were generated, infected at an MOI of 2, and viral
spread was observed through the Cy3 lens of a confocal microscope to track virally-induced
RFP expression throughout the spheroid over time. The spheroid diameter was approximately
250-300 µm at the time of infection. The images presented are representative fluorescent images
approximately halfway into the spheroid (~130 µm) (Figure 3.13 and 3.14). A snapshot of the
spheroid with the brightfield lens was also taken to calculate spheroid volume using an equation
that assumed a spherical/elliptical shape. Tumor volume was only calculated for MC38
spheroids, since DLD-1 spheroids tended to become very irregular as a result of infection.
A2780 cells were not used to make spheroids in this study, because tumor spheroid generation
with PolyHEMA plates did not yield the desired uniform, compact, cell aggregates which could
survive the aspiration step during infection. Instead, A2780 cells formed loose cell aggregates,
consistent with what has been reported in the literature (Casagrande et al., 2014).
Viral spread into tumor spheroids was evaluated qualitatively using visual examination of viral
RFP marker expression. The viruses varied in their ability to penetrate into the centre of the 3D
structures. Small amounts of RFP expression associated with vvDD infection could be seen at
130 µm depth into MC38 spheroids at 72hpi. In contrast, the ∆N1L, ∆K1L, ∆A46R, and ∆A52R
VVs infected most of the rim and exhibited some penetration into the MC38 spheroids. The
DLD-1 spheroids were more resistant to infection by vvDD and most candidate VVs, resulting
in small, dispersed foci of RFP by 72hpi. However, ∆A52R VV was able to infect a larger
portion of the DLD-1 spheroids. Out of all viruses tested, ∆A52R VV spread the furthest into
both MC38 and DLD-1 spheroids.
83
Figure 3.13. Viral spread of candidate VVs and vvDD in MC38 tumor spheroids. MC38 spheroids were infected at an MOI of 2 and visualized by confocal
microscopy with brightfield and Cy3 lens at 10x objective lens (n=4). Scale bar = 100 um A) Brightfield images of spheroids before infection B) Brightfield images of
MC38 spheroids 72 hpi, C) Virally-induced RFP expression of a cross-section of spheroids at 150 um (approximately halfway), visualized with a Cy3 filter.
vvDD ∆N1L ∆K1L ∆K3L ∆A46R ∆A52R Mock
A
B
C
84
Figure 3.14. Viral spread of candidate VVs and vvDD in DLD-1 spheroids. DLD-1 spheroids were infected at an MOI of 2 and visualized by confocal microscopy
with brightfield and Cy3 filter at 10x objective lens 72 hpi (n=4). Scale bar = 100 um A) Brightfield images of spheroids before infection B) Brightfield images of DLD-
1 spheroids 72 hpi, C) Virally-induced RFP expression of a cross-section of spheroids at 150 um (approximately halfway) visualized with a Cy3 filter.
vvDD ∆N1L ∆K1L ∆K3L ∆A46
R
∆A52
R
Mock
A
B
C
85
Candidate VVs and vvDD are cytotoxic in tumor spheroids.
The effect of VV infection on tumor spheroid volume, i.e. cytotoxicity, was evaluated in MC38
spheroids (Figure 3.14). Tumor spheroid volume was determined by measuring the longest
diameter (major axis) and the diameter of the spheroid at the axis perpendicular to the major
axis (minor axis) using brightfield images of each spheroid. These values were then used to
calculate spheroid volume, using an equation that assumed a spherical shape (V=4/3*pi*(minor
axis)2(major axis)). Since infected DLD-1 spheroids were often irregular, tumor volume was not
calculated for these spheroids. In general, vvDD- and candidate VV-infected MC38 spheroids
had significantly lower mean spheroid volume compared to mock-treated controls by 72hpi
(Figure 3.14 A). Additionally, candidate VVs were associated with similar or lower mean tumor
spheroid volume compared to vvDD (Figure 3.14 B). Moreover, the decrease in tumor spheroid
volume in infected spheroids started to plateau at 96 hpi. Hence, to confirm the cytopathic effect
of vvDD and candidate VVs in this model, a clonogenic assay was conducted with MC38 and
DLD-1 spheroids at 96hpi.
86
Figure 3.15. MC38 spheroid size after treatment with candidate VVs or vvDD. MC38 spheroids were infected
at an MOI of 2 and brightfield images were taken at 24 hour intervals post-infection with a 10x objective lens. The
grey box represents the expanded region from A) shown in B). Tumor volume was calculated based on the radii at
the major and minor axis of the spheroid measured with the images. V=4/3*pi*(minor axis)2(major axis). Values
are mean of four replicates ± SEM corresponding to one experiment (n=4).
A)
B)
87
The percent surviving fraction of virus-treated MC38 spheroids was low or undetectable (range
of mean surviving fraction 0-3.3%). MC38 spheroids treated with ∆A46R or ∆N1L VV did not
yield a detectable surviving fraction (Figure 3.16 A and B). Similarly, surviving fraction of
DLD-1 spheroids treated with all viruses was very low to undetectable (range of mean surviving
fraction: 0 – 1.3%). DLD-1 spheroids treated with ∆K1L, ∆N1L, and ∆A52R VV did not result
in a detectable surviving fraction (Figure 3.16 C and D). In contrast, many cells survived in
mock-treated spheroids (mean surviving fraction MC38: 60.2% ±12.0%, DLD-1: 87.7% ±
20.2%).
88
MC38 Spheroids
A)
B)
89
Figure 3.16. Clonogenic assay of tumor spheroids treated with candidate VVs or vvDD. MC38 (A, B) and
DLD-1 (C,D) spheroids infected at MOI 2 were dissociated at 96hpi and reseeded into 6-well plates at 25-100
cells/well, grown for 10 days, and stained with crystal violet. Surviving fraction was calculated based on the
number of colonies (>50 cells) relative to the number of cells originally seeded. The grey box represents the
expanded region from A) and C) shown in B) and D), respectively. Values are means of three replicates ± SEM
corresponding to one of two independent experiments (n=3).
C)
D)
DLD-1 Spheroids
90
In vitro assays suggest ∆K1L VV, ∆A46R VV, and ∆A52R VV are promising oncolytic
viruses.
The 3 best-performing candidate VVs in vitro were chosen for subsequent in vivo investigation.
Categorization of candidate VVs in Table 3.1 as more, equally, or less potent than vvDD were
based on statistical analysis via two-tailed t-test (p<0.05) in all assays, with the exception of
viral spread in tumor spheroids (last 2 columns) which was not quantified. Viruses were ranked
based on the quantitative mean where applicable or qualitative analysis (as in the case of viral
spread in tumor spheroids). One candidate VV for each category was the best performer across
all cell lines tested. Namely, ∆K1L VV exhibited the fastest VV replication, ∆A46R was the
most cytotoxic, and ∆A52R demonstrated the most viral spread in tumors. Hence, these 3
viruses were tested in in vivo models of cancer in Aim 3
91
Table 3.1. Summary of the in vitro assays comparing candidate VVs to vvDD. Candidate VVs were assessed against vvDD for viral replication, spread and tumor
cytotoxicity in MC38, DLD-1, and A2780 cells and results are summarized, ranking the performance of each virus starting with the best performer first.
Replication
(Monolayer)
Cytotoxicity
(Monolayer)
Cytotoxicity
(Spheroids)
Spread
(Monolayer)
Spread
(Spheroids)
MC38 DLD-1 A2780 MC38 DLD-1 A2780 MC38 DLD-1 MC38 DLD-1 A2780 MC38 DLD-1
∆K1L ∆K1L ∆K1L ∆A46R ∆A46R ∆A46R ∆A46R
∆A52R
∆A52R ∆A52R ∆A52R ∆A52R ∆A52R
∆A52R ∆A52R ∆K3L ∆K1L ∆N1L ∆N1L ∆N1L ∆K1L ∆K1L ∆K1L ∆N1L ∆N1L ∆K1L
∆A46R ∆K3L ∆N1L ∆A52R ∆A52R vvDD ∆K3L ∆N1L ∆N1L ∆K3L ∆K1L ∆K1L ∆N1L
∆K3L ∆N1L ∆A52R ∆N1L ∆K1L ∆K3L vvDD ∆A46R vvDD ∆N1L vvDD ∆A46R ∆K3L
∆N1L ∆A46R vvDD ∆K3L ∆K3L ∆A52R ∆K1L ∆K3L ∆K3L ∆A46R ∆K3L ∆K3L ∆A46R
vvDD vvDD ∆A46R vvDD vvDD ∆K1L ∆A52R vvDD ∆A46R vvDD ∆A46R vvDD vvDD
More potent than vvDD
Equally potent compared to vvDD
Less potent than vvDD
92
3.3 Aim 3: Characterization of the candidate VV deletion mutants to vvDD in terms of in vivo tumor-selectivity, toxicity and efficacy in mouse models of PC.
To further investigate the potential of our novel candidate VVs as oncolytic viruses, the best
performers from our in vitro assays were tested in nude (NU/NU) and immunocompetent mice
(C57BL/6). A maximum tolerable dose (MTD) was determined for each candidate VV and used
for subsequent investigation. For both the biodistribution and tumor survival studies, tumor
generation was induced by IP injection of either DLD-1 human colon carcinoma cells or A2780
human ovarian carcinoma cells into NU/NU mice, or MC38 murine colon carcinoma cells into
immunocompetent C57BL/6 mice. These mouse models are established models of peritoneal
carcinomatosis (PC) in our lab.
The MTD of candidate VVs is lower than the established vvDD treatment dose.
Before assessing the anti-tumor efficacy of each candidate VV treatment, MTDs were
determined for IP treatment (Figure 3.17). Non-tumor-bearing mice were injected IP at different
doses and followed for toxicity. Common adverse events of virus treatment in nude mice
included pox formation, usually on paws or tail, and weight loss. However, in C57BL/6 mice,
only weight loss, if at all, was observed after virus treatment.
In the first study in which C57BL/6 mice were injected at the same dose as the established
vvDD IP dose of 109 pfu, the mice treated with candidate VVs reached endpoint within one
week. Subsequent studies tested doses one at a time and mice were observed for at least 30 days
or until the first death, before the initiation of another study with an adjusted dose. Endpoint
criteria for these studies included: >20% weight loss, moribund, or otherwise unable to eat and
drink. Doses were increased or decreased by 0.5 log-fold in the next study, accordingly. For
most of the dose titration experiments, no mock group was used. Instead, vvDD was injected at
93
the same dose as the candidate VVs for each study. According to the literature, vvDD is not
toxic to mice even at an IP dose of 109, though transient weight loss after injection is observed
at this dose (McCart et al., 2001; Ottolino-Perry et al., 2014). Thus, no deaths were expected
from the vvDD-treated group, especially at lower doses. Hence, the vvDD group served as 1) a
negative control similar to mock and 2) a treatment group to compare to candidate VV treatment
groups for in vivo toxicity.
For immunocompetent C57BL/6 mice, the IP MTD for the ∆K1L VV was 5x107
pfu, while the
MTD of ∆A46R VV and ∆A52R VV was 1x107
pfu (Figure 3.17 A, B). No mice reached
endpoint at the corresponding treatment doses within 30 days. However, mice in the ∆K1L VV-
treated group suffered transient weight loss approaching endpoint weight loss, before recovery
(~1 week) at a dose of 5x107 pfu.
The IP treatment dose for the tumor survival studies of all candidate VVs in nude mice was 106
pfu (Figure 3.17 C). Though one mouse from each of the ∆K1L and ∆A46R treatment groups
reached endpoint at 28 days, the MTD was still deemed to be 106 for these viruses.
94
Figure 3.17. Determining the IP MTD of candidate VVs in nude and C57BL/6 mice. Non-tumor-bearing mice were injected IP with the indicated doses of
candidate VV or vvDD (n=3). A) 5x107 pfu into C57BL/6 mice B) 1x10
7 pfu into C57BL/6 mice, and C) 1x10
6 pfu into NU/NU mice.
A) B)
C)
5 x 107 pfu in C57BL/6 1 x 107 pfu in C57BL/6
1 x 106 pfu in NU/NU
95
Candidate VVs and vvDD replication preferentially target tumors and ovaries.
The tumor-selectivity of IP-delivered candidate VV and vvDD replication was evaluated in
tumor-bearing models of PC (Figure 3.18). Specifically, a syngeneic model of PC with C57BL/6
mice bearing IP MC38 tumors and xenograft models of nude (NU/NU) mice bearing IP A2780
or DLD-1 tumors, were used. All mice were treated with IP virus or mock infection 12 days-
post tumor inoculation. In C57BL/6 mice, the doses were: 109 pfu of vvDD, 5x10
7 pfu of ∆K1L
VV, 1x107 pfu of ∆A46R VV or ∆A52R VV. Nude mice were treated at 5x10
6 pfu for all
viruses. Viral titers were normalized to total protein, to account for the differing protein contents
in each tissue type (Figure 3.18 A, C, E). Since the viral doses also differed among treatment
groups in C57BL/6, normalized viral loads of non-tumor tissues were also presented relative to
the normalized viral load in tumors, for studies in both C57BL/6 and NU/NU mice (Figure 3.18
B, D, F). Specifically, the normalized viral titers from non-tumor tissue were divided by the
viral load found in tumors from the same mouse. If the viral load of the non-tumor tissue was 0,
it is not presented on the graph. These data are presented in log-scale, thus bars below the x-axis
signify that the viral titers for the corresponding non-tumor tissues are lower than the viral load
in the tumors found in the same mouse.
Candidate VV and vvDD replication preferentially targeted the tumor and the ovaries in all
cancer mouse models tested. In C57BL/6 mice bearing MC38 tumors, 2-4 log-fold less
candidate VV was generally detected in the tumor compared to vvDD, possibly partially due to
the different doses. With the exception of the ovaries, all viruses had little to no infectious
particles in other non-tumor tissues compared to tumor. Most impressively, ∆A52R VV was
undetectable in the bowel, spleen, liver, heart, and brain. In NU/NU mice bearing DLD-1
tumors, the viral load of candidate VVs and vvDD found in tumors was more similar ( range:
1.3 x 105 pfu/mg – 1.5 x 10
6 pfu/mg compared to 4.1x10
5 pfu/mg) . In general, the concentration
of infectious particles of all candidate VVs and vvDD was lower in non-tumor tissues, except
the ovary, compared to tumor. In NU/NU mice bearing A2780 tumors, up to 10 times more than
the amount of virus injected into each mouse was found per milligram of tumor for all viruses.
96
In addition, the viral load in all non-tumor tissues was at least 10 times lower than the viral load
found in corresponding tumors.
97
Sple
en
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
Sple
en
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
Sple
en
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
MC38 in C57BL/6
DLD-1 in NU/NUA2780 in NU/NU
vvDD K1L A46R A52R
MC38 in C57BL/6 A)
B)
98
Sple
en
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
Sple
en
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
Sple
en
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
MC38 in C57BL/6
DLD-1 in NU/NUA2780 in NU/NU
vvDD K1L A46R A52R
DLD-1 in NU/NU C)
D)
99
Figure 3.18. Biodistribution of candidate VVs and vvDD in tumor-bearing mice. Nude mice were injected IP
with tumors and 12 days later, treated IP with vvDD or candidate VVs at MTDs of virus in MC38-bearing C57BL6
mice (A, B) or 5x106 pfu for DLD-1 (C,D) or A2780- bearing (E,F) nude mice. Non-tumor and tumor tissues were
harvested and viral load was quantified and presented as total pfu/mg (A, C, E) and total pfu/mg relative to tumor
titer (B, D, F). Values are means of three replicates ± SEM.
A2780 in NU/NU E)
F)
Spleen
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
Spleen
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
Spleen
Bow
el
Bra
in
Bone
Mar
row
Ova
ry
1.010 -10
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.010 00
1.010 02
1.010 04
Re
lati
ve
Tit
er
(PF
U/m
g)
to T
um
ou
r
MC38 in C57BL/6
DLD-1 in NU/NUA2780 in NU/NU
vvDD K1L A46R A52R
100
Candidate VVs improve survival in orthotopic PC models compared to mock- and vvDD-
treated groups.
The survival advantage of candidate VVs and vvDD was assessed in syngeneic and xenograft
orthotopic models of PC. Mice were treated at the MTD 12 days post-tumor inoculation and
followed for survival. The endpoint criteria for these experiments included: >20% weight loss, a
subcutaneous tumor at the injection site of >1.5cm, difficulty breathing, moribund, or otherwise
unable to obtain food or water.
Candidate VVs improved survival equivalent to or better than vvDD with respect to mock-
treated controls in the MC38 tumor-bearing C57BL/6 syngeneic model (Figure 3.19). Both
vvDD- and ∆A46R- treated mice had a similar survival time compared to mock-treated mice. A
significant improvement in median survival time compared to vehicle-treated mice was
observed in ∆K1L-treated mice (35 days v.s. 28.5 days, p=0.0058), but ∆A52R VV-associated
median survival was also longer than vvDD (32.5 days).
Figure 3.19. Efficacy of candidate VVs and vvDD in a syngeneic model of PC. Kaplan-Meier survival curve of
MC38 tumor-bearing mice injected IP with candidate VV, vvDD, or mock-treatment (HBSS) 12 days post-tumor
injection (n=8).
MC38 in C57BL/6
101
The efficacy of the candidate VVs was also similar or better than vvDD in xenograft models of
PC. In DLD-1 tumor-bearing mice (Figure 3.20 A), long-term survival until the end of the
experiment at 160 dpi was observed in 12.5%, 25%, and 37.5% of vvDD, ∆A46R VV and
∆A52R VV treated mice, respectively. In A2780 tumor-bearing mice (Figure 3.20 B), ∆K1L
VV treatment significantly improved median survival time compared to mock- treated mice
(53.5 days v.s. 40 days, p=0.0021). A 12.5% long-term survival rate was also associated with
vvDD, ∆K1L, and ∆A52R treatment.
102
Figure 3.20. Efficacy of candidate VVs and vvDD in xenograft models of PC. Kaplan-Meier survival curve of
A) DLD-1 tumor-bearing NU/NU mice and B) A2780 tumor-bearing NU/NU mice injected IP with candidate VV,
vvDD, or mock-treatment (HBSS), 12 days post-tumor injection (n=8). The mock-treated group in A) had 7 mice
due to dramatic weight loss in one mouse before the experiment began. Death of one mouse in the vvDD group
presented in B) was censored due to a death related to neither virus treatment nor tumor burden.
DLD-1 in NU/NU
A2780 in NU/NU
p=0.0021
A)
B)
103
Chapter 4
4 Discussion
4.1. General Discussion
The first aim of this project was to generate a panel of VV deletion mutants with a deletion in
one of the VV immunomodulatory genes (N1L, K1L, K3L, A46R, and A52R) from one of the
more virulent strains of VV, Western Reserve (WR). The WR strain was chosen as the
backbone of our viruses for its inherent tumor-selectivity compared to other strains of VV, as
measured by viral replication in tumors relative to non-tumor cells (Thorne et al., 2007).
Further, WR VV was used as the parental virus in the creation of vvDD (McCart et al., 2001).
We intended to exploit the defects in antiviral immunity commonly found in cancer by deleting
redundant immunomodulatory genes from VV. This mechanism of tumor-specificity is
exploited by other research groups and there are some promising OVs created using this
rationale. For example, the deletion of the VV inhibitor of IFNβ, B18R, resulted in a tumor-
selective OV (Kirn et al., 2007). There were several reasons for choosing the aforementioned
VV genes for deletion. The chosen candidate genes inhibited major proteins related to the IFN
induction or signaling pathways that are already dysregulated in several malignancies. Hence,
the expression of these VV immunomodulatory genes would be redundant for successful
replication in tumor cells. Further, independent research groups have reported decreased
virulence in normal cells, or animal models, following deletion of the candidate genes from WR
VV or other strains of VV (Stack et al., 2005; Harte et al., 2003; Bartlett et al., 2002; Langland
and Jacobs, 2002; Liu et al., 2013). Hence, we believed that the deletion of our candidate genes
would yield a promising tumor-selective oncolytic VV. Of note, the degree of mutations and
IFN resistance varies among cancers and cell lines, so the susceptibility of different tumors to
our candidate VVs would also vary.
104
The candidate deletion mutants were generated via homologous recombination with a shuttle
plasmid. Though some groups have already made deletion mutants of our candidate genes from
WR VV, it was important to make our own virus, to ensure consistency and comparability to
vvDD-R2R-Luc. The marker gene was a fusion protein of RFP and Renilla luciferase. RFP was
used to measure in vitro viral spread, however the Renilla luciferase was not used in this project
and cloned in for future studies. Overall, the first aim of this project was successfully achieved.
The shuttle plasmid had been confirmed with both colony PCR and restriction enzyme
digestions of unique sites (Figure 3.5). Further, expression of RFP in infected monolayers
confirmed the presence of the desired recombinant VV (Figure 3.6) and subsequent PCR
demonstrated the successful selection from parental virus via the absence of a ~1 kb PCR
product that would have been amplified in the presence of parental WR VV (Figure 3.7-3.8).
The recombinant VVs would have also been able to produce a 4kb band from the same PCR
reaction. Although it was not a requirement to determine the absence of the parental WR VV,
there was a 4kb band for all viruses except ∆K1L VV, which served as a double confirmation of
the presence of the desired deletion mutant. The crude DNA preparation and the length of the
PCR product may have hindered the production of the 4kb band during the PCR reaction for
∆K1L VV. Alternatively, a separate PCR reaction amplifying a smaller product, by replacing
one of the original primers with a DNA sequence derived from the inserted marker genes, could
confirm the presence of the desired ∆K1L VV with the expected insert.
For the second aim of our project, we tested our panel of candidate VV deletion mutants against
vvDD in terms of in vitro viral replication, viral spread and cytotoxicity in colon and ovarian
cancer cell lines. The cell lines MC38 murine colon adenocarcinoma, DLD-1 human colon
adenocarcinoma, and A2780 human ovarian carcinoma, were chosen to correspond to the cell
lines used for orthotopic models of PC in Aim 3. All candidate VVs performed similarly or
better than vvDD in monolayers of colon cancer cells, MC38 and DLD-1. Select candidate
viruses had significantly lower viral spread or cytotoxicity in monolayer ovarian carcinoma cells
relative to vvDD, but all VVs were also more efficient at replicating, spreading and killing
A2780 cells (Figure 3.9 – 3.12). It should be noted that since the MTS assay used to measure
105
cell viability is based on the metabolic activity of the cells, the assay quantifies both the
cytotoxic and cytostatic effects of the candidate VVs and vvDD on the tumor cell lines.
The improved viral replication and spread may be attributed to the different gene deletions
between vvDD and our candidate VVs. Specifically, vvDD has deletions in its TK and VGF
genes, which restrict its supply of nucleotides for replication to the dNTPs made by the cell
(McCart et al., 2001). In contrast, our candidate VVs retain the ability to express TK to add to
and use the pool of nucleotides already in the infected cell, in addition to expressing the
mitogen, VGF, to prime adjacent cells to activate its MEK/ERK pathway. Though cancer cells
usually constitutively activate the MEK/ERK pathway that produces cellular dNTPs, viral TK
and VGF will confer a larger advantage in slower growing cancers. On the other hand, IFN
limits the replication and spread of VV (Luker et al., 2005). Since in each case, a VV
immunomodulatory gene that counteracts major proteins in the induction and signaling pathway
of IFN is deleted, the replication of our candidate VVs may be differentially inhibited depending
on the degree of IFN responsiveness in the cancer cell. In contrast, vvDD still expresses the
whole armamentarium of WR VV immunomodulatory genes to counteract antiviral processes.
Together, the interplay of these factors contributes to the VV replication efficacy of vvDD and
our candidate VVs.
In addition to cell lysis from the cytoplasmic accumulation of VV progeny, cell death associated
with VV is enacted by various mechanisms depending on the cell type. For example, WR VV
infection induces apoptosis in Hela G cervical carcinoma cells, but causes necrosis in BSC-40
African green monkey kidney cells (Liskova et al., 2011). This suggests that the increased
cytotoxicity of the candidate VVs seen in our experiments may be a result of both VV-mediated
death and the cellular response to infection. In particular, cells could undergo cell death to
suppress VV replication and spread. An example would be the infection of VV in keratinocytes,
where rapid necrosis is induced by a STAT3-dependent pathway, resulting in lower VV titers
and the secretion of type I IFNs and pro-inflammatory cytokines (He et al., 2014). Alternatively,
106
the infection of DCs results in apoptosis prior to the formation of viral factories (Chahroudi et
al., 2006). Similarly, some of the cell death observed in our experiments from infection with
candidate VVs could have been part of cell-intrinsic antiviral mechanisms. TLR, NFκB, and
PKR signaling can also result in cell death (Radhakrishnan and Kamalakaran, 2006; García et
al., 2007; Salaun et al., 2007). Since candidate viruses have a deletion in an immunomodulatory
protein that could inhibit a process related to the induction of pro-inflammatory cytokines and
IFN-stimulated proteins, more cells would have died by antiviral processes compared to vvDD,
which still expresses all the VV immunomodulatory proteins. The amount of death by cell-
intrinsic mechanisms, however, would be dependent on the type of mutation and the effect on
the antiviral mechanisms in the cancer cells themselves. Further, the observed increase in
replication of candidate VVs relative to vvDD suggests an increase in the amount of viral
nucleic acids that would be recognized by cytosolic PRRs such as RIG-1 and MDA-5 to activate
an antiviral response. Of note, premature cell lysis will contribute to a decreased amount of VV
virions. Hence, VV replication is also affected by these antiviral responses.
Viral spread is affected by the degree of replication and lysis, as well as the permissivity of cells
to infection. The amount of virions produced inside the cell and the subsequent release of IMV
forms of VV would contribute the most towards the amount of VV spread, as the EEV form
constitutes the minority of virions produced (Roberts and Smith, 2008).
VV replication, spread, and cytotoxicity among the cell lines used also differed. A2780 cells
were the most susceptible to candidate VVs and vvDD, followed by MC38 and DLD-1. General
characteristics of cancer cells coincide with the optimal environment for virus infection and
growth. Recognized attributes include increased cell proliferation, nucleotide and protein
synthesis and decreased antiviral responses and apoptosis (Ilkow et al., 2014). A combination of
these attributes may partially explain VV susceptibility. For example, MC38 cells were the most
aggressive and rapidly dividing cell line of the three, and that may have contributed to the
increased VV replication and cytotoxicity compared to DLD-1; however it is does not fully
107
explain A2780 cell permissivity observed herein. It is unclear what specific gene expression
pattern or combination of characteristics lends itself to resistance or susceptibility to VV
infection. Other groups have attempted to determine the factors that contribute to widespread or
limited VV infection in cancer cells. For example, an oncolytic VV, GLV-1h68, was tested in a
panel of 76 cancer cell lines, and some correlations between in vitro susceptibility and gene
expression patterns were drawn. Generally, highly permissive cells had a downregulation of
genes related to IRF3/7 signaling. Further, ovarian cancer cell lines expressing genes indicative
of the epithelial cell phenotype were more resistant to VV infection, though this trend was not
observed in other cancer types (Ascierto et al., 2011). This might partially explain the
susceptibility to VV replication, spread, and cytotoxicity of vvDD and our candidate VVs in
A2780, which is a loosely adherent cell line that demonstrates a mix of epithelial-like and
mesenchymal-like properties (Huang et al., 2013). It is important to emphasize that the
susceptibility to VV infection is a complex and multi-factorial phenomenon and the permissivity
of a cell line towards VV infection is facilitated by a combination of many attributes.
Interestingly, the ∆K1L, ∆A46R, and ∆A52R VVs consistently demonstrated superior viral
replication, cytotoxicity and viral spread, respectively, across all cancer cell lines examined,
though superiority was usually not statistically significant compared to other candidate VVs.
This suggests, for example, that the K1L gene confers the least advantage towards VV
replication within the context of MC38, DLD-1 and A2780 monolayers. Yet, the K1L gene is
more important for other aspects of VV potency, such as viral spread and tumor cytotoxicity
than A52R and A46R, respectively. When these results are interpreted with the knowledge that
cancers are not completely resistant to antiviral IFN and pro-inflammatory responses, nor
absolutely anti-apoptotic, but rather these features are enhanced compared to normal cell lines
(Haralambieva et al., 2007), the reason for these results may be various. It is likely that the
constitutive activation of NFκB in these cell lines renders the NFκB-inhibiting activity of K1L
and N1L redundant for viral replication. However, since N1L also has anti-apoptotic properties
which can prolong the time VV has to replicate (Abrahams et al., 2005), its gene deletion
negatively affects VV replication more than the deletion of K1L. On the other hand, the anti-
108
apoptotic activity of N1L reduces the amount of cell lysis and, therefore, tumor cytotoxicity and
viral spread. Likewise, the A46R and A52R genes are the most redundant VV genes in terms of
tumor cytotoxicity and viral spread, respectively, while remaining relatively more important
than K1L for VV replication. Both genes express proteins that inhibit TLR signaling, but
perhaps the abrogation of the A46R inhibition of TLR3- mediated IRF3 (Bowie et al., 2000)
results in more cell lysis despite N1L apoptotic activity, thus also leading to less viral replication
and spread than ∆K1L and ∆A52R VVs, respectively. Lastly, the activity of A52R may be
complemented by other VV immunomodulatory genes in the context our cancer cell lines,
leading to superior viral spread. Yet, its role in promoting TLR4-mediated expression of IL-10
or inhibiting NFκB through TLR signaling (Maloney et al., 2005) may have made the A52R
gene more important for VV replication and tumor cytotoxicity than K1L and A46R,
respectively.
The viral spread and cytotoxicity of our candidate VVs were also compared to vvDD in MC38
and DLD-1 tumor spheroids (Figure 3.13 – 3.16). The 3D architecture of multicellular spheroids
offers several characteristics of an in vivo tumor as a result of a shape that mimics the
physiological cell-cell contact. In contrast to monolayer cultures, only the cells on the surface of
the tumor spheroid are directly exposed to the nutrients in the growth media. Nutrients must
diffuse into the spheroid to reach cells in the inner portion of the spheroid, resulting in a gradient
of nutrient distribution, differential growth kinetics and waste metabolism in the same spheroid.
Spheroids have also been shown to be more resistant to anticancer drugs compared to monolayer
cultures, as a result of the physiological cell-cell contact that allows tight junctions and
communication. It should be noted that tumor spheroids obviously lack some aspects of an in
vivo tumor, such as vasculature and immune cell infiltration (Mehta et al., 2012)
As expected, viral spread for all candidate VVs and vvDD at the center of the spheroids was
inhibited compared to the spread observed in monolayer cultures. However, there was
widespread infection on the surface of all VV-treated spheroids. This is consistent with VV
109
spread observed within ovarian cancer spheroids (Tong et al., 2015), where the quiescence of
the cells at the center of the spheroids was attributed to the reduced spread. Similar to the results
seen in monolayer cultures, the spread of the candidate VVs to the middle of MC38 and DLD-1
spheroids was also similar, or better, compared to vvDD. The factors that governed the
differences in viral spread between candidate VVs and vvDD in monolayer cultures could also
play a part in these spheroids. ∆A52R VV had the best spread in both MC38 (Figure 3.13) and
DLD-1 (Figure 3.14) spheroids, suggesting that the A52R gene is also the most redundant gene
of our candidate genes for viral spread within spheroids. The quiescent state of the cells at the
center of the spheroids had the greatest effect on vvDD spread, which relies solely on the cell-
intrinsic pool of dNTPs for successful viral replication. Nevertheless, all viruses effectively
killed most, or all, the cells within both types of spheroids by 96 hpi, as measured by clonogenic
assays (Figure 3.16) and the change in MC38 spheroid size of VV-treated spheroids compared
to mock (Figure 3.15 A). Though the cells in the spheroids were mostly killed, the spheroid size
was larger than initial spheroid volume before infection. Further, the spheroid volume seemed to
be still decreasing past 96 hpi, suggesting more tumor killing. The larger size at 96hpi may be a
result of tumor growth that superseded viral killing during the initial stages of infection resulting
in a net growth, resulting in a larger spheroid. The eventual decrease in tumor volume at later
time points is an indicator of more virus-mediated cell killing than tumor cell proliferation. The
continued decrease in spheroid volume after 96 hpi, albeit slower, despite almost no viability
measured by the clonogenic assay, can be explained by the nature of the assay. It is possible that
there were still many infected, but viable, tumor cells in the spheroid at 96 hpi that eventually
died and led to the decreased spheroid volume at later time points. The infected cells would
have not survived to generate colonies in the clonogenic assay; the clonogenic assay only serves
to measure the clonogenic potential of tumor cells after candidate VV and vvDD infection.
The best performers from the in vitro assays, ∆K1L, ∆A46R and ∆A52R VV were used in the in
vivo investigation in Aim 3. Here, we sought to determine the tumor-selectivity and therapeutic
efficacy of these candidate VVs compared to vvDD at MTDs in syngeneic and xenograft models
of PC. In order to determine the doses for tumor survival studies, non-tumor bearing C57BL/6
110
and nude mice were injected IP with increasing doses of candidate VVs and followed for
toxicity and survival. In C57BL/6 mice, the MTD for ∆K1L VV was 5x107 pfu while the MTD
for ∆A46R VV and ∆A52R VV was 1x107 pfu (Figure 3.17 A, B). In nude mice, the MTD of all
candidate VVs was 1x106 pfu (Figure 3.17 C). Although one mouse from the ∆K1L and ∆A46R
group treated at this dose had died at 28 days (instead of after the 30 day predetermined
experimental endpoint), we continued our experiments using this dose because we speculated
the tumors in the mouse will act as a sink for viral replication and reduce the initial symptoms of
these candidate VV treatments. This was supported by the reduced weight loss in tumor-bearing
C57BL/6 mice during the first week after treatment with 5 x 107 pfu of ∆K1L VV compared to
non-tumor-bearing mice. The MTD for vvDD, as determined from the literature, for these
strains of mice is 1x109 pfu (McCart et al., 2001; Ottolino-Perry et al., 2014). The significantly
lower MTDs of our candidate VVs were not unexpected. It may be attributed to the heightened
immune response against our candidate VVs compared to vvDD. The abrogation of an
immunomodulatory gene in these viruses renders them more susceptible to the activation of pro-
inflammatory cytokines and IFNs compared to vvDD. A cytokine storm may have resulted in an
immune response that contributed more to the tissue damage and subsequent deaths than
candidate VV infection and cytotoxicity alone. However, further work to measure the pro-
inflammatory cytokines and IFN induction after infection with our candidate VVs and vvDD
must be done to confirm this speculation.
Our data confirm the biodistribution of vvDD reported in the literature (McCart et al., 2001;
Ottolino-Perry et al., 2014), wherein vvDD preferentially targeted tumor and ovaries for all 3
mouse models of PC. Similarly, the replication of candidate VVs was also the highest in the
tumors and ovaries (Figure 3.18). The VV replication in the bowel, kidney, spleen, liver, heart,
lung, brain and bone marrow was limited by comparison, especially for candidate VVs within
MC38-tumor bearing C57BL/6 immunocompetent mice. The mechanism of selective viral
replication could be partially attributed to the gene deletions. In vvDD, the TK and VGF gene
deletions will restrict replication to rapidly dividing tissues, yet vvDD expresses all VV
immunomodulatory genes to counteract antiviral mechanisms. In the candidate genes, the VV
111
immunomodulatory gene deletions abrogate the ability of VV to inhibit NFκB and TLR
activation in the host cell, allowing non-tumor cells to more effectively inhibit candidate VV
replication via innate antiviral mechanisms. The intrinsic tumor-selectivity of the parental WR
(Thorne et al., 2007; McCart et al., 2001) may also play a role in the biodistribution of these
viruses. Though its mechanism is unknown, its large size has been suggested to restrict its
extravasation to tissues with leaky vasculature, such as the ovarian follicles and tumor tissues
(Shen and Nemunaitis, 2005). It is possible that the estrous cycle, in which there are periods of
increased cell proliferation and angiogenesis in mouse ovaries (Baranda-Avila et al., 2009),
contributed to the high VV titers found in our models. Of note, comparably lower amounts of
WR VV (3646 pfu/mg) were found in the ovaries of non-human primates 6 days after systemic
administration (Naik et al., 2006), suggesting a species-specific phenomenon. Similarly, no
vvDD was found in the ovaries of these primates 6 days and 6 weeks post-treatment (Naik et al.,
2006).
Our in vivo studies evaluating therapeutic efficacy were conducted in both immunocompetent
(C57BL/6) and immunocompromised mice (NU/NU), at previously determined MTDs (Figure
3.19 – 3.20). Excitingly, treatment with candidate VVs was associated with similar or improved
survival, despite being administered at a dose 20 – 1000 times lower than the vvDD dose. In the
syngeneic model with C57BL/6 mice bearing MC38 tumors, only the ∆K1L VV treatment
offered a statistically significant improvement in median survival compared to mock (35 days
v.s. 28.5 days; p=0.0058). This is interesting because the ∆K1L VV-treated mice in the
C57BL/6 biodistribution experiment also had the least amount of virus in tumors, despite
displaying the best viral replication in vitro and replicating to comparably higher titers in tumors
implanted in nude mice. Thus, direct viral infection and oncolysis may not be the primary mode
of tumor killing for ∆K1L VV in this model. It is well recognized that OVs can trigger multiple
mechanisms against cancer (Kirn and Thorne, 2009) Likely, the ∆K1L VV may initially have
replicated well in tumors and caused immunogenic cell death to a sufficient level in tumors and
tumor stroma to prime a robust tumor- and VV- specific adaptive response against infected and
uninfected tumors. An OV-induced immune response would have explained the concurrent
lower viral load and improved therapeutic efficacy. However, more studies are required to
112
confirm this mechanism of action and explore how the deletion of ∆K1L contributed to the
mechanism of action compared to vvDD and other candidate gene deletions.
Different viruses improved survival in ovarian and colon cancer in nude mice. In short, no
viruses improved the median survival of DLD-1 tumor-bearing mice, but ∆A52R VV treatment
was associated with the highest number of mice experiencing a complete response and long term
survival (37.5%), followed by ∆A46R VV (25%) and vvDD and ∆K1L VV (12.5%). On the
other hand, ∆K1L VV treatment was the sole treatment that extended the median survival of
A2780 tumor-bearing mice compared to mock, though one mouse (12.5%) from ∆K1L, ∆A52R,
and vvDD-treated groups experienced complete responses. Intriguingly, these tumor responses
are associated with the candidate VVs at a dose 1000 times lower than the vvDD dose. It should
also be noted that some nude mice experienced treatment-related deaths or bowel obstruction
with moderate tumor load, but the endpoint for the majority of mice was related to high tumor
burden. In general, the reason for superior efficacy could be that the A52R gene and the K1L
gene are the most redundant genes in WR VV for infecting and lysing DLD-1 and A2780
tumors, respectively, in nude mice. The in vivo tumors had a 3D architecture similar to tumor
spheroids, but were much larger and some also had tumor vasculature. Most cells in areas with
low perfusion would be quiescent, thereby impeding vvDD penetration compared to candidate
VVs. In addition to the reasons proposed for efficacy against monolayer colon and ovarian
cancer cell lines, anti-tumor effects can also arise from the intact innate immunity in nude mice.
For example, neutrophils could be attracted to and obstruct tumor vasculature. Further, the cell
death induced by the candidate viruses could change the tumor microenvironment to repolarize
M2 macrophages or enhance M1 macrophages against the cancer. Since A2780 and DLD-1 are
different cell lines from different cancers, it is not surprising that different candidate VVs
exhibited different anti-tumor efficacy. As before, the potential mechanisms need to be
confirmed with further experiments.
113
4.2. Project Summary
In summary, the project described herein explored the possibility of generating safe and potent
OVs based on the defective innate immunity in cancer, specifically focusing on genes associated
with an IFN response. In Aim 1, we generated 5 recombinant VVs with deletions in VV
immunomodulatory proteins from one of the most potent and tumor-selective strains, WR VV.
In Aim 2, we tested these candidate VVs in terms of in vitro viral replication, spread and tumor
cytotoxicity in colon and ovarian cancer cell lines, comparing them to a clinical OV, vvDD.
Here, we demonstrated that the gene deletions in the VV immunomodulatory genes did not
hamper the viral potency towards tumor cells compared to vvDD. Instead, the candidate VVs
were at least comparably effective against both cell lines and tumor spheroids of colon cancer
cells. All viruses and vvDD were potent against monolayer ovarian cancer cells. We propose
that the superior efficacy of the candidate VVs was due to the redundancy of the deleted genes
in our candidate VVs in the context of colon and ovarian cancer cells, compared to the TK- and
VGF- deletions in vvDD. The best performers, ∆K1L, ∆A46R, and ∆A52R VV, were further
evaluated in Aim 3, wherein in vivo tumor-selectivity and therapeutic efficacy were assessed.
Overall, the replication of the candidate VVs was tumor-selective. Most excitingly, there was
improved therapeutic efficacy associated with the candidate VVs examined at a dose 20 times
lower in immunocompetent mice and 1000 times lower in nude mice, relative to the treatment
dose of vvDD. Herein we present promising oncolytic VVs and confirm the hypothesis that the
deletion of VV immunomodulatory genes can lead to an OV with improved therapeutic efficacy.
Future studies are needed to characterize and develop next generation viruses for clinical use.
4.3. Experimental Challenges and Limitations
4.3.1. Tumor Spheroids
As described above, tumor spheroids offer a 3D architecture to better mimic the
microenvironment found in in vivo tumors. Our objective with the confocal imaging was to
compare the ability of the candidate VVs and vvDD to spread into the spheroid. The most
difficult region to spread into, and therefore the most representative of the ability of the VVs to
114
penetrate spheroids, would be the middle of the spheroid. Hence, the images acquired from the
middle of each spheroid at a peak time point of RFP expression (72h) were used to compare the
viral spread, using RFP expression. Instead of uniformly penetrating the cells at the surface of
the spheroid, the virus infections occurred at random foci at early time points before spreading
across the surface and penetrating into the spheroid at approximately 48-72hpi. Hence, it would
have been ideal to measure viral spread throughout the whole spheroid, especially early in the
infection, albeit technically difficult. The spheroids were ~250-300 µm in diameter when they
were infected, but the upper limit for acquiring z-stacks via confocal imaging was 200µm, so
only a portion of the spheroid could be reliably imaged in thin sections. Two-photon microscopy
would have been able to visualize thicker specimens, but the low working distance of the
microscope means the spheroid formation via hanging drop method would be better suited for
this type of imaging. The hanging drop method is the spontaneous formation of spheroids
encouraged by the gravity and surface tension inside a small droplet hanging from the inside of
the lid of a tissue culture plate. However, the maintenance of these spheroids and the addition of
virus are delicate and labour-intensive protocols. Some research groups have assessed the
interior of larger spheroids by sectioning, staining and digitally reconstructing the spheroid
(Achilli et al., 2012). Since the spread of candidate VVs could still be compared at later time
points during spheroid infection using one section, we did not pursue these labour-intensive
alternatives.
Tumor response to treatment is also usually measured by monitoring tumor size over time. This
is usually achieved by measuring the diameter of the spheroid from brightfield images and
calculating tumor volume with an equation that assumes a spherical shape (Achilli et al., 2012).
Though this method worked well with MC38 spheroids, which retained a relatively spherical
shape throughout the experiment, this was not true for DLD-1 spheroids. DLD-1 spheroids were
spherical prior to infection, but upon infection by VV, the cells lose adherence and form a
loosely-held aggregate that eventually falls away from the main spheroid, leaving a crater where
the infected cells used to be attached. The resulting irregularly-shaped DLD-1 spheroids were
not amenable for calculating tumor volume using the above method. Accordingly, we used the
115
clonogenic assay to evaluate the cyototoxicity of the VVs for the spheroids and confirmed that
the cells were killed.
4.3.2. In vitro to In vivo translation
In vitro assays were used to predict possible candidate VVs that would perform the best in the in
vivo experiments in Aim 3. The best 3 candidate VVs were then tested in mouse models of
peritoneal carcinomatosis. In vitro testing is a simple, reproducible and cost-effective method to
assess the tumor potency of our candidate VVs, however these assays do not test important
elements such as the role of the immune system in the viral infection. For example, the cell
mediated-immune responses from macrophages or T-cells are absent in our in vitro assays,
highlighting the importance of assessing the candidate VVs in mouse models. Nonetheless, our
in vitro assays were critical for screening our candidate VVs as potential oncolytic viruses.
The potency of candidate VVs was extensively compared to vvDD in tumor cell monolayer
studies. We recognize that there are many factors, in addition to immune infiltrates, existing in
vivo that may positively or negatively affected candidate VV replication, spread and tumor
cytotoxicity, that are absent in monolayers. Though experiments with monolayer cultures can
evaluate virus behavior in tumor cells in a simple, reproducible environment, they do not mimic
the differential signaling and the resulting response to OVs that likely exist in the 3D
architecture of tumors. Hence, the candidate viruses were also tested in the context of tumor
spheroids. Though the spheroid model more closely mimics in vivo tumors, it was difficult to
quantify viral spread in this model. Nevertheless, it was evident that ∆A52R VV had the greatest
spread in these studies. There remains a possibility that the potential of ∆N1L or ∆K3L VV as
OVs was overlooked. These viruses could have been less affected by the tumor cell-extrinsic
obstacles to viral delivery and may have superior efficacy in vivo, but were not tested herein.
However, since ∆K1L VV, ∆A46R VV and ∆A52R VV were consistently superior in all cell
lines examined, during our best efforts to predict in vivo efficacy with in vitro assays, these were
116
the candidate VVs chosen for in vivo testing. Tumor-selectivity of our viruses was not tested in
cell cultures.
4.3.3. Mouse Models
The mouse models we used in our study were important for evaluating our VVs in an in vivo
context. Both immunocompetent (C57BL/6) and immunocompromised (NU/NU) mice provided
unique environments for extracting important information about in vivo toxicity, tumor-
selectivity and therapeutic efficacy. Immunocompetent mice have intact innate and adaptive
immune responses. Therefore the C57BL/6 mouse model provided an environment that
facilitated the multimechanistic anti-cancer effect of OVs which involves direct oncolysis,
disruption of tumor vasculature and the induction of anticancer immunity. This environment
also mirrored challenges that arise with an intact immune system, affecting viral delivery and
clearance (Kirn and Thorne, 2009). Thus, the syngeneic model may be a more clinically relevant
model. However, human cancer cell lines do not grow in immunocompetent mice, so xenograft
models are used to demonstrate the tumor response of human cancers to OV treatment. Though
nude mice lack a robust T-cell response and so viral clearance is not as effective in this model,
the vasculature and stroma provide a better model to measure the therapeutic efficacy of vvDD
and our candidate VVs against human cancers than in vitro models. Thus, both mouse models
have limitations, but can be used to foreshadow the possibility of using our candidate VVs in the
clinic. There are still differences between our mouse models and the human system; the true
feasibility of our candidate VVs as OVs requires extensive human clinical trials.
Both types of mice were important for assessing the safety of our candidate VVs. In this project,
we reported the toxicity of IP treatment with our candidate VVs in non-tumor bearing mice and
the biodistribution of VV replication in tumor-bearing immunocompetent and
immunocompromised mice. Since C57BL/6 mice have intact immune responses, these mice
were the most informative on whether the candidate VVs were toxic and the effect of the
immune response on the biodistribution of candidate VVs. Nude mice could model the toxicity
and biodistribution of the candidate VVs in the absence of an intact T-cell response.
117
Encouragingly, MTDs could be determined and candidate VVs were tumor-selective in nude
mice. However, conclusions about safety derived from mouse models should be made with
caution; there are differences in murine and human immune systems. For example, 10 TLRs
(TLR 1-10) are present in humans, while 12 are identified in mice (TLR 1-9, 11-13) (Perdiguero
and Esteban, 2009). Hence, the true safety of the candidate VVs must be assessed in clinical
trials.
4.3.4. Intraperitoneal Tumor Implantation
Our objective in the in vivo studies was to evaluate the efficacy and tumor-selectivity of our
candidate VVs compared to vvDD in PC. The tumor microenvironment is instrumental in
determining the progression and development of the tumor and its response to treatment. In one
study, renal, colon and prostate cell lines implanted at orthotopic locations were more resistant
to treatment with immunotherapy with three agonist antibodies compared to subcutaneous
implantation (Devaud et al., 2014). Further, the sensitivity of tumors to type I IFNs is influenced
by tumor location (Brunda et al., 1987). Thus, we chose to inject tumor cells IP into mice to
mimic the tumor microenvironment of PC. Though the tumor locations had some variability for
tumor types and among individual mice, tumor nodules were usually found in the peritoneum,
urogenital area, diaphragm, bowel, mesentery, omentum and the serous membrane covering the
liver, similar to human disease (Klaver et al., 2012). Further, ascites development, which is a
common symptom in human PC and one of the factors influencing tumor dissemination (Terzi
et al., 2014; Carmignani et al., 2003), was also present in our model.
Our model of PC also presents a technical challenge for measuring tumor response over time.
Whereas subcutaneous tumor size can be easily tracked with calipers, IP tumors are not visible
on the surface. Many non-invasive imaging methods have been developed to track IP tumor
burden (e.g. bioluminescence imaging, positron emission tomography, computed tomography),
but the sensitivity of these techniques are hampered by the location and size of the tumor and
118
the number of tumors disseminated in the peritoneal cavity (Rampurwala et al., 2009; Stollfuss
et al., 2015). For example, imaging by positron emission tomography can only detect 58% of
tumors between 1mm - 2mm and 88% of nodules between 2mm-4mm (Stollfuss et al., 2015),
which is approximately the size of many tumors at necropsy in our model, in addition to a few
larger 1-2 cm tumors. In bioluminescence imaging, nodules behind dense structures, like the
liver, are frequently undetected (Stollfuss et al., 2015). For these reasons, we did not feel
longitudinal monitoring of tumor burden would add useful information to our investigations and
so tumor-bearing mice were only followed for survival.
4.3.5 IFN Sensitivity in Tumors
The candidate VVs described in this project were created by gene deletions in VV proteins
associated with antagonizing the IFN induction and IFN-mediated responses. Hence, a
discussion of the immunogenicity in the tumor cells used in this project is warranted. MC38 is
poorly immunogenic. When MC38 cells were cultured in vitro with IFNα, MHC I expression
was enhanced but the immunosuppressive protein, programmed cell death 1 ligand, was also
upregulated. When MC38 cells were injected subcutaneously into C57BL/6 mice and treated
with IFN α, a strong programmed cell death 1 expression was induced in tumor-infiltrating T-
cells and the number of CD8+ T cells decreased (Terawaki et al., 2011). Further, tumor-
infiltrating macrophages of in vivo MC38 tumors drive tumor growth (Ries et al., 2014). In
contrast, DLD-1 cells are moderately responsive to IFN. Treatment of DLD-1 cells with 40
U/ml of IFNα was sufficient to confer 50% cell viability against a VSV infection challenge
compared to >5000 U/ml for completely IFN-resistant LNCap cells (Christian et al., 2012). In
vitro treatment of A2780 cells with IFNα was not able to induce antiviral mechanisms against
WR VV infection with or without a deletion in its viral IFNβ antagonist. Though A2780 was
able to produce IFNβ, it was not able to respond to it (Kirn et al., 2007). Thus, the cancer cells
that were used in this project were moderately to highly resistant to IFN induction and signaling,
providing an advantageous environment for candidate VV replication, spread, and cell-killing.
However, tumors are often made up of cells with varying degrees of sensitivity to IFN,
119
including cells that are very sensitive to IFN that could be resistant to candidate VVs. However,
as discussed in Section 1.1.4, OVs have multiple mechanisms of action aside from direct tumor
infection and lysis including vascular disruption and the induction of the adaptive immune
response. The candidate VVs may still be effective against heterogeneous tumors. Our in vivo
PC models, wherein tumor cell lines are implanted, do not fully reflect the heterogeneity of
clinical tumors. Patient-derived tumors may be more reflective of the diversity in human disease
though this model is costly and requires availability of patient samples. As the initial study
characterizing the tumor efficacy of the candidate VVs, our model was the more practical, cost-
effective, and reproducible approach. However, future work may benefit from models with
patient-derived xenografts.
4.4. Future Directions
4.4.1. Determining the Mechanisms of Action
We have demonstrated anti-tumor efficacy in our mouse models, but did not specifically
determine the mechanism(s) of action against tumors by our candidate viruses. Understanding
how infection with the candidate VVs leads to tumor-killing is crucial for designing strategies to
improve the virus in the future. Multiple mechanisms of action have been identified in oncolytic
virotherapy (Kirn and Thorne, 2009). It would be of particular interest to investigate how ∆K1L
VV effected improved median survival in the MC38 tumor-bearing C57BL/6 mice, yet had the
lowest tumor titer in the biodistribution study within the same tumor model. Thus, it is
important to determine if and how the candidate VVs disrupt tumor vasculature and induce an
anti-tumor host response, in addition to implementing direct tumor lysis. In this project, we have
already demonstrated viral replication of the candidate VVs within in vivo tumors. The extent
and dispersion of infection throughout the tumor can be further assessed histologically with VV-
specific antibodies.
120
Tumor vasculature shutdown, directly or indirectly, induced by OV infection, could have also
been a mechanism by which the candidate VVs induced tumor regression. Many studies have
been conducted to evaluate the role of the vasculature in anti-tumor efficacy of other OVs, but
whether our candidate VVs would employ this mechanism, remains to be determined. Similar
experiments can be conducted for our candidate viruses. Endothelial cells stained for CD31
would indicate whether VV staining co-localizes with the tumor vasculature (Ottolino-Perry et
al., 2014). Tumor perfusion studies should be performed by IV injection of fluorescent
microspheres into tumor-bearing mice before euthanization (Breitbach et al., 2011b). To assess
the role of neutrophil occlusion and clot formation in candidate VV efficacy, neutrophil
depletion, or the inhibition of clot formation with heparin, could be conducted to determine
whether efficacy is affected (Breitbach et al., 2007).
As mentioned, induction of an immune response is also a possible mechanism of action for
candidate VVs. Many OVs have been shown to induce immunogenic cell death that leads to a
host anti-cancer immune response (Guo et al., 2014). Studies have evaluated the induction of an
anti-tumor response in various ways such as re-challenge experiments in immunocompetent
mice that had complete responses (Kirn et al., 2007). Alternatively, Lemay et al. conducted an
adoptive cell transfer into naive mice from donor CT26-tumor bearing mice that had complete
responses from a VSV-infected cell vaccine treatment. CT26 and 4TI tumors were injected into
different flanks of the recipient naive mice and monitored for tumor growth, thereby measuring
tumor-specific responses from the treatment (Lemay et al., 2012). Similar experiments with the
candidate VVs would also determine whether a host immune response against cancer was
induced from VV treatment. Then, it would be interesting to investigate how the different
candidate VVs induced the host response. Immunohistochemistry of tumors from virus-treated
mice might reveal the types of immune cell infiltrates in the tumor, as a result of infection. In a
different experiment, conditioned media from infected monolayers of tumor cells could be used
to investigate how different lymphocytes would have been affected by the mixture of cytokines
secreted into the medium by the infected tumor cells. There might be a difference in effects on
the immune response associated with different candidate VVs, which could be useful
121
information for selecting patients or designing therapy regimens. Overall, understanding the
mechanisms of action of our candidate VVs will be vital for designing the optimal treatment for
cancer patients and how to improve the candidate VVs.
4.4.2. Potential Treatment for Other Cancer Types
Though our project tested our candidate VVs in the context of colon and ovarian PC, many
other cancers have also accumulated defects in the innate antiviral immune response to
potentiate high viral replication, spread and cytotoxicity, relative to normal cells. Thus, the
rationale used to generate our panel of VVs is also applicable to other types of cancers. Within
the NCI-60 panel of cancer cell lines, several cancers were unresponsive to IFNα or IFNβ.
These malignancies included leukemia, non-small cell lung carcinoma, colon cancer, central
nervous system malignancy, melanoma, ovarian cancer, renal carcinoma, prostate cancer and
breast cancer (Stojdl et al., 2003). Further, VV has a broad tumor tropism (McFadden, 2005),
potentiating OV treatment with VV in several cancers. Thus, the therapeutic efficacy of
oncolytic VVs, such as vvDD, has been tested in several tumor types pre-clinically, some of
which include gliomas (Lun et al., 2009), renal cancer (Guse et al., 2010), peritoneal
mesothelioma (Acuna et al., 2014), breast cancer and melanoma (MacTavish et al., 2010).
Similarly, our candidate VVs can also be retested in the context of several malignancies.
4.4.3. Improving VV Delivery
It is possible to deliver OVs intratumorally, but intravenous delivery is more ideal for metastatic
cancers, in order to reach tumor nodules that cannot be directly injected, due to location, or to
eliminate undetected tumors. One of the major barriers to successful OV therapy is delivery to
the tumor. Widespread and dispersed infection of tumors is critical for complete responses (Le
Bœuf et al., 2013; Wein et al., 2003). When delivered systemically, OVs can be neutralized by
serum factors, or sequestered by the liver or spleen, before reaching and infecting the tumors.
This, too, will be a major issue for the candidate VVs which will usually be in IMV form, with
122
many antigenic proteins on its surface. The varying characteristics of the dispersed tumors found
in metastastic cancer (e.g. size, vascularization, immune infiltrates) also lead to differing
degrees of infection in each tumor mass (Ottolino-Perry et al., 2014).
Currently, different studies employ different strategies to shield the viruses, using cell-carriers
or coating the viruses with a polymer to improve delivery. Carrier cells are usually chosen for
their tumor-homing properties. Immune cells (cytokine-induced killer cells (Thorne, 2006), T-
cells (Ong et al., 2007), macrophages (Muthana et al., 2013), myeloid-derived suppressor cells
(Eisenstein et al., 2013) and mesenchymal stem cells (Komarova, 2006)) and cancer cells
(Power et al., 2007), are among the cell types being explored as possible cell carriers.
Biocompatible polymers, polyethylene glycol and N-[2-hydroxypropyl] methylacrylamide, have
been conjugated to adenoviruses to evade neutralization. Adenovirus coated with these polymers
was cleared 3.5 to 4 times slower than uncoated viral particles (Alemany et al., 2000; Green et
al., 2004). Overall, these shielding strategies have led to a longer lifespan in the bloodstream
and improved viral delivery to tumors. Therefore, it may be beneficial to combine our candidate
VVs with these masking strategies.
4.4.4. Combination Therapy
There is potential in testing our candidate VVs in combination with chemotherapy, radiotherapy,
immunotherapy, or surgery. Using the example of PC, there are many patients who are not
eligible for CRS with HIPEC due to tumor burden. The candidate VVs could be used for tumor
debulking that would then render these patients eligible for surgery. Alternatively, these VVs
could be administered IP along with chemotherapy, for a synergistic effect. However, these
possibilities require further investigation. The possibility of combining virotherapy with other
anti-cancer modalities has been investigated in several pre-clinical and clinical settings. Our
group demonstrated that vvDD can synergize with the chemotherapy drug, irinotecan (Ottolino-
Perry et al., 2015), and be used for peptide-receptor radiation therapy to improve survival from
CRC PC (unpublished data). There is also the possibility of arming the viruses with
immunomodulatory proteins such as GM-CSF. The herpes virus, T-Vec, and Wyeth strain VV,
123
JX-594, which express GM-CSF, have been shown to improve survival in many pre-clinical and
clinical investigations (discussed in Section 1.1.6). As our understanding of the mechanisms of
action of the candidate VVs begin to be delineated, it will be interesting to combine various
types of cancer treatment with these candidate VVs.
4.4.5. Deletion of Other VV Immunomodulatory Genes
In this project, we have evaluated the effect of deleting five VV immunomodulatory genes and
demonstrated that this strategy is a viable option for generating OVs. This strategy can be
pursued further. VV expresses several other proteins that can potentially be deleted to generate
other novel oncolytic VVs. There are many VV proteins that directly affect IFN induction and
IFN signaling pathways that have not been exploited. For example, K7L, F1L, H1L are
examples of VV immunomodulatory genes (Perdiguero and Esteban, 2009) that have yet to be
tested in the context of oncolytic virotherapy. Target genes do not necessarily have to be
involved in directly inhibiting proteins involved in the IFN system. The deletion of the D10R
VV gene is also a promising strategy. The D10 protein is expressed after DNA replication and
removes the 5‘ cap in VV mRNAs, expediting the degradation of these viral nucleotides and
reducing chances of viral RNA recognition by PRRs. Its deletion was associated with decreased
replication in normal tissues after IP injection into Balb/c mice (Liu et al., 2014). On the other
hand, it would also be interesting to evaluate VVs with a combination of gene deletions. The
deletions may work synergistically to generate an even safer virus, while retaining potency,
similar to how the combination of a TK and VGF deletion resulted in a more tumor-selective
virus, vvDD, relative to the TK- and VGF- viruses (McCart et al., 2001).
124
4.5. Final Remarks
Oncolytic virotherapy is a promising and rapidly developing anti-cancer treatment. Its multi-
mechanistic attack against cancer and broad tumor tropism make oncolytic VVs an appealing
option. As our understanding of cancer, the immune system and virology advance, new
strategies will arise to develop and fine tune oncolytic viruses to treat several malignancies. In
this project, we have combined the current knowledge of cancer immunology with the
understanding of VV immunomodulatory proteins, to design a panel of promising oncolytic
VVs. Concurrently, we have shown, as other research groups have, that exploiting the cancer
defects in antiviral immunity is a viable strategy for engineering a mechanism of tumor-
specificity for VV. More importantly, we have shown that this strategy can yield OVs with
similar or improved therapeutic efficacy than the current oncolytic VV, vvDD. As a result, we
have generated promising oncolytic VVs that have potential to be used in the clinic.
125
References
Abrahams, Melissa Rose, Zhouning Zhang, Sufan Chien, Tim Skerns, and Girish J Kotwal.
2005. ―The Vaccinia Virus N1L ORF May Encode a Multifunctional Protein Possibly
Targeting Different Kinases, One of Which Influences ATP Levels in Vivo.‖ Annals of the
New York Academy of Sciences 1056 (1): 87–99. doi:10.1196/annals.1352.006.
Achilli, Toni-marie, Julia Meyer, and Jeffrey R Morgan. 2012. ―Advances in the Formation, Use
and Understanding of Multi-Cellular Spheroids.‖ Expert Opinion on Biological Therapy 12
(10): 1347–60. doi:10.1517/14712598.2012.707181.
Acuna, Sergio A, Kathryn Ottolino-Perry, Besmira Çako, Nan Tang, Fernando A Angarita, and
J Andrea McCart. 2014. ―Oncolytic Vaccinia Virus as an Adjuvant Treatment to
Cytoreductive Surgery for Malignant Peritoneal Mesothelioma.‖ Annals of Surgical
Oncology 21 (7): 2259–66. doi:10.1245/s10434-014-3651-4.
Akhtar, Jihan, and Deepak Shukla. 2009. ―Viral Entry Mechanisms: Cellular and Viral
Mediators of Herpes Simplex Virus Entry.‖ FEBS Journal 276 (24): 7228–36.
doi:10.1111/j.1742-4658.2009.07402.x.
Albarnaz, Jonas D., Geoffrey L. Smith, Alice A. Torres, and Cláudio A. Bonjardim. 2016.
―Multiple Bcl-2 Family Immunomodulators from Vaccinia Virus Regulate MAPK/AP-1
Activation.‖ Journal of General Virology, June. doi:10.1099/jgv.0.000525.
Alberts, David S., P.Y. Liu, Edward V. Hannigan, Robert O‘Toole, Stephen D. Williams, James
A. Young, Ernest W. Franklin, Daniel L. Clarke-Pearson, Vinay K. Malviya, Brent
DuBeshter, Mark D. Adelson, and William J. Hoskins. 1996. ―Intraperitoneal Cisplatin
plus Intravenous Cyclophosphamide versus Intravenous Cisplatin plus Intravenous
Cyclophosphamide for Stage III Ovarian Cancer.‖ New England Journal of Medicine 335
(26): 1950–55. doi:10.1056/NEJM199612263352603.
Alemany, Ramon, David T. Curiel, and Kaori Suzuki. 2000. ―Blood Clearance Rates of
Adenovirus Type 5 in Mice.‖ Journal of General Virology 81 (11): 2605–9.
doi:10.1099/0022-1317-81-11-2605.
Anderson, B. D. 2004. ―High CD46 Receptor Density Determines Preferential Killing of Tumor
Cells by Oncolytic Measles Virus.‖ Cancer Research 64 (14): 4919–26. doi:10.1158/0008-
5472.CAN-04-0884.
Andtbacka, Robert H I, Howard L. Kaufman, Frances Collichio, Thomas Amatruda, Neil
Senzer, Jason Chesney, Keith A. Delman, et al. 2015. ―Talimogene Laherparepvec
Improves Durable Response Rate in Patients with Advanced Melanoma.‖ Journal of
Clinical Oncology 33 (25): 2780–88. doi:10.1200/JCO.2014.58.3377.
126
Angarita, Fernando A., Sergio A. Acuna, Kathryn Ottolino-Perry, Siham Zerhouni, and J.
Andrea McCart. 2013. ―Mounting a Strategic Offense: Fighting Tumor Vasculature with
Oncolytic Viruses.‖ Trends in Molecular Medicine 19 (6). Elsevier Ltd: 378–92.
doi:10.1016/j.molmed.2013.02.008.
Antonio Chiocca, E. 2002. ―Oncolytic Viruses.‖ Nature Reviews Cancer 2 (12): 938–50.
doi:10.1038/nrc948.
Aoyagi, Mika, Dayong Zhai, Chaofang Jin, Alexander E Aleshin, Boguslaw Stec, John C Reed,
and Robert C Liddington. 2007. ―Vaccinia Virus N1L Protein Resembles a B Cell
Lymphoma-2 (Bcl-2) Family Protein.‖ Protein Science : A Publication of the Protein
Society 16 (1): 118–24. doi:10.1110/ps.062454707.
Armstrong, Deborah K., Brian Bundy, Lari Wenzel, Helen Q. Huang, Rebecca Baergen,
Shashikant Lele, Larry J. Copeland, Joan L. Walker, and Robert A. Burger. 2006.
―Intraperitoneal Cisplatin and Paclitaxel in Ovarian Cancer.‖ New England Journal of
Medicine 354 (1): 34–43. doi:10.1056/NEJMoa052985.
Ascierto, Maria Libera, Andrea Worschech, Zhiya Yu, Sharon Adams, Jennifer Reinboth,
Nanhai G Chen, Zoltan Pos, Rahul Roychoudhuri, Giovanni Di Pasquale, Davide
Bedognetti, Lorenzo Uccellini, Fabio Rossano, Paolo a Ascierto, David F Stroncek,
Nicholas P Restifo, Ena Wang, Aladar a Szalay, and Francesco M Marincola. 2011.
―Permissivity of the NCI-60 Cancer Cell Lines to Oncolytic Vaccinia Virus GLV-1h68.‖
BMC Cancer 11 (1). BioMed Central Ltd: 451. doi:10.1186/1471-2407-11-451.
Baranda-Avila, Noemi, C. Adriana Mendoza-Rodríguez, Sumiko Morimoto, Elizabeth Langley,
and Marco Cerbón. 2009. ―Molecular Mechanism of Cell Proliferation in Rodent Uterus
during the Estrous Cycle.‖ The Journal of Steroid Biochemistry and Molecular Biology 113
(3-5): 259–68. doi:10.1016/j.jsbmb.2009.01.008.
Bartlett, David L, Zuqiang Liu, Magesh Sathaiah, Roshni Ravindranathan, Zongbi Guo, Yukai
He, and Zong Sheng Guo. 2013. ―Oncolytic Viruses as Therapeutic Cancer Vaccines.‖
Molecular Cancer 12 (1): 103. doi:10.1186/1476-4598-12-103.
Bartlett, Nathan, Julian a Symons, David C Tscharke, and Geoffrey L Smith. 2002. ―The
Vaccinia Virus N1L Protein Is an Intracellular Homodimer That Promotes Virulence.‖ The
Journal of General Virology 83 (Pt 8): 1965–76. doi:10.1099/0022-1317-83-8-1965.
Basseres, D. S., A. Ebbs, E. Levantini, and A. S. Baldwin. 2010. ―Requirement of the NF- B
Subunit p65/RelA for K-Ras-Induced Lung Tumorigenesis.‖ Cancer Research 70 (9):
3537–46. doi:10.1158/0008-5472.CAN-09-4290.
Belongia, Edward A, and Allison L Naleway. 2003. ―Smallpox Vaccine: The Good, the Bad,
and the Ugly.‖ Clinical Medicine & Research 1 (2): 87–92.
127
Belyakov, I. M., P. Earl, A. Dzutsev, V. A. Kuznetsov, M. Lemon, L. S. Wyatt, J. T. Snyder, J.
D. Ahlers, G. Franchini, B. Moss, and J. A. Berzofsky. 2003. ―Shared Modes of Protection
against Poxvirus Infection by Attenuated and Conventional Smallpox Vaccine Viruses.‖
Proceedings of the National Academy of Sciences 100 (16): 9458–63.
doi:10.1073/pnas.1233578100.
Bengali, Zain, Alan C. Townsley, and Bernard Moss. 2009. ―Vaccinia Virus Strain Differences
in Cell Attachment and Entry.‖ Virology 389 (1-2). Elsevier B.V.: 132–40.
doi:10.1016/j.virol.2009.04.012.
Ben-Neriah, Yinon, and Michael Karin. 2011. ―Inflammation Meets Cancer, with NF-κB as the
Matchmaker.‖ Nature Immunology 12 (8): 715–23. doi:10.1038/ni.2060.
Bischoff, J R, D H Kirn, a Williams, C Heise, S Horn, M Muna, L Ng, J a Nye, a Sampson-
Johannes, a Fattaey, and F McCormick. 1996. ―An Adenovirus Mutant That Replicates
Selectively in p53-Deficient Human Tumor Cells.‖ Science (New York, N.Y.) 274 (5286):
373–76.
Black, Margaret E., and Dennis E. Hruby. 1991. ―Structure and Function of Vaccinia Virus
Thymidine Kinase: Biomedical Relevance and Implications for Antiviral Drug Design.‖
Reviews in Medical Virology 1 (4): 235–45. doi:10.1002/rmv.1980010407.
Bœuf, Fabrice Le, Cory Batenchuk, Markus Vähä-Koskela, Sophie Breton, Dominic Roy,
Chantal Lemay, Julie Cox, Hesham Abdelbary, Theresa Falls, Girija Waghray, Harold
Atkins, David Stojdl, Jean-Simon Diallo, Mads Kærn, and John C Bell. 2013. ―Model-
Based Rational Design of an Oncolytic Virus with Improved Therapeutic Potential.‖
Nature Communications 4 (May): 1974. doi:10.1038/ncomms2974.
Bonnet, M C, R Weil, E Dam, A G Hovanessian, and E F Meurs. 2000. ―PKR Stimulates NF-
kappaB Irrespective of Its Kinase Function by Interacting with the IkappaB Kinase
Complex.‖ Molecular and Cellular Biology 20 (13). UNITED STATES: 4532–42.
Bowie, a, E Kiss-Toth, J a Symons, G L Smith, S K Dower, and L a O‘Neill. 2000. ―A46R and
A52R from Vaccinia Virus Are Antagonists of Host IL-1 and Toll-like Receptor
Signaling.‖ Proceedings of the National Academy of Sciences of the United States of
America 97: 10162–67. doi:10.1073/pnas.160027697.
Breitbach, Caroline, John C. Bell, Tae-Ho Hwang, David Kirn, and James Burke. 2015. ―The
Emerging Therapeutic Potential of the Oncolytic Immunotherapeutic Pexa-Vec (JX-594).‖
Oncolytic Virotherapy Volume 4: 25. doi:10.2147/OV.S59640.
Breitbach, Caroline J, James Burke, Derek Jonker, Joe Stephenson, Andrew R Haas, Laura Q M
Chow, Jorge Nieva, et al. 2011a. ―Intravenous Delivery of a Multi-Mechanistic Cancer-
Targeted Oncolytic Poxvirus in Humans.‖ Nature 477 (7362). Nature Publishing Group:
99–102. doi:10.1038/nature10358.
128
Breitbach, Caroline J, Jennifer M Paterson, Chantal G Lemay, Theresa J Falls, Allison McGuire,
Kelley A Parato, David F Stojdl, Manijeh Daneshmand, Kelly Speth, David Kirn, J Andrea
McCart, Harold Atkins, and John C Bell. 2007. ―Targeted Inflammation During Oncolytic
Virus Therapy Severely Compromises Tumor Blood Flow.‖ Molecular Therapy 15 (9):
1686–93. doi:10.1038/sj.mt.6300215.
Breitbach, Caroline J, Naomi S De Silva, Theresa J Falls, Usaf Aladl, Laura Evgin, Jennifer
Paterson, Yang Yang Sun, Dominic G Roy, Julia L Rintoul, Manijeh Daneshmand, Kelley
Parato, Marianne M Stanford, Brian D Lichty, Aaron Fenster, David Kirn, Harold Atkins,
and John C Bell. 2011b. ―Targeting Tumor Vasculature with an Oncolytic Virus.‖
Molecular Therapy : The Journal of the American Society of Gene Therapy 19 (5). Nature
Publishing Group: 886–94. doi:10.1038/mt.2011.26.
Breitbach, Caroline J., Rozanne Arulanandam, Naomi De Silva, Steve H. Thorne, Richard Patt,
Manijeh Daneshmand, An Moon, Carolina Ilkow, James Burke, Tae-Ho Hwang, Jeong
Heo, Mo Cho, Hannah Chen, Fernando A. Angarita, Christina L. Addison, Judith Andrea
McCart, John C. Bell, and David H. Kirn. 2013. ―Oncolytic Vaccinia Virus Disrupts
Tumor-Associated Vasculature in Humans.‖ Cancer Research 73 (4): 1265–75.
doi:10.1158/0008-5472.CAN-12-2687.
Broyles, Steven S. 2003. ―Vaccinia Virus Transcription.‖ Journal of General Virology 84 (9):
2293–2303. doi:10.1099/vir.0.18942-0.
Brunda, M J, V Sulich, and D Bellantoni. 1987. ―The Anti-Tumor Effect of Recombinant
Interferon Alpha or Gamma Is Influenced by Tumor Location.‖ International Journal of
Cancer 40 (6). UNITED STATES: 807–10.
Bucheit, A, Shaji Kumar, Deanna M. Grote, Yukang Lin, Veronika von Messling, Robert B.
Cattaneo, and Adele K. Fielding. 2003. ―An Oncolytic Measles Virus Engineered to Enter
Cells through the CD20 Antigen.‖ Molecular Therapy 7 (1): 62–72. doi:10.1016/S1525-
0016(02)00033-3.
Buijs, Pascal R A, Judith H E Verhagen, Casper H J van Eijck, and Bernadette G. van den
Hoogen. 2015. ―Oncolytic Viruses: From Bench to Bedside with a Focus on Safety.‖
Human Vaccines and Immunotherapeutics 11 (7): 1573–84.
doi:10.1080/21645515.2015.1037058.
Buller, R M L, S Chakrabarti, J A Cooper, D R Twardzik, and B Moss. 1988a. ―Deletion of the
Vaccinia Virus Growth Factor Gene Reduces Virus Virulence.‖ Journal of Virology 62 (3):
866–74. http://jvi.asm.org/content/62/3/866.short.
Buller, R M, G L Smith, K Cremer, A L Notkins, and B Moss. 1985. ―Decreased Virulence of
Recombinant Vaccinia Virus Expression Vectors Is Associated with a Thymidine Kinase-
Negative Phenotype.‖ Nature 317 (6040). England: 813–15.
129
Buller, R. Mark L, Sekhar Chakrabarti, Bernard Moss, and Torgny Fredricksont. 1988b. ―Cell
Proliferative Response to Vaccinia Virus Is Mediated by VGF.‖ Virology 164 (1): 182–92.
doi:10.1016/0042-6822(88)90635-6.
Burke, James M., Donald L. Lamm, Maxwell V. Meng, John J. Nemunaitis, Joseph J.
Stephenson, James C. Arseneau, Junko Aimi, Seth Lerner, Alex W. Yeung, Troy Kazarian,
Daniel J. Maslyar, and James M. McKiernan. 2012. ―A First in Human Phase 1 Study of
CG0070, a GM-CSF Expressing Oncolytic Adenovirus, for the Treatment of Nonmuscle
Invasive Bladder Cancer.‖ Journal of Urology 188 (6). Elsevier Inc.: 2391–97.
doi:10.1016/j.juro.2012.07.097.
Canadian Cancer Society's Advisory Committee on Cancer Statistics. Canadian Cancer
Statistics 2015. Toronto, Ontario: Canadian Cancer Society; 2015.
Carmignani, C Pablo, Tessa A Sugarbaker, Christina M Bromley, and Paul H Sugarbaker. 2003.
―Intraperitoneal Cancer Dissemination: Mechanisms of the Patterns of Spread.‖ Cancer
Metastasis Reviews 22 (4). United States: 465–72.
Carter, Gemma C., Masun Law, Michael Hollinshead, and Geoffrey L. Smith. 2005. ―Entry of
the Vaccinia Virus Intracellular Mature Virion and Its Interactions with
Glycosaminoglycans.‖ Journal of General Virology 86 (5): 1279–90.
doi:10.1099/vir.0.80831-0.
Carter, Gemma C., Gaener Rodger, Brendan J. Murphy, Mansun Law, Oliver Krauss, Michael
Hollinshead, and Geoffrey L. Smith. 2003. ―Vaccinia Virus Cores Are Transported on
Microtubules.‖ Journal of General Virology 84 (9): 2443–58. doi:10.1099/vir.0.19271-0.
Carty, Michael, Rory Goodbody, Martina Schröder, Julianne Stack, Paul N Moynagh, and
Andrew G Bowie. 2006. ―The Human Adaptor SARM Negatively Regulates Adaptor
Protein TRIF–dependent Toll-like Receptor Signaling.‖ Nature Immunology 7 (10): 1074–
81. doi:10.1038/ni1382.
Casagrande, Naike, Marta Celegato, Cinzia Borghese, Maurizio Mongiat, Alfonso Colombatti,
and Donatella Aldinucci. 2014. ―Preclinical Activity of the Liposomal Cisplatin Lipoplatin
in Ovarian Cancer.‖ Clinical Cancer Research 20 (21): 5496–5506. doi:10.1158/1078-
0432.CCR-14-0713.
Cattaneo, Roberto, Tanner Miest, Elena V Shashkova, and Michael A Barry. 2008.
―Reprogrammed Viruses as Cancer Therapeutics: Targeted, Armed and Shielded.‖ Nature
Reviews. Microbiology. doi:10.1038/nrmicro1927.
Chahroudi, Ann, David A Garber, Patrick Reeves, Luzheng Liu, Daniel Kalman, and Mark B
Feinberg. 2006. ―Differences and Similarities in Viral Life Cycle Progression and Host
Cell Physiology after Infection of Human Dendritic Cells with Modified Vaccinia Virus
Ankara and Vaccinia Virus.‖ Journal of Virology 80 (17): 8469–81.
doi:10.1128/JVI.02749-05.
130
Chen, F. E., S. Kempiak, D.-B. Huang, C. Phelps, and G. Ghosh. 1999. ―Construction,
Expression, Purification and Functional Analysis of Recombinant NF B p50/p65
Heterodimer.‖ Protein Engineering Design and Selection 12 (5): 423–28.
doi:10.1093/protein/12.5.423.
Chen, Lin-Feng, and Warner C. Greene. 2004. ―Shaping the Nuclear Action of NF-κB.‖ Nature
Reviews Molecular Cell Biology 5 (5): 392–401. doi:10.1038/nrm1368.
Chen, Ron A.-J., Grigory Ryzhakov, Samantha Cooray, Felix Randow, and Geoffrey L. Smith.
2008. ―Inhibition of IκB Kinase by Vaccinia Virus Virulence Factor B14.‖ PLoS
Pathogens 4 (2): e22. doi:10.1371/journal.ppat.0040022.
Chen, Wenshu, Zi Li, Lang Bai, and Yong Lin. 2011. ―NF-kappaB, a Mediator for Lung
Carcinogenesis and a Target for Lung Cancer Prevention and Therapy.‖ Frontiers in
Bioscience : A Journal and Virtual Library.
Chiocca, E Antonio, and Samuel D Rabkin. 2014. ―Oncolytic Viruses and Their Application to
Cancer Immunotherapy.‖ Cancer Immunology Research 2 (4): 295–300. doi:10.1158/2326-
6066.CIR-14-0015.
Chiu, Wen-Ling, Chi-Long Lin, Min-Hsiang Yang, Der-Lii M Tzou, and Wen Chang. 2007.
―Vaccinia Virus 4c (A26L) Protein on Intracellular Mature Virus Binds to the Extracellular
Cellular Matrix Laminin.‖ Journal of Virology 81 (5): 2149–57. doi:10.1128/JVI.02302-
06.
Christian, Sherri L., Dong Zu, Maria Licursi, Yumiko Komatsu, Theerawat Pongnopparat,
Dianne A. Codner, and Kensuke Hirasawa. 2012. ―Suppression of IFN-Induced
Transcription Underlies IFN Defects Generated by Activated Ras/MEK in Human Cancer
Cells.‖ Edited by Elankumaran Subbiah. PLoS ONE 7 (9): e44267.
doi:10.1371/journal.pone.0044267.
Chu, D Z, N P Lang, C Thompson, P K Osteen, and K C Westbrook. 1989. ―Peritoneal
Carcinomatosis in Nongynecologic Malignancy. A Prospective Study of Prognostic
Factors.‖ Cancer 63 (2). UNITED STATES: 364–67.
Chung, C S, J C Hsiao, Y S Chang, and W Chang. 1998. ―A27L Protein Mediates Vaccinia
Virus Interaction with Cell Surface Heparan Sulfate.‖ Journal of Virology 72 (2): 1577–85.
doi:10.1128/JVI.75.16.7517-7527.2001.
Chung, R Y, Y Saeki, and E a Chiocca. 1999. ―B-Myb Promoter Retargeting of Herpes Simplex
Virus gamma34.5 Gene-Mediated Virulence toward Tumor and Cycling Cells.‖ Journal of
Virology 73 (9): 7556–64.
131
Coccolini, Federico, Federico Gheza, Marco Lotti, Salvatore Virz??, Domenico Iusco, Claudio
Ghermandi, Rita Melotti, Gianluca Baiocchi, Stefano Maria Giulini, Luca Ansaloni, and
Fausto Catena. 2013. ―Peritoneal Carcinomatosis.‖ World Journal of Gastroenterology 19
(41): 6979–94. doi:10.3748/wjg.v19.i41.6979.
Comins, Charles, James Spicer, Andrew Protheroe, Victoria Roulstone, Katie Twigger,
Christine M White, Richard Vile, Alan Melcher, Matt C Coffey, Karl L Mettinger, Gerard
Nuovo, David E Cohn, Mitch Phelps, Kevin J Harrington, and H. S. Pandha. 2010. ―REO-
10: A Phase I Study of Intravenous Reovirus and Docetaxel in Patients with Advanced
Cancer.‖ Clinical Cancer Research 16 (22): 5564–72. doi:10.1158/1078-0432.CCR-10-
1233.
Cottingham, Matthew G., Rikke F. Andersen, Alexandra J. Spencer, Saroj Saurya, Julie Furze,
Adrian V S Hill, and Sarah C. Gilbert. 2008. ―Recombination-Mediated Genetic
Engineering of a Bacterial Artificial Chromosome Clone of Modified Vaccinia Virus
Ankara (MVA).‖ PLoS ONE 3 (2). doi:10.1371/journal.pone.0001638.
Cripe, Timothy P, Minhtran C Ngo, James I Geller, Chrystal U Louis, Mark A Currier, John M
Racadio, Alexander J Towbin, Cliona M Rooney, Adina Pelusio, Anne Moon, Tae-Ho
Hwang, James M Burke, John C Bell, David H Kirn, and Caroline J Breitbach. 2014.
―Phase 1 Study of Intratumoral Pexa-Vec (JX-594), an Oncolytic and Immunotherapeutic
Vaccinia Virus, in Pediatric Cancer Patients.‖ Molecular Therapy 23 (3): 602–8.
doi:10.1038/mt.2014.243.
Critchley-Thorne, Rebecca J, Diana L Simons, Ning Yan, Andrea K Miyahira, Frederick M
Dirbas, Denise L Johnson, Susan M Swetter, Robert W Carlson, George A Fisher, Albert
Koong, Susan Holmes, and Peter P Lee. 2009. ―Impaired Interferon Signaling Is a
Common Immune Defect in Human Cancer.‖ Proceedings of the National Academy of
Sciences of the United States of America 106 (22): 9010–15.
doi:10.1073/pnas.0901329106.
Crouse, Josh, Ulrich Kalinke, and Annette Oxenius. 2015. ―Regulation of Antiviral T Cell
Responses by Type I Interferons.‖ Nature Reviews Immunology 15 (4). Nature Publishing
Group: 231–42. doi:10.1038/nri3806.
Cuddihy, Andrew R, Andrew Hoi-Tao Wong, Nancy Wai Ning Tam, Suiyang Li, and Antonis E
Koromilas. 1999. ―The Double-Stranded RNA Activated Protein Kinase PKR Physically
Associates with the Tumor Suppressor p53 Protein and Phosphorylates Human p53 on
Serine 392 in Vitro.‖ Oncogene 18 (17): 2690–2702. doi:10.1038/sj.onc.1202620.
Damon, I. 2013. ―Fields Virology, 6th Edition.‖ In Fields Virology, edited by David M Knipe
and Peter M Howley, 6th ed., 2:2161–84. Knipe, Fields Virology. Philadelphia: Lippincott
Williams & Wilkins. doi:10.1093/cid/ciu346.
132
Dar, Arvin C, and Frank Sicheri. 2002. ―X-Ray Crystal Structure and Functional Analysis of
Vaccinia Virus K3L Reveals Molecular Determinants for PKR Subversion and Substrate
Recognition.‖ Molecular Cell 10 (2). United States: 295–305.
Delaloye, Julie, Thierry Roger, Quynh Giao Steiner-Tardivel, Didier Le Roy, Marlies Knaup
Reymond, Shizuo Akira, Virginie Petrilli, Carmen E. Gomez, Beatriz Perdiguero, J??rg
Tschopp, Giuseppe Pantaleo, Mariano Esteban, and Thierry Calandra. 2009. ―Innate
Immune Sensing of Modified Vaccinia Virus Ankara (MVA) Is Mediated by TLR2-TLR6,
MDA-5 and the NALP3 Inflammasome.‖ PLoS Pathogens 5 (6).
doi:10.1371/journal.ppat.1000480.
Delgado André, Nayara, and Fernando L. De Lucca. 2007. ―Knockdown of PKR Expression by
RNAi Reduces Pulmonary Metastatic Potential of B16-F10 Melanoma Cells in Mice:
Possible Role of NF-κB.‖ Cancer Letters 258 (1): 118–25.
doi:10.1016/j.canlet.2007.08.021.
Devaud, Christel, Jennifer A Westwood, Liza B John, Jacqueline K Flynn, Sophie Paquet-
Fifield, Connie PM Duong, Carmen SM Yong, Hollie J Pegram, Steven A Stacker, Marc G
Achen, Trina J Stewart, Linda A Snyder, Michele WL Teng, Mark J Smyth, Phillip K
Darcy, and Michael H Kershaw. 2014. ―Tissues in Different Anatomical Sites Can Sculpt
and Vary the Tumor Microenvironment to Affect Responses to Therapy.‖ Molecular
Therapy 22 (1): 18–27. doi:10.1038/mt.2013.219.
Deweese, Theodore L, Henk Van Der Poel, Shidong Li, Bahar Mikhak, Renee Drew, Marti
Goemann, Ulrike Hamper, et al. 2001. ―A Phase I Trial of CV706 , a Replication-
Competent , PSA Selective Oncolytic Adenovirus , for the Treatment of Locally Recurrent
Prostate Cancer Following Radiation Therapy 1.‖ Cancer Research 61: 7464–72.
DiPerna, Gary, Julianne Stack, Andrew G. Bowie, Annemarie Boyd, Girish Kotwal, Zhouning
Zhang, Sheila Arvikar, Eicke Latz, Katherine a. Fitzgerald, and William L. Marshall. 2004.
―Poxvirus Protein N1L Targets the I-κB Kinase Complex, Inhibits Signaling to NF-κB by
the Tumor Necrosis Factor Superfamily of Receptors, and Inhibits NF-κB and IRF3
Signaling by Toll-like Receptors.‖ Journal of Biological Chemistry 279 (35): 36570–78.
doi:10.1074/jbc.M400567200.
Dix, B. R., S. J. Edwards, and A. W. Braithwaite. 2001. ―Does the Antitumor Adenovirus
ONYX-015/dl1520 Selectively Target Cells Defective in the p53 Pathway?‖ Journal of
Virology 75 (12): 5443–47. doi:10.1128/JVI.75.12.5443-5447.2001.
Dock, George. 1904. ―The Influence of Complicating Diseases Upon Leukemia.‖ The American
Journal of the Medical Sciences 127 (4): 563–92. doi:10.1097/00000441-190412740-
00001.
133
Downs-Canner, Stephanie, Zong Sheng Guo, Roshni Ravindranathan, Caroline J. Breitbach,
Mark E O‘Malley, Heather L. Jones, Anne Moon, Judith Andrea McCart, Yongli Shuai,
Herbert J. Zeh, and David L. Bartlett. 2016. ―Phase 1 Study of Intravenous Oncolytic
Poxvirus (vvDD) in Patients With Advanced Solid Cancers.‖ Molecular Therapy 24 (8):
1492–1501. doi:10.1038/mt.2016.101.
Eisenstein, S., B. A. Coakley, K. Briley-Saebo, G. Ma, H.-m. Chen, M. Meseck, S. Ward, C.
Divino, S. Woo, S.-H. Chen, and P.-Y. Pan. 2013. ―Myeloid-Derived Suppressor Cells as a
Vehicle for Tumor-Specific Oncolytic Viral Therapy.‖ Cancer Research 73 (16): 5003–15.
doi:10.1158/0008-5472.CAN-12-1597.
Fedosyuk, Sofiya, Irina Grishkovskaya, Euripedes de Almeida Ribeiro, and Tim Skern. 2014.
―Characterization and Structure of the Vaccinia Virus NF-κB Antagonist A46.‖ Journal of
Biological Chemistry 289 (6): 3749–62. doi:10.1074/jbc.M113.512756.
Fish, Eleanor N., and Leonidas C Platanias. 2014. ―Interferon Receptor Signaling in
Malignancy: A Network of Cellular Pathways Defining Biological Outcomes.‖ Molecular
Cancer Research 12 (12): 1691–1703. doi:10.1158/1541-7786.MCR-14-0450.
Fish, Eleanor, Shahab Uddin, Mete Korkmaz, Beata Majchrzak, Brian J. Druker, and Leonidas
C Platanias. 1999. ―Activation of a CrkL-Stat5 Signaling Complex by Type I Interferons.‖
Journal of Biological Chemistry 274 (2): 571–73. doi:10.1074/jbc.274.2.571.
Fitzgerald, Katherine A., Eva M. Palsson-McDermott, Andrew G. Bowie, Caroline A. Jefferies,
Ashley S. Mansell, Gareth Brady, Elizabeth Brint, Aisling Dunne, Pearl Gray, Mary T.
Harte, Diane McMurray, Dirk E. Smith, John E. Sims, Timothy A. Bird, and Luke A. J.
O‘Neill. 2001. ―Mal (MyD88-Adapter-like) Is Required for Toll-like Receptor-4 Signal
Transduction.‖ Nature 413 (6851): 78–83. doi:10.1038/35092578.
Fuertes, Mercedes B., Seng Ryong Woo, Byron Burnett, Yang Xin Fu, and Thomas F.
Gajewski. 2013. ―Type I Interferon Response and Innate Immune Sensing of Cancer.‖
Trends in Immunology 34 (2). Elsevier Ltd: 67–73. doi:10.1016/j.it.2012.10.004.
Fujioka, Shuichi, Guido M Sclabas, Christian Schmidt, Wayne A Frederick, Qiang G Dong,
James L Abbruzzese, Douglas B Evans, Cheryl Baker, and Paul J Chiao. 2003. ―Function
of Nuclear Factor kappaB in Pancreatic Cancer Metastasis.‖ Clinical Cancer Research : An
Official Journal of the American Association for Cancer Research 9 (1). United States:
346–54.
Furrie, Elizabeth, Sandra Macfarlane, George Thomson, and George T. Macfarlane. 2005.
―Toll-like Receptors-2, -3 and -4 Expression Patterns on Human Colon and Their
Regulation by Mucosal-Associated Bacteria.‖ Immunology 115 (4): 565–74.
doi:10.1111/j.1365-2567.2005.02200.x.
134
García, M. A., E. F. Meurs, and M. Esteban. 2007. ―The dsRNA Protein Kinase PKR: Virus and
Cell Control.‖ Biochimie 89 (6-7): 799–811. doi:10.1016/j.biochi.2007.03.001.
García, María Angel, Esther Carrasco, Margarita Aguilera, Pablo Alvarez, Carmen Rivas,
Joaquin María Campos, Jose Carlos Prados, Miguel Angel Calleja, Mariano Esteban, Juan
Antonio Marchal, and Antonia Aránega. 2011. ―The Chemotherapeutic Drug 5-
Fluorouracil Promotes PKR-Mediated Apoptosis in a p53- Independent Manner in Colon
and Breast Cancer Cells.‖ Edited by Ilya Ulasov. PLoS ONE 6 (8): e23887.
doi:10.1371/journal.pone.0023887.
Gentschev, Ivaylo, Meike Müller, Marion Adelfinger, Stephanie Weibel, Friedrich Grummt,
Martina Zimmermann, Michael Bitzer, Martin Heisig, Qian Zhang, Yong A. Yu, Nanhai G.
Chen, Jochen Stritzker, Ulrich M. Lauer, and Aladar A. Szalay. 2011. ―Efficient
Colonization and Therapy of Human Hepatocellular Carcinoma (HCC) Using the
Oncolytic Vaccinia Virus Strain GLV-1h68.‖ PLoS ONE 6 (7).
doi:10.1371/journal.pone.0022069.
Gil, Jesús, Joaquín Rullas, María Angel García, José Alcamí, and Mariano Esteban. 2001. ―The
Catalytic Activity of dsRNA-Dependent Protein Kinase, PKR, Is Required for NF-κB
Activation.‖ Oncogene 20 (3): 385–94. doi:10.1038/sj.onc.1204109.
Gill, Richdeep S., David P. Al-Adra, Jeevan Nagendran, Sandy Campbell, Xinzhe Shi, Erika
Haase, and Daniel Schiller. 2011. ―Treatment of Gastric Cancer with Peritoneal
Carcinomatosis by Cytoreductive Surgery and HIPEC: A Systematic Review of Survival,
Mortality, and Morbidity.‖ Journal of Surgical Oncology 104 (6): 692–98.
doi:10.1002/jso.22017.
Gillard, S, D Spehner, R Drillien, and a Kirn. 1986. ―Localization and Sequence of a Vaccinia
Virus Gene Required for Multiplication in Human Cells.‖ Proceedings of the National
Academy of Sciences of the United States of America 83 (15): 5573–77.
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=386330&tool=pmcentrez&rend
ertype=abstract.
Gilmore, T D. 2006. ―Introduction to NF-κB: Players, Pathways, Perspectives.‖ Oncogene 25
(51): 6680–84. doi:10.1038/sj.onc.1209954.
Glehen, Olivier, François N. Gilly, Florent Boutitie, Jean M. Bereder, François Quenet, Lucas
Sideris, Baudouin Mansvelt, Gérard Lorimier, Simon Msika, and Dominique Elias. 2010.
―Toward Curative Treatment of Peritoneal Carcinomatosis from Nonovarian Origin by
Cytoreductive Surgery Combined with Perioperative Intraperitoneal Chemotherapy.‖
Cancer 116 (24): 5608–18. doi:10.1002/cncr.25356.
González, José M, and Mariano Esteban. 2010. ―A Poxvirus Bcl-2-like Gene Family Involved in
Regulation of Host Immune Response: Sequence Similarity and Evolutionary History.‖
Virology Journal 7 (1): 59. doi:10.1186/1743-422X-7-59.
135
Goto, Y., T. Arigami, M. Kitago, S. L. Nguyen, N. Narita, S. Ferrone, D. L. Morton, R. F. Irie,
and D. S.B. Hoon. 2008. ―Activation of Toll-like Receptors 2, 3, and 4 on Human
Melanoma Cells Induces Inflammatory Factors.‖ Molecular Cancer Therapeutics 7 (11):
3642–53. doi:10.1158/1535-7163.MCT-08-0582.
Graham, Stephen C., Mohammad W. Bahar, Samantha Cooray, Ron A.-J. Chen, Daniel M.
Whalen, Nicola G. A. Abrescia, David Alderton, Raymond J. Owens, David I. Stuart,
Geoffrey L. Smith, and Jonathan M. Grimes. 2008. ―Vaccinia Virus Proteins A52 and B14
Share a Bcl-2–Like Fold but Have Evolved to Inhibit NF-κB rather than Apoptosis.‖
Edited by Michele Barry. PLoS Pathogens 4 (8): e1000128.
doi:10.1371/journal.ppat.1000128.
Grandvaux, Nathalie, Benjamin R TenOever, Marc J Servant, and John Hiscott. 2002. ―The
Interferon Antiviral Response: From Viral Invasion to Evasion.‖ Current Opinion in
Infectious Diseases 15 (3): 259–67. doi:10.1097/00001432-200206000-00008.
Green, N K, C W Herbert, S J Hale, A B Hale, V Mautner, R Harkins, T Hermiston, K Ulbrich,
K D Fisher, and L W Seymour. 2004. ―Extended Plasma Circulation Time and Decreased
Toxicity of Polymer-Coated Adenovirus.‖ Gene Therapy 11 (16): 1256–63.
doi:10.1038/sj.gt.3302295.
Greig, Sarah L. 2016. ―Talimogene Laherparepvec: First Global Approval.‖ Drugs 76 (1).
Springer International Publishing: 147–54. doi:10.1007/s40265-015-0522-7.
Greiner, S., J. Y. Humrich, P. Thuman, B. Sauter, G. Schuler, and L. Jenne. 2006. ―The Highly
Attenuated Vaccinia Virus Strain Modified Virus Ankara Induces Apoptosis in Melanoma
Cells and Allows Bystander Dendritic Cells to Generate a Potent Anti-Tumoral Immunity.‖
Clinical and Experimental Immunology 146 (2): 344–53. doi:10.1111/j.1365-
2249.2006.03177.x.
Gu, J, L M Roth, C Younger, H Michael, F W Abdul-Karim, S Zhang, T M Ulbright, J N Eble,
and L Cheng. 2001. ―Molecular Evidence for the Independent Origin of Extra-Ovarian
Papillary Serous Tumors of Low Malignant Potential.‖ Journal of the National Cancer
Institute 93 (15). United States: 1147–52.
Guo, Zong Sheng, Zuqiang Liu, and David L. Bartlett. 2014. ―Oncolytic Immunotherapy: Dying
the Right Way Is a Key to Eliciting Potent Antitumor Immunity.‖ Frontiers in Oncology 4
(April): 1–11. doi:10.3389/fonc.2014.00074.
Guse, Kilian, Vincenzo Cerullo, and Akseli Hemminki. 2011. ―Oncolytic Vaccinia Virus for the
Treatment of Cancer.‖ Expert Opinion on Biological Therapy 11 (5): 595–608.
doi:10.1517/14712598.2011.558838.
136
Guse, Kilian, Marta Sloniecka, Iulia Diaconu, Kathryn Ottolino-Perry, Nan Tang, Calvin Ng,
Fabrice Le Boeuf, John C Bell, J Andrea McCart, Ari Ristimäki, Sari Pesonen, Vincenzo
Cerullo, and Akseli Hemminki. 2010. ―Antiangiogenic Arming of an Oncolytic Vaccinia
Virus Enhances Antitumor Efficacy in Renal Cell Cancer Models.‖ Journal of Virology 84
(2): 856–66. doi:10.1128/JVI.00692-09.
Guttridge, Denis C., Chris Albanese, Julie Y. Reuther, Richard G. Pestell, and Albert S.
Baldwin. 1999. ―NF-κB Controls Cell Growth and Differentiation through Transcriptional
Regulation of Cyclin D1.‖ Molecular and Cellular Biology 19 (8): 5785–99.
doi:10.1128/MCB.19.8.5785.
Hagemann, Thorsten, Toby Lawrence, Iain McNeish, Kellie a Charles, Hagen Kulbe, Richard G
Thompson, Stephen C Robinson, and Frances R Balkwill. 2008. ―‗Re-Educating‘ tumor-
Associated Macrophages by Targeting NF-kappaB.‖ The Journal of Experimental
Medicine 205 (6): 1261–68. doi:10.1084/jem.20080108.
Haggar, Fatima, and Robin Boushey. 2009. ―Colorectal Cancer Epidemiology: Incidence,
Mortality, Survival, and Risk Factors.‖ Clinics in Colon and Rectal Surgery 22 (04): 191–
97. doi:10.1055/s-0029-1242458.
Haralambieva, Iana, Ianko Iankov, Kosei Hasegawa, Mary Harvey, Stephen J Russell, and Kah-
Whye Peng. 2007. ―Engineering Oncolytic Measles Virus to Circumvent the Intracellular
Innate Immune Response.‖ Molecular Therapy 15 (3): 588–97. doi:10.1038/sj.mt.6300076.
Harte, M. T., I. R. Haga, G. Maloney, P. Gray, P. C. Reading, N. W. Bartlett, G. L. Smith, A.
Bowie, and L. A.J. O‘Neill. 2003. ―The Poxvirus Protein A52R Targets Toll-like Receptor
Signaling Complexes to Suppress Host Defense.‖ Journal of Experimental Medicine 197
(3): 343–51. doi:10.1084/jem.20021652.
He, Yong, Robert Fisher, Soma Chowdhury, Ishrat Sultana, Claudia P. Pereira, Mike Bray, and
Jennifer L. Reed. 2014. ―Vaccinia Virus Induces Rapid Necrosis in Keratinocytes by a
STAT3-Dependent Mechanism.‖ PLoS ONE 9 (11): 1–21.
doi:10.1371/journal.pone.0113690.
He, Yuan, Luigi Franchi, and Gabriel Núñez. 2013. ―The Protein Kinase PKR Is Critical for
LPS-Induced iNOS Production but Dispensable for Inflammasome Activation in
Macrophages.‖ European Journal of Immunology 43 (5): 1147–52.
doi:10.1002/eji.201243187.
Helm, C. W. 2009. ―The Role of Hyperthermic Intraperitoneal Chemotherapy (HIPEC) in
Ovarian Cancer.‖ The Oncologist 14 (7): 683–94. doi:10.1634/theoncologist.2008-0275.
137
Hemminki, Otto, Suvi Parviainen, Juuso Juhila, Riku Turkki, Nina Linder, Johan Lundin, Matti
Kankainen, Ari Ristimäki, Anniina Koski, Ilkka Liikanen, Minna Oksanen, Dirk M D.M.
Nettelbeck, Kalevi Kairemo, Kaarina Partanen, Timo Joensuu, Anna Kanerva, and Akseli
Hemminki. 2015. ―Immunological Data from Cancer Patients Treated with Ad5/3-E2F-
Δ24-GMCSF Suggests Utility for Tumor Immunotherapy.‖ Oncotarget 6 (6): 4467.
Heo, Jeong, Tony Reid, Leyo Ruo, Caroline J Breitbach, Steven Rose, Mark Bloomston, Mong
Cho, et al. 2013. ―Randomized Dose-Finding Clinical Trial of Oncolytic
Immunotherapeutic Vaccinia JX-594 in Liver Cancer.‖ Nature Medicine 19 (3): 329–36.
doi:10.1038/nm.3089.
Hett, Erik C, Louise H Slater, Kevin G Mark, Tomohiko Kawate, Brian G Monks, Andrea Stutz,
Eicke Latz, and Deborah T Hung. 2013. ―Chemical Genetics Reveals a Kinase-Independent
Role for Protein Kinase R in Pyroptosis.‖ Nature Chemical Biology 9 (6): 398–405.
doi:10.1038/nchembio.1236.
Hoesel, Bastian, and Johannes A Schmid. 2013. ―The Complexity of NF-κB Signaling in
Inflammation and Cancer.‖ Molecular Cancer 12 (1). Molecular Cancer: 86.
doi:10.1186/1476-4598-12-86.
Horstmann, Elizabeth, Mary S McCabe, Louise Grochow, Seiichiro Yamamoto, Larry
Rubinstein, Troy Budd, Dale Shoemaker, Ezekiel J Emanuel, and Christine Grady. 2005.
―Risks and Benefits of Phase 1 Oncology Trials, 1991 through 2002.‖ The New England
Journal of Medicine 352 (9): 895–904. doi:10.1056/NEJMsa042220.
Hsiao, J C, C S Chung, and W Chang. 1999. ―Vaccinia Virus Envelope D8L Protein Binds to
Cell Surface Chondroitin Sulfate and Mediates the Adsorption of Intracellular Mature
Virions to Cells.‖ Journal of Virology 73 (10): 8750–61.
Hu, Zhuting, Michael J Molloy, and Edward J Usherwood. 2014. ―CD4+ T-Cell Dependence of
Primary CD8+ T-Cell Response against Vaccinia Virus Depends upon Route of Infection
and Viral Dose.‖ Cellular and Molecular Immunology 13 (November): 1–12.
doi:10.1038/cmi.2014.128.
Huang, B, J Zhao, J C Unkeless, Z H Feng, and H Xiong. 2008. ―TLR Signaling by Tumor and
Immune Cells: A Double-Edged Sword.‖ Oncogene 27 (2): 218–24.
doi:10.1038/sj.onc.1210904.
Huang, R Y-J, M K Wong, T Z Tan, K T Kuay, A H C Ng, V Y Chung, Y-S Chu, N
Matsumura, H-C Lai, Y F Lee, W-J Sim, C Chai, E Pietschmann, S Mori, J J H Low, M
Choolani, and J P Thiery. 2013. ―An EMT Spectrum Defines an Anoikis-Resistant and
Spheroidogenic Intermediate Mesenchymal State That Is Sensitive to E-Cadherin
Restoration by a Src-Kinase Inhibitor, Saracatinib (AZD0530).‖ Cell Death & Disease 4:
e915. doi:10.1038/cddis.2013.442.
138
Huber, Margit A., Ninel Azoitei, Bernd Baumann, Stefan Grünert, Andreas Sommer, Hubert
Pehamberger, Norbert Kraut, Hartmut Beug, and Thomas Wirth. 2004. ―NF-κB Is Essential
for Epithelial-Mesenchymal Transition and Metastasis in a Model of Breast Cancer
Progression.‖ Journal of Clinical Investigation 114 (4): 569–81. doi:10.1172/JCI21358.
Hutchens, Martha A., Kathryn E. Luker, Joanne Sonstein, Gabriel Nunez, Jeffrey L. Curtis, and
Gary D. Luker. 2008a. ―Protective Effect of Toll-like Receptor 4 in Pulmonary Vaccinia
Infection.‖ PLoS Pathogens 4 (9). doi:10.1371/journal.ppat.1000153.
Hutchens, Martha, K. E. Luker, Peter Sottile, Joanne Sonstein, Nicholas W Lukacs, G. Nunez,
Jeffrey L Curtis, and Gary D Luker. 2008b. ―TLR3 Increases Disease Morbidity and
Mortality from Vaccinia Infection.‖ The Journal of Immunology 180 (1): 483–91.
doi:10.4049/jimmunol.180.1.483.
Hwang, Tae-Ho, Anne Moon, James Burke, Antoni Ribas, Joe Stephenson, Caroline J
Breitbach, Manijeh Daneshmand, Naomi De Silva, Kelley Parato, Jean-Simon Diallo,
Yeon-Sook Lee, Ta-Chiang Liu, John C Bell, and David H Kirn. 2011. ―A Mechanistic
Proof-of-Concept Clinical Trial With JX-594, a Targeted Multi-Mechanistic Oncolytic
Poxvirus, in Patients With Metastatic Melanoma.‖ Molecular Therapy 19 (10). Nature
Publishing Group: 1913–22. doi:10.1038/mt.2011.132.
Ilkow, Carolina S., Stephanie L. Swift, John C. Bell, and Jean-Simon Diallo. 2014. ―From
Scourge to Cure: Tumour-Selective Viral Pathogenesis as a New Strategy against Cancer.‖
PLoS Pathogens 10 (1): e1003836. doi:10.1371/journal.ppat.1003836.
Jacobs, Nathalie, Nathan W. Bartlett, Richard H. Clark, and Geoffrey L. Smith. 2008. ―Vaccinia
Virus Lacking the Bcl-2-like Protein N1 Induces a Stronger Natural Killer Cell Response
to Infection.‖ Journal of General Virology 89 (11): 2877–81.
doi:10.1099/vir.0.2008/004119-0.
Jacquet, P, and P H Sugarbaker. 1996. ―Clinical Research Methodologies in Diagnosis and
Staging of Patients with Peritoneal Carcinomatosis.‖ Cancer Treatment and Research 82.
Netherlands: 359–74.
Jayne, D G. 2003. ―The Molecular Biology of Peritoneal Carcinomatosis from Gastrointestinal
Cancer.‖ Annals of the Academy of Medicine, Singapore 32 (2). Singapore: 219–25.
Jayne, D G, S Fook, C Loi, and F Seow-Choen. 2002. ―Peritoneal Carcinomatosis from
Colorectal Cancer.‖ Br J Surg 89 (12): 1545–50. doi:2274 [pii]\r10.1046/j.1365-
2168.2002.02274.x.
Jiao, Xiang, Laura D. Wood, Monica Lindman, Sian Jones, Phillip Buckhaults, Kornelia Polyak,
Saraswati Sukumar, Hannah Carter, Dewey Kim, Rachel Karchin, and Tobias Sjöblom.
2012. ―Somatic Mutations in the Notch, NF-KB, PIK3CA, and Hedgehog Pathways in
Human Breast Cancers.‖ Genes, Chromosomes and Cancer 51 (5): 480–89.
doi:10.1002/gcc.21935.
139
Jounai, Nao, Kouji Kobiyama, Fumihiko Takeshita, and Ken J Ishii. 2013. ―Recognition of
Damage-Associated Molecular Patterns Related to Nucleic Acids during Inflammation and
Vaccination.‖ Frontiers in Cellular and Infection Microbiology 2 (January): 1–13.
doi:10.3389/fcimb.2012.00168.
Kagan, Jonathan C, Tian Su, Tiffany Horng, Amy Chow, Shizuo Akira, and Ruslan Medzhitov.
2008. ―TRAM Couples Endocytosis of Toll-like Receptor 4 to the Induction of Interferon-
β.‖ Nature Immunology 9 (4): 361–68. doi:10.1038/ni1569.
Kalir, Tamara, Adolfo Firpo-Betancourt, and Farr Nezhat. 2013. ―Update on Ovarian Cancer
Pathogenesis: History, Controversies, Emerging Issues and Future Impact.‖ Expert Review
of Obstetrics & Gynecology 8 (6): 539–47. doi:10.1586/17474108.2013.847638.
Katz, Matthew H, and Robert M Barone. 2003. ―The Rationale of Perioperative Intraperitoneal
Chemotherapy in the Treatment of Peritoneal Surface Malignancies.‖ Surgical Oncology
Clinics of North America 12 (3). United States: 673–88.
Kaufman, Howard L, Dae Won Kim, Gail DeRaffele, Josephine Mitcham, Rob S Coffin, and
Seunghee Kim-Schulze. 2010. ―Local and Distant Immunity Induced by Intralesional
Vaccination with an Oncolytic Herpes Virus Encoding GM-CSF in Patients with Stage IIIc
and IV Melanoma.‖ Annals of Surgical Oncology 17 (3): 718–30. doi:10.1245/s10434-009-
0809-6.
Kawai, Taro, and Shizuo Akira. 2006. ―Innate Immune Recognition of Viral Infection.‖ Nature
Immunology 7 (2): 131–37. doi:10.1038/ni1303.
Kelly, Elizabeth, and Stephen J Russell. 2007. ―History of Oncolytic Viruses: Genesis to
Genetic Engineering.‖ Molecular Therapy : The Journal of the American Society of Gene
Therapy 15 (4): 651–59. doi:10.1038/sj.mt.6300108.
Kerscher, A G, T C Chua, M Gasser, U Maeder, V Kunzmann, C Isbert, C T Germer, and J O W
Pelz. 2013. ―Impact of Peritoneal Carcinomatosis in the Disease History of Colorectal
Cancer Management: A Longitudinal Experience of 2406 Patients over Two Decades.‖
British Journal of Cancer 108 (7): 1432–39. doi:10.1038/bjc.2013.82.
Killeen, S D, J H Wang, E J Andrews, and H P Redmond. 2006. ―Exploitation of the Toll-like
Receptor System in Cancer: A Doubled-Edged Sword?‖ British Journal of Cancer 95 (3):
247–52. doi:10.1038/sj.bjc.6603275.
Kim, H J, N Hawke, and a S Baldwin. 2006a. ―NF-kappaB and IKK as Therapeutic Targets in
Cancer.‖ Cell Death and Differentiation 13 (5): 738–47. doi:10.1038/sj.cdd.4401877.
Kim, J. H., J. Y. Oh, B. H. Park, D. E. Lee, J. S. Kim, H. E. Park, M. S. Roh, J. E. Je, J. H.
Yoon, S. H. Thorne, D. Kirn, and T. H. Hwang. 2006b. ―Systemic Armed Oncolytic and
Immunologic Therapy for Cancer with JX-594, a Targeted Poxvirus Expressing GM-CSF.‖
Molecular Therapy 14 (3): 361–70. doi:10.1016/j.ymthe.2006.05.008.
140
Kim, Mi Kyung, Caroline J Breitbach, Anne Moon, Jeong Heo, Yu Kyoung Lee, Mong Cho,
Jun Woo Lee, Seong-Geun Kim, Dae Hwan Kang, John C Bell, Byeong Ho Park, David H
Kirn, and Tae-Ho Hwang. 2013. ―Oncolytic and Immunotherapeutic Vaccinia Induces
Antibody-Mediated Complement-Dependent Cancer Cell Lysis in Humans.‖ Science
Translational Medicine 5 (185): 185ra63. doi:10.1126/scitranslmed.3005361.
Kim, Yongwoon, Hasup Lee, Lim Heo, Chaok Seok, and Jungwoo Choe. 2014. ―Structure of
Vaccinia Virus A46, an Inhibitor of TLR4 Signaling Pathway Shows the Conformation of
VIPER Motif.‖ Protein Science 23 (7): 906–14. doi:10.1002/pro.2472.
Kimball, Kristopher J., Meredith A. Preuss, Mack N. Barnes, Minghui Wang, Gene P. Siegal,
Wen Wan, Huichien Kuo, Souheil Saddekni, Cecil R. Stockard, William E. Grizzle,
Raymond D. Harris, Rosemarie Aurigemma, David T. Curiel, and Ronald D. Alvarez.
2010. ―A Phase I Study of a Tropism-Modified Conditionally Replicative Adenovirus for
Recurrent Malignant Gynecologic Diseases.‖ Clinical Cancer Research 16 (21): 5277–87.
doi:10.1158/1078-0432.CCR-10-0791.
Kirn, D. 2001. ―Clinical Research Results with dl1520 (Onyx-015), a Replication-Selective
Adenovirus for the Treatment of Cancer: What Have We Learned?‖ Gene Therapy 8 (2):
89–98. doi:10.1038/sj.gt.3301377.
Kirn, David H, and Steve H Thorne. 2009. ―Targeted and Armed Oncolytic Poxviruses: A
Novel Multi-Mechanistic Therapeutic Class for Cancer.‖ Nature Reviews. Cancer 9 (1):
64–71. doi:10.1038/nrc2545.
Kirn, David H., Yaohe Wang, Fabrice Le Boeuf, John Bell, and Steve H. Thorne. 2007.
―Targeting of Interferon-Beta to Produce a Specific, Multi-Mechanistic Oncolytic Vaccinia
Virus.‖ PLoS Medicine 4 (12): 2004–12. doi:10.1371/journal.pmed.0040353.
Klaver, Yvonne L B, Valery E P P Lemmens, Simon W. Nienhuijs, Misha D P Luyer, and
Ignace H J T de Hingh. 2012. ―Peritoneal Carcinomatosis of Colorectal Origin: Incidence,
Prognosis and Treatment Options.‖ World Journal of Gastroenterology 18 (39): 5489–94.
doi:10.3748/wjg.v18.i39.5489.
Komarova, S. 2006. ―Mesenchymal Progenitor Cells as Cellular Vehicles for Delivery of
Oncolytic Adenoviruses.‖ Molecular Cancer Therapeutics 5 (3): 755–66.
doi:10.1158/1535-7163.MCT-05-0334.
Koyama, Shohei, Ken J. Ishii, Cevayir Coban, and Shizuo Akira. 2008. ―Innate Immune
Response to Viral Infection.‖ Cytokine 43 (3): 336–41. doi:10.1016/j.cyto.2008.07.009.
Kumar, Himanshu, Taro Kawai, and Shizuo Akira. 2011. ―Pathogen Recognition by the Innate
Immune System.‖ International Reviews of Immunology 30 (1): 16–34.
doi:10.3109/08830185.2010.529976.
141
Kusamura, Shigeki, Dario Baratti, Nadia Zaffaroni, Raffaella Villa, Barbara Laterza, and Maria
Rosaria Balestra. 2010. ―Pathophysiology and Biology of Peritoneal Carcinomatosis.‖
World Journal of Gastrointestinal Oncology 2 (1): 12–18. doi:10.4251/wjgo.v2.i1.12.
Laliberte, Jason P., Andrea S. Weisberg, and Bernard Moss. 2011. ―The Membrane Fusion Step
of Vaccinia Virus Entry Is Cooperatively Mediated by Multiple Viral Proteins and Host
Cell Components.‖ PLoS Pathogens 7 (12). doi:10.1371/journal.ppat.1002446.
Lane, J M, F L Ruben, J M Neff, and J D Millar. 1970. ―Complications of Smallpox
Vaccination, 1968: Results of Ten Statewide Surveys.‖ The Journal of Infectious Diseases
122 (4). UNITED STATES: 303–9.
Langland, Jeffrey O, and Bertram L Jacobs. 2002. ―The Role of the PKR-Inhibitory Genes, E3L
and K3L, in Determining Vaccinia Virus Host Range.‖ Virology 299 (1): 133–41.
doi:10.1006/viro.2002.1479.
Laurie, S. a., John C. Bell, Harold L Atkins, Joanne Roach, Michael K Bamat, James D. O‘Neil,
Scot M. Roberts, William S. Groene, and Robert M. Lorence. 2006. ―A Phase 1 Clinical
Study of Intravenous Administration of PV701, an Oncolytic Virus, Using Two-Step
Desensitization.‖ Clinical Cancer Research 12 (8): 2555–62. doi:10.1158/1078-0432.CCR-
05-2038.
Law, Mansun, Gemma C Carter, Kim L Roberts, Michael Hollinshead, and Geoffrey L Smith.
2006. ―Ligand-Induced and Nonfusogenic Dissolution of a Viral Membrane.‖ Proceedings
of the National Academy of Sciences of the United States of America 103 (15): 5989–94.
doi:10.1073/pnas.0601025103.
Lemay, Chantal G, Julia L Rintoul, Agnieszka Kus, Jennifer M Paterson, Vanessa Garcia,
Theresa J Falls, Lisa Ferreira, et al. 2012. ―Harnessing Oncolytic Virus-Mediated
Antitumor Immunity in an Infected Cell Vaccine.‖ Molecular Therapy : The Journal of the
American Society of Gene Therapy 20 (9): 1791–99. doi:10.1038/mt.2012.128.
Lencioni, Riccardo, and Josep M Llovet. 2010. ―Modified RECIST ( mRECIST ) Assessment
for Hepatocellular Carcinoma‖ 1 (212): 52–60.
Li, Y., X. Meng, Y. Xiang, and J. Deng. 2010. ―Structure Function Studies of Vaccinia Virus
Host Range Protein K1 Reveal a Novel Functional Surface for Ankyrin Repeat Proteins.‖
Journal of Virology 84 (7): 3331–38. doi:10.1128/JVI.02332-09.
Li, Y., D. C. Yu, Y. Chen, P. Amin, H. Zhang, N. Nguyen, and D. R. Henderson. 2001. ―A
Hepatocellular Carcinoma-Specific Adenovirus Variant, CV890, Eliminates Distant
Human Liver Tumors in Combination with Doxorubicin.‖ Cancer Research 61 (17): 6428–
36.
142
Lichty, Brian D, Caroline J Breitbach, David F Stojdl, and John C Bell. 2014. ―Going Viral with
Cancer Immunotherapy.‖ Nature Reviews. Cancer 14 (8). Nature Publishing Group: 559–
67. doi:10.1038/nrc3770.
Lind, D.Scott, Steven N. Hochwald, John Malaty, Stelio Rekkas, Paul Hebig, Girish Mishra,
Lyle L. Moldawer, Edward M. Copeland, and Sally MacKay. 2001. ―Nuclear Factor-κB Is
Upregulated in Colorectal Cancer.‖ Surgery 130 (2): 363–69.
doi:10.1067/msy.2001.116672.
Liskova, Jana, Jarmila Knitlova, Richard Honner, and Zora Melkova. 2011. ―Apoptosis and
Necrosis in Vaccinia Virus-Infected HeLa G and BSC-40 Cells.‖ Virus Research 160 (1-2).
Elsevier B.V.: 40–50. doi:10.1016/j.virusres.2011.05.005.
Liu, Shin-Wu, Linda S Wyatt, Marlene S Orandle, Mahnaz Minai, and Bernard Moss. 2014.
―The D10 Decapping Enzyme of Vaccinia Virus Contributes to Decay of Cellular and
Viral mRNAs and to Virulence in Mice.‖ Journal of Virology 88 (1): 202–11.
doi:10.1128/JVI.02426-13.
Liu, Ta-Chiang, Evanthia Galanis, and David Kirn. 2007. ―Clinical Trial Results with Oncolytic
Virotherapy: A Century of Promise, a Decade of Progress.‖ Nature Clinical Practice.
Oncology 4 (2): 101–17. doi:10.1038/ncponc0736.
Liu, Zheng, Shuhui Wang, Qicheng Zhang, Meijuan Tian, Jue Hou, Rongmin Wang, Chang Liu,
Xu Ji, Ying Liu, and Yiming Shao. 2013. ―Deletion of C7L and K1L Genes Leads to
Significantly Decreased Virulence of Recombinant Vaccinia Virus TianTan.‖ PloS One 8
(7): e68115. doi:10.1371/journal.pone.0068115.
Lu, Ben, Takahisa Nakamura, Karen Inouye, Jianhua Li, Yiting Tang, Peter Lundbäck, Sergio I.
Valdes-Ferrer, et al. 2012. ―Novel Role of PKR in Inflammasome Activation and HMGB1
Release.‖ Nature 488 (7413): 670–74. doi:10.1038/nature11290.
Luker, Kathryn E., Martha Hutchens, Tracey Schultz, Andrew Pekosz, and Gary D. Luker.
2005. ―Bioluminescence Imaging of Vaccinia Virus: Effects of Interferon on Viral
Replication and Spread.‖ Virology 341 (2): 284–300. doi:10.1016/j.virol.2005.06.049.
Lun, Xue Qing, Ji Hyun Jang, Nan Tang, Helen Deng, Renee Head, John C. Bell, David F.
Stojdl, Catherine L. Nutt, Donna L. Senger, Peter A. Forsyth, and J. Andrea McCart. 2009.
―Efficacy of Systemically Administered Oncolytic Vaccinia Virotherapy for Malignant
Gliomas Is Enhanced by Combination Therapy with Rapamycin or Cyclophosphamide.‖
Clinical Cancer Research 15 (8): 2777–88. doi:10.1158/1078-0432.CCR-08-2342.
Lysakova-Devine, Tatyana, Brian Keogh, Barry Harrington, Kamalpreet Nagpal, Annett Halle,
Douglas T Golenbock, Tom Monie, and Andrew G Bowie. 2010. ―Viral Inhibitory Peptide
of TLR4, a Peptide Derived from Vaccinia Protein A46, Specifically Inhibits TLR4 by
Directly Targeting MyD88 Adaptor-like and TRIF-Related Adaptor Molecule.‖ Journal of
Immunology (Baltimore, Md. : 1950) 185 (7): 4261–71. doi:10.4049/jimmunol.1002013.
143
MacTavish, Heather, Jean Simon Diallo, Baocheng Huang, Marianne Stanford, Fabrice Le
Boeuf, Naomi De Silva, Julie Cox, John Graydon Simmons, Tanya Guimond, Theresa
Falls, Andrea J. McCart, Harry Atkins, Caroline Breitbach, David Kirn, Stephen Thorne,
and John C. Bell. 2010. ―Enhancement of Vaccinia Virus Based Oncolysis with Histone
Deacetylase Inhibitors.‖ PLoS ONE 5 (12): 1–9. doi:10.1371/journal.pone.0014462.
Maloney, Geraldine, Martina Schröder, and Andrew G. Bowie. 2005. ―Vaccinia Virus Protein
A52R Activates p38 Mitogen-Activated Protein Kinase and Potentiates
Lipopolysaccharide-Induced Interleukin-10.‖ Journal of Biological Chemistry 280 (35):
30838–44. doi:10.1074/jbc.M501917200.
Maluquer de Motes, Carlos, Samantha Cooray, Hongwei Ren, Gabriel M F Almeida, Kieran
McGourty, Mohammad W Bahar, David I Stuart, Jonathan M Grimes, Stephen C Graham,
and Geoffrey L Smith. 2011. ―Inhibition of Apoptosis and NF-κB Activation by Vaccinia
Protein N1 Occur via Distinct Binding Surfaces and Make Different Contributions to
Virulence.‖ PLoS Pathogens 7 (12): e1002430. doi:10.1371/journal.ppat.1002430.
Marchal, Juan a., Gabriel J. Lopez, Macarena Peran, Ana Comino, Juan R. Delgado, Javier a.
García-García, Veronica Conde, Fernando M. Aranda, Carmen Rivas, Mariano Esteban,
and Maria a. Garcia. 2014. ―The Impact of PKR Activation: From Neurodegeneration to
Cancer.‖ FASEB Journal 28 (5): 1965–74. doi:10.1096/fj.13-248294.
Maringe, Camille, Sarah Walters, John Butler, Michel P. Coleman, Neville Hacker, Louise
Hanna, Berit J. Mosgaard, et al. 2012. ―Stage at Diagnosis and Ovarian Cancer Survival:
Evidence from the International Cancer Benchmarking Partnership.‖ Gynecologic
Oncology 127 (1). Elsevier Inc.: 75–82. doi:10.1016/j.ygyno.2012.06.033.
Markman, M, B N Bundy, D S Alberts, J M Fowler, D L Clark-Pearson, L F Carson, S Wadler,
and J Sickel. 2001. ―Phase III Trial of Standard-Dose Intravenous Cisplatin plus Paclitaxel
versus Moderately High-Dose Carboplatin Followed by Intravenous Paclitaxel and
Intraperitoneal Cisplatin in Small-Volume Stage III Ovarian Carcinoma: An Intergroup
Study of the Gynecol.‖ Journal of Clinical Oncology : Official Journal of the American
Society of Clinical Oncology 19 (4). United States: 1001–7.
Masoumi Moghaddam, Samar, Afshin Amini, David L. Morris, and Mohammad H.
Pourgholami. 2012. ―Significance of Vascular Endothelial Growth Factor in Growth and
Peritoneal Dissemination of Ovarian Cancer.‖ Cancer and Metastasis Reviews 31 (1-2):
143–62. doi:10.1007/s10555-011-9337-5.
Mastrangelo, M J, H C Maguire Jr., L C Eisenlohr, C E Laughlin, C E Monken, P A McCue, A
J Kovatich, and E C Lattime. 1999. ―Intratumoral Recombinant GM-CSF-Encoding Virus
as Gene Therapy in Patients with Cutaneous Melanoma.‖ Cancer Gene Ther 6 (5): 409–22.
doi:10.1038/sj.cgt.7700066.
144
McCart, J. Andrea, Jerrold M Ward, John Lee, Yun Hu, H Richard Alexander, Steven K Libutti,
Bernard Moss, and David L Bartlett. 2001. ―Systemic Cancer Therapy with a Tumor-
Selective Vaccinia Virus Mutant Lacking Thymidine Kinase and Vaccinia Growth Factor
Genes.‖ Cancer Research 61: 8751–57.
McFadden, Grant. 2005. ―Poxvirus Tropism.‖ Nature Reviews Microbiology 3 (3): 201–13.
doi:10.1038/nrmicro1099.
McLemore, Monica R., Christine Miaskowski, Bradley E. Aouizerat, Lee-may Chen, and
Marylin J. Dodd. 2009. ―Epidemiological and Genetic Factors Associated With Ovarian
Cancer.‖ Cancer Nursing 32 (4): 281–88. doi:10.1097/NCC.0b013e31819d30d6.
Medeiros-Silva, Daniela Carla, Eduardo Augusto Dos Santos Moreira-Silva, Juliana de Assis
Silva Gomes, Flávio Guimarães da Fonseca, and Rodrigo Correa-Oliveira. 2013. ―CD4 and
CD8 T Cells Participate in the Immune Memory Response against Vaccinia Virus after
a Previous Natural Infection.‖ Results in Immunology 3: 104–13.
doi:10.1016/j.rinim.2013.10.002.
Mehta, Geeta, Amy Y Hsiao, Marylou Ingram, Gary D Luker, and Shuichi Takayama. 2012.
―Opportunities and Challenges for Use of Tumor Spheroids as Models to Test Drug
Delivery and Efficacy.‖ Journal of Controlled Release 164 (2). Elsevier B.V.: 192–204.
doi:10.1016/j.jconrel.2012.04.045.
Melcher, Alan, Kelley Parato, Cliona M Rooney, and John C Bell. 2011. ―Thunder and
Lightning: Immunotherapy and Oncolytic Viruses Collide.‖ Molecular Therapy : The
Journal of the American Society of Gene Therapy 19 (6). Nature Publishing Group: 1008–
16. doi:10.1038/mt.2011.65.
Meng, Xiangzhi, Canhua Jiang, Janilyn Arsenio, Kevin Dick, Jingxin Cao, and Yan Xiang.
2009. ―Vaccinia Virus K1L and C7L Inhibit Antiviral Activities Induced by Type I
Interferons.‖ Journal of Virology 83 (20): 10627–36. doi:10.1128/JVI.01260-09.
Meng, Xiangzhi, and Yan Xiang. 2006. ―Vaccinia Virus K1L Protein Supports Viral Replication
in Human and Rabbit Cells through a Cell-Type-Specific Set of Its Ankyrin Repeat
Residues That Are Distinct from Its Binding Site for ACAP2.‖ Virology 353 (1): 220–33.
doi:10.1016/j.virol.2006.05.032.
Miest, Tanner S, and Roberto Cattaneo. 2014. ―New Viruses for Cancer Therapy: Meeting
Clinical Needs.‖ Nature Reviews. Microbiology 12 (1). Nature Publishing Group: 23–34.
doi:10.1038/nrmicro3140.
145
Morgan, Juliette, Martha H Roper, Laurence Sperling, Richard a Schieber, James D
Heffelfinger, Christine G Casey, Jacqueline W Miller, et al. 2008. ―Myocarditis,
Pericarditis, and Dilated Cardiomyopathy after Smallpox Vaccination among Civilians in
the United States, January-October 2003.‖ Clinical Infectious Diseases : An Official
Publication of the Infectious Diseases Society of America 46 Suppl 3 (October 2003):
S242–50. doi:10.1086/524747.
Moss, Bernard. 2013. ―Fields Virology.‖ In Fields Virology, edited by D. Knipe and P. Howley,
6th ed., 2:2130–60. Philadelphia: Lippincott Williams & Wilkins. doi:10.1093/cid/ciu346.
Mulligan, R C, and P Berg. 1981. ―Selection for Animal Cells That Express the Escherichia Coli
Gene Coding for Xanthine-Guanine Phosphoribosyltransferase.‖ Proceedings of the
National Academy of Sciences of the United States of America 78 (4): 2072–76.
Musti, Marina, Eeva Kettunen, Silvano Dragonieri, Pamela Lindholm, Domenica Cavone,
Gabriella Serio, and Sakari Knuutila. 2006. ―Cytogenetic and Molecular Genetic Changes
in Malignant Mesothelioma.‖ Cancer Genetics and Cytogenetics 170 (1): 9–15.
doi:10.1016/j.cancergencyto.2006.04.011.
Muthana, M., S. Rodrigues, Y.-Y. Chen, A. Welford, R. Hughes, S. Tazzyman, M. Essand, F.
Morrow, and C. E. Lewis. 2013. ―Macrophage Delivery of an Oncolytic Virus Abolishes
Tumor Regrowth and Metastasis after Chemotherapy or Irradiation.‖ Cancer Research 73
(2): 490–95. doi:10.1158/0008-5472.CAN-12-3056.
Naik, Arpana M, Sricharan Chalikonda, J Andrea McCart, Hui Xu, Z Sheng Guo, Gregory
Langham, Donald Gardner, Simone Mocellin, Anna E Lokshin, Bernard Moss, H Richard
Alexander, and David L Bartlett. 2006. ―Intravenous and Isolated Limb Perfusion Delivery
of Wild Type and a Tumor-Selective Replicating Mutant Vaccinia Virus in Nonhuman
Primates.‖ Human Gene Therapy 17 (1): 31–45. doi:10.1089/hum.2006.17.31.
Nemunaitis, J, C Cunningham, a Buchanan, a Blackburn, G Edelman, P Maples, G Netto, a
Tong, B Randlev, S Olson, and D Kirn. 2001. ―Intravenous Infusion of a Replication-
Selective Adenovirus (ONYX-015) in Cancer Patients: Safety, Feasibility and Biological
Activity.‖ Gene Therapy 8: 746–59. doi:10.1038/sj.gt.3301424.
Nezhat, Farr R., Radu Apostol, Camran Nezhat, and Tanja Pejovic. 2015. ―New Insights in the
Pathophysiology of Ovarian Cancer and Implications for Screening and Prevention.‖
American Journal of Obstetrics and Gynecology 213 (3). Elsevier Inc.: 262–67.
doi:10.1016/j.ajog.2015.03.044.
Nissan, Aviram, Alexander Stojadinovic, Alfredo Garofalo, Jesus Esquivel, and Pompiliu Piso.
2009. ―Evidence-Based Medicine in the Treatment of Peritoneal Carcinomatosis: Past,
Present, and Future.‖ Journal of Surgical Oncology 100 (4): 335–44.
doi:10.1002/jso.21323.
146
Oda, Shun-ichiro, Edward Franklin, and Amir R. Khan. 2011. ―Poxvirus A46 Protein Binds to
TIR Domain-Containing Mal/TIRAP via an α-Helical Sub-Domain.‖ Molecular
Immunology 48 (15-16): 2144–50. doi:10.1016/j.molimm.2011.07.014.
Oeckinghaus, Andrea, Matthew S Hayden, and Sankar Ghosh. 2011. ―Crosstalk in NF-κB
Signaling Pathways.‖ Nat Immunol 12 (8): 695–708. doi:10.1038/ni.2065.
Ong, H T, K Hasegawa, A B Dietz, S J Russell, and K-W Peng. 2007. ―Evaluation of T Cells as
Carriers for Systemic Measles Virotherapy in the Presence of Antiviral Antibodies.‖ Gene
Therapy 14 (4): 324–33. doi:10.1038/sj.gt.3302880.
Ottolino-Perry, Kathryn, Sergio A. Acuna, Fernando A. Angarita, Clara Sellers, Siham
Zerhouni, Nan Tang, and J. Andrea McCart. 2015. ―Oncolytic Vaccinia Virus Synergizes
with Irinotecan in Colorectal Cancer.‖ Molecular Oncology 9 (8). Elsevier B.V: 1539–52.
doi:10.1016/j.molonc.2015.04.009.
Ottolino-Perry, Kathryn, Nan Tang, Renee Head, Calvin Ng, Rozanne Arulanandam, Fernando
a Angarita, Sergio a Acuna, Yonghong Chen, John Bell, Ralph S Dacosta, and J Andrea
McCart. 2014. ―Tumor Vascularization Is Critical for Oncolytic Vaccinia Virus Treatment
of Peritoneal Carcinomatosis.‖ International Journal of Cancer. Journal International Du
Cancer 134 (3): 717–30. doi:10.1002/ijc.28395.
Park, Byeong Ho, Taeho Hwang, Ta Chiang Liu, Daniel Y. Sze, Jae Seok Kim, Hyuk Chan
Kwon, Sung Yong Oh, et al. 2008. ―Use of a Targeted Oncolytic Poxvirus, JX-594, in
Patients with Refractory Primary or Metastatic Liver Cancer: A Phase I Trial.‖ The Lancet
Oncology 9 (6): 533–42. doi:10.1016/S1470-2045(08)70107-4.
Park, Se Hoon, Caroline J Breitbach, Jeeyun Lee, Joon Oh Park, Ho Yeong Lim, Won Ki Kang,
Anne Moon, Jae-Hee Mun, Erica M Sommermann, Liliana Maruri Avidal, Rick Patt,
Adina Pelusio, James Burke, Tae-Ho Hwang, David Kirn, and Young Suk Park. 2015.
―Phase 1b Trial of Biweekly Intravenous Pexa-Vec (JX-594), an Oncolytic and
Immunotherapeutic Vaccinia Virus in Colorectal Cancer.‖ Molecular Therapy 23 (9):
1532–40. doi:10.1038/mt.2015.109.
Peng, Kah Whye, Kathleen A. Donovan, Urs Schneider, Roberto Cattaneo, John A. Lust, and
Stephen J. Russell. 2003. ―Oncolytic Measles Viruses Displaying a Single-Chain Antibody
against CD38, a Myeloma Cell Marker.‖ Blood 101 (7): 2557–62. doi:10.1182/blood-2002-
07-2195.
Perdiguero, Beatriz, and Mariano Esteban. 2009. ―The Interferon System and Vaccinia Virus
Evasion Mechanisms.‖ Journal of Interferon & Cytokine Research 29 (9): 581–98.
doi:10.1089/jir.2009.0073.
147
Perdiguero, Beatriz, Carmen Elena Gómez, Mauro Di Pilato, Carlos Oscar S Sorzano, Julie
Delaloye, Thierry Roger, Thierry Calandra, Giuseppe Pantaleo, and Mariano Esteban.
2013. ―Deletion of the Vaccinia Virus Gene A46R, Encoding for an Inhibitor of TLR
Signalling, Is an Effective Approach to Enhance the Immunogenicity in Mice of the
HIV/AIDS Vaccine Candidate NYVAC-C.‖ Edited by Adriano Boasso. PLoS ONE 8 (9):
e74831. doi:10.1371/journal.pone.0074831.
Perkus, M E, S J Goebel, S W Davis, G P Johnson, K Limbach, E K Norton, and E Paoletti.
1990. ―Vaccinia Virus Host Range Genes.‖ Virology 179 (1): 276–86.
http://www.ncbi.nlm.nih.gov/pubmed/2171207.
Pol, Jonathan, Aitziber Buqué, Fernando Aranda, Norma Bloy, Isabelle Cremer, Alexander
Eggermont, Philippe Erbs, Jitka Fucikova, Jérôme Galon, Jean-Marc Limacher, Xavier
Preville, Catherine Sautès-Fridman, Radek Spisek, Laurence Zitvogel, Guido Kroemer, and
Lorenzo Galluzzi. 2015. ―Trial Watch—Oncolytic Viruses and Cancer Therapy.‖
OncoImmunology 5 (2): e1117740. doi:10.1080/2162402X.2015.1117740.
Postigo, A., and M. Way. 2012. ―The Vaccinia Virus-Encoded Bcl-2 Homologues Do Not Act
as Direct Bax Inhibitors.‖ Journal of Virology 86 (1): 203–13. doi:10.1128/JVI.05817-11.
Power, Anthony T, Jiahu Wang, Theresa J Falls, Jennifer M Paterson, Kelley A Parato, Brian D
Lichty, David F Stojdl, Peter A J Forsyth, Harry Atkins, and John C Bell. 2007. ―Carrier
Cell-Based Delivery of an Oncolytic Virus Circumvents Antiviral Immunity.‖ Molecular
Therapy 15 (1): 123–30. doi:10.1038/sj.mt.6300039.
Puhlmann, M, C K Brown, M Gnant, J Huang, S K Libutti, H R Alexander, and D L Bartlett.
2000. ―Vaccinia as a Vector for Tumor-Directed Gene Therapy: Biodistribution of a
Thymidine Kinase-Deleted Mutant.‖ Cancer Gene Therapy 7 (1): 66–73.
doi:10.1038/sj.cgt.7700075.
Putz, Mike M, Claire M Midgley, Mansun Law, and Geoffrey L Smith. 2006. ―Quantification of
Antibody Responses against Multiple Antigens of the Two Infectious Forms of Vaccinia
Virus Provides a Benchmark for Smallpox Vaccination.‖ Nature Medicine 12 (11). United
States: 1310–15. doi:10.1038/nm1457.
Qing, G., Z. Qu, and G. Xiao. 2007. ―Endoproteolytic Processing of C-Terminally Truncated
NF- B2 Precursors at B-Containing Promoters.‖ Proceedings of the National Academy of
Sciences 104 (13): 5324–29. doi:10.1073/pnas.0609914104.
Radhakrishnan, Senthil K, and Sitharthan Kamalakaran. 2006. ―Pro-Apoptotic Role of NF-
kappaB: Implications for Cancer Therapy.‖ Biochimica et Biophysica Acta 1766 (1): 53–
62. doi:10.1016/j.bbcan.2006.02.001.
148
Rampurwala, Murtuza, Murali K Ravoori, Wei Wei, Valen E Johnson, Raghunandan Vikram,
and Vikas Kundra. 2009. ―Visualization and Quantification of Intraperitoneal Tumors by In
Vivo Computed Tomography Using Negative Contrast Enhancement Strategy in a Mouse
Model of Ovarian Cancer.‖ Translational Oncology.
Ramsey-Ewing, A L, and B Moss. 1996. ―Complementation of a Vaccinia Virus Host-Range
K1L Gene Deletion by the Nonhomologous CP77 Gene.‖ Virology 222 (1): 75–86.
doi:10.1006/viro.1996.0399.
Rathinam, Vijay A K, Zhaozhao Jiang, Stephen N Waggoner, Shruti Sharma, Leah E Cole, Lisa
Waggoner, Sivapriya Kailasan Vanaja, Brian G Monks, Sandhya Ganesan, Eicke Latz, Veit
Hornung, Stefanie N Vogel, Eva Szomolanyi-Tsuda, and Katherine A Fitzgerald. 2010.
―The AIM2 Inflammasome Is Essential for Host Defense against Cytosolic Bacteria and
DNA Viruses.‖ Nature Immunology 11 (5): 395–402. doi:10.1038/ni.1864.
Riedel, Stefan. 2005. ―Edward Jenner and the History of Smallpox and Vaccination.‖
Proceedings (Baylor University. Medical Center).
Ries, Carola H., Michael A. Cannarile, Sabine Hoves, Jörg Benz, Katharina Wartha, Valeria
Runza, Flora Rey-Giraud, et al. 2014. ―Targeting Tumor-Associated Macrophages with
Anti-CSF-1R Antibody Reveals a Strategy for Cancer Therapy.‖ Cancer Cell 25 (6): 846–
59. doi:10.1016/j.ccr.2014.05.016.
Roberts, Kim L., and Geoffrey L. Smith. 2008. ―Vaccinia Virus Morphogenesis and
Dissemination.‖ Trends in Microbiology 16 (10): 472–79. doi:10.1016/j.tim.2008.07.009.
Rodriguez, Ron, Eric R. Schuur, Ho Yeong Lim, Gail A. Henderson, Jonathan W. Simons, and
Daniel R. Henderson. 1997. ―Prostate Attenuated Replication Competent Adenovirus
(ARCA) CN706: A Selective Cytotoxic for Prostate-Specific Antigen-Positive Prostate
Cancer Cells.‖ Cancer Research 57 (13): 2559–63.
Roper, R L, and B Moss. 1999. ―Envelope Formation Is Blocked by Mutation of a Sequence
Related to the HKD Phospholipid Metabolism Motif in the Vaccinia Virus F13L Protein.‖
Journal of Virology 73 (2): 1108–17.
Rosa, Francis A La, Jacqueline W Pierce, and Gail E Sonenshein. 1994. ―Differential
Regulation of the c-Myc Oncogene Promoter by the NF-Kappa B Rel Family of
Transcription Factors.‖ Molecular and Cellular Biology 14 (2): 1039–44.
doi:10.1128/MCB.14.2.1039.
Rothenfusser, S., N. Goutagny, G. DiPerna, M. Gong, B. G. Monks, A. Schoenemeyer, M.
Yamamoto, S. Akira, and K. A. Fitzgerald. 2005. ―The RNA Helicase Lgp2 Inhibits TLR-
Independent Sensing of Viral Replication by Retinoic Acid-Inducible Gene-I.‖ The Journal
of Immunology 175 (8): 5260–68. doi:10.4049/jimmunol.175.8.5260.
149
Rubino, Matthew S., Raafat Z. Abdel-Misih, Joseph J. Bennett, and Nicholas J. Petrelli. 2012.
―Peritoneal Surface Malignancies and Regional Treatment: A Review of the Literature.‖
Surgical Oncology 21 (2). Elsevier Ltd: 87–94. doi:10.1016/j.suronc.2010.12.001.
Russell, Stephen J, Kah-Whye Peng, and John C Bell. 2012. ―Oncolytic Virotherapy.‖ Nature
Biotechnology 30 (7): 658–70. doi:10.1038/nbt.2287.
Sacchi, G, N Di Paolo, F Venezia, A Rossi, G A Nicolai, and G Garosi. 2007. ―Possible Role of
Milky Spots in Mesothelial Transplantation.‖ The International Journal of Artificial
Organs 30 (6). Italy: 520–26.
Sadeghi, B, C Arvieux, O Glehen, A C Beaujard, M Rivoire, J Baulieux, E Fontaumard, A
Brachet, J L Caillot, J L Faure, J Porcheron, J L Peix, Y Francois, J Vignal, and F N Gilly.
2000. ―Peritoneal Carcinomatosis from Non-Gynecologic Malignancies: Results of the
EVOCAPE 1 Multicentric Prospective Study.‖ Cancer 88 (2). UNITED STATES: 358–63.
Salaun, Bruno, Pedro Romero, and Serge Lebecque. 2007. ―Toll-like Receptor‘s Two-Edged
Sword: When Immunity Meets Apoptosis.‖ European Journal of Immunology 37 (12):
3311–18. doi:10.1002/eji.200737744.
Samuel, Charles E. 2001. ―Antiviral Actions of Interferons.‖ Clinical Microbiology Reviews 14
(4): 778–809. doi:10.1128/CMR.14.4.778-809.2001.
Santoro, M Gabriella, Antonio Rossi, and Carla Amici. 2003. ―NF-kappaB and Virus Infection:
Who Controls Whom.‖ The EMBO Journal 22 (11): 2552–60. doi:10.1093/emboj/cdg267.
Schmelz, M, B Sodeik, M Ericsson, E J Wolffe, H Shida, G Hiller, and G Griffiths. 1994.
―Assembly of Vaccinia Virus: The Second Wrapping Cisterna Is Derived from the Trans
Golgi Network.‖ Journal of Virology 68 (1). UNITED STATES: 130–47.
Schmidt, Florian Ingo, Christopher Karl Ernst Bleck, and Jason Mercer. 2012. ―Poxvirus Host
Cell Entry.‖ Current Opinion in Virology 2 (1). Elsevier B.V.: 20–27.
doi:10.1016/j.coviro.2011.11.007.
Schneider, William M, Meike Dittmann Chevillotte, and Charles M Rice. 2014. ―Interferon-
Stimulated Genes: A Complex Web of Host Defenses.‖ Annual Review of Immunology 32:
513–45. doi:10.1146/annurev-immunol-032713-120231.
Schroder, Kate, Paul J Hertzog, Timothy Ravasi, and David A Hume. 2004. ―Interferon- Y : An
Overview of Signals , Mechanisms and Functions.‖ Journal of Leukocyte Biology 75
(February): 163–89. doi:10.1189/jlb.0603252.Journal.
Segerman, A., J. P. Atkinson, M. Marttila, V. Dennerquist, G. Wadell, and N. Arnberg. 2003.
―Adenovirus Type 11 Uses CD46 as a Cellular Receptor.‖ Journal of Virology 77 (17):
9183–91. doi:10.1128/JVI.77.17.9183-9191.2003.
150
Shen, Yuqiao, and John Nemunaitis. 2005. ―Fighting Cancer with Vaccinia Virus: Teaching
New Tricks to an Old Dog.‖ Molecular Therapy 11 (2): 180–95.
doi:10.1016/j.ymthe.2004.10.015.
Sherley, J L, and T J Kelly. 1988. ―Regulation of Human Thymidine Kinase during the Cell
Cycle.‖ The Journal of Biological Chemistry 263 (17): 8350–58.
Shisler, Joanna L, and Xiao-Lu Jin. 2004. ―The Vaccinia Virus K1L Gene Product Inhibits Host
NF-kappaB Activation by Preventing IkappaBalpha Degradation.‖ Journal of Virology 78
(7): 3553–60. doi:10.1128/JVI.78.7.3553.
Shukla, Arti, Mary Gulumian, Tom K Hei, David Kamp, Qamar Rahman, and Brooke T
Mossman. 2003. ―Multiple Roles of Oxidants in the Pathogenesis of Asbestos-Induced
Diseases.‖ Free Radical Biology & Medicine 34 (9). United States: 1117–29.
Siebenlist, Ulrich, Keith Brown, and Estefania Claudio. 2005. ―Control of Lymphocyte
Development by Nuclear Factor-κB.‖ Nature Reviews Immunology 5 (6): 435–45.
doi:10.1038/nri1629.
Silva, Daniela Carla Medeiros, Eduardo Augusto dos Santos Moreira-Silva, Juliana de Assis
Silva Gomes, Flavio Guimaraes da Fonseca, and Rodrigo Correa-Oliveira. 2010. ―Clinical
Signs, Diagnosis, and Case Reports of Vaccinia Virus Infections.‖ The Brazilian Journal of
Infectious Diseases : An Official Publication of the Brazilian Society of Infectious Diseases
14 (2). Brazil: 129–34.
Smale, Stephen T. 2011. ―Hierarchies of NF-κB Target-Gene Regulation.‖ Nature Immunology
12 (8): 689–94. doi:10.1038/ni.2070.
Small, Eric J., Michael A. Carducci, James M. Burke, Ron Rodriguez, Lawrence Fong, Lynn
van Ummersen, D. C. Yu, Junko Aimi, Dale Ando, Peter Working, David Kirn, and
George Wilding. 2006. ―A Phase I Trial of Intravenous CG7870, a Replication-Selective,
Prostate-Specific Antigen-Targeted Oncolytic Adenovirus, for the Treatment of Hormone-
Refractory, Metastatic Prostate Cancer.‖ Molecular Therapy 14 (1): 107–17.
doi:10.1016/j.ymthe.2006.02.011.
Smith, Geoffrey L., Camilla T O Benfield, Carlos Maluquer de Motes, Michela Mazzon, Stuart
W J Ember, Brian J. Ferguson, and Rebecca P. Sumner. 2013. ―Vaccinia Virus Immune
Evasion: Mechanisms, Virulence and Immunogenicity.‖ Journal of General Virology 94
(PART 11): 2367–92. doi:10.1099/vir.0.055921-0.
Smith, Geoffrey L., Alain Vanderplasschen, and Mansun Law. 2002. ―The Formation and
Function of Extracellular Enveloped Vaccinia Virus.‖ Journal of General Virology 83 (12):
2915–31. doi:10.1099/0022-1317-83-12-2915.
151
Sovak, M A, R E Bellas, D W Kim, G J Zanieski, A E Rogers, A M Traish, and G E
Sonenshein. 1997. ―Aberrant Nuclear Factor-kappaB/Rel Expression and the Pathogenesis
of Breast Cancer.‖ Journal of Clinical Investigation 100 (12): 2952–60.
doi:10.1172/JCI119848.
Stack, Julianne, Ismar R Haga, Martina Schröder, Nathan W Bartlett, Geraldine Maloney,
Patrick C Reading, Katherine a Fitzgerald, Geoffrey L Smith, and Andrew G Bowie. 2005.
―Vaccinia Virus Protein A46R Targets Multiple Toll-like-Interleukin-1 Receptor Adaptors
and Contributes to Virulence.‖ The Journal of Experimental Medicine 201 (6): 1007–18.
doi:10.1084/jem.20041442.
Staudt, L. M. 2010. ―Oncogenic Activation of NF- B.‖ Cold Spring Harbor Perspectives in
Biology 2 (6): a000109–a000109. doi:10.1101/cshperspect.a000109.
Sticca, Robert P, and Brian W Dach. 2003. ―Rationale for Hyperthermia with Intraoperative
Intraperitoneal Chemotherapy Agents.‖ Surgical Oncology Clinics of North America 12
(3). United States: 689–701.
Stojdl, David F., Brian D. Lichty, Benjamin R. TenOever, Jennifer M. Paterson, Anthony T.
Power, Shane Knowles, Ricardo Marius, Jennifer Reynard, Laurent Poliquin, Harold
Atkins, Earl G. Brown, Russell K. Durbin, Joan E. Durbin, John Hiscott, and John C. Bell.
2003. ―VSV Strains with Defects in Their Ability to Shutdown Innate Immunity Are Potent
Systemic Anti-Cancer Agents.‖ Cancer Cell 4 (4): 263–75. doi:10.1016/S1535-
6108(03)00241-1.
Stollfuss, J, N Landvogt, M Abenstein, S Ziegler, M Schwaiger, R Senekowitsch-Schmidtke,
and H Wieder. 2015. ―Non-Invasive Imaging of Implanted Peritoneal Carcinomatosis in
Mice Using PET and Bioluminescence Imaging.‖ EJNMMI Research. Berlin/Heidelberg.
doi:10.1186/s13550-015-0125-z.
Stroobant, Paul, Andrew R Rice, William J Gullick, Dorothy J Cheng, M Kerr, and Michael D
Waterfield. 1985. ―Purification and Characterization of Vaccinia Virus Growth Factor‖ 42
(August): 383–93.
Sugarbaker, P H. 1995. ―Peritonectomy Procedures.‖ Annals of Surgery 221 (1). UNITED
STATES: 29–42.
Sun, J., F. Wiklund, S. L. Zheng, B. Chang, K. Balter, L. Li, J.-E. Johansson, G. Li, H.-O.
Adami, W. Liu, A. Tolin, A. R. Turner, D. A. Meyers, W. B. Isaacs, J. Xu, and H.
Gronberg. 2005. ―Sequence Variants in Toll-Like Receptor Gene Cluster (TLR6-TLR1-
TLR10) and Prostate Cancer Risk.‖ JNCI Journal of the National Cancer Institute 97 (7):
525–32. doi:10.1093/jnci/dji070.
152
Takaoka, A, Z Wang, M K Choi, H Yanai, H Negishi, T Ban, Y Lu, M Miyagishi, T Kodama, K
Honda, Y Ohba, and T Taniguchi. 2007. ―DAI (DLM-1/ZBP1) Is a Cytosolic DNA Sensor
and an Activator of Innate Immune Response.‖ Nature 448 (7152): 501–5.
doi:10.1038/nature06013.
Tan, Rebecca S T, Bow Ho, Bernard P Leung, and Jeak L Ding. 2014. ―TLR Cross-Talk
Confers Specificity to Innate Immunity.‖ International Reviews of Immunology 33 (6):
443–53. doi:10.3109/08830185.2014.921164.
Tatsuo, Hironobu, Nobuyuki Ono, Kotaro Tanaka, and Yusuke Yanagi. 2000. ―SLAM
(CDw150) Is a Cellular Receptor for Measles Viruse.‖ Nature 406 (6798): 893–97.
doi:10.1038/35022579.
Teijaro, John R. 2016. ―Type I Interferons in Viral Control and Immune Regulation.‖ Current
Opinion in Virology 16. Elsevier B.V.: 31–40. doi:10.1016/j.coviro.2016.01.001.
Terawaki, S., S. Chikuma, S. Shibayama, T. Hayashi, T. Yoshida, T. Okazaki, and T. Honjo.
2011. ―IFN-Alpha Directly Promotes Programmed Cell Death-1 Transcription and Limits
the Duration of T Cell-Mediated Immunity.‖ The Journal of Immunology 186 (5): 2772–79.
doi:10.4049/jimmunol.1003208.
Terzi, Cem, Naciye Cigdem Arslan, and Aras Emre Canda. 2014. ―Peritoneal Carcinomatosis of
Gastrointestinal Tumors: Where Are We Now?‖ World Journal of Gastroenterology 20
(39): 14371. doi:10.3748/wjg.v20.i39.14371.
Thomas, Christoph, Ignacio Moraga, Doron Levin, Peter O. Krutzik, Yulia Podoplelova,
Angelica Trejo, Choongho Lee, Ganit Yarden, Susan E. Vleck, Jeffrey S. Glenn, Garry P.
Nolan, Jacob Piehler, Gideon Schreiber, and K. Christopher Garcia. 2011. ―Structural
Linkage between Ligand Discrimination and Receptor Activation by Type I Interferons.‖
Cell 146 (4): 621–32. doi:10.1016/j.cell.2011.06.048.
Thorne, S. H. 2006. ―Synergistic Antitumor Effects of Immune Cell-Viral Biotherapy.‖ Science
311 (5768): 1780–84. doi:10.1126/science.1121411.
Thorne, Steve H., Tae Ho H Hwang, William E. O‘Gorman, David L. Bartlett, Shizuko Sei,
Femina Kanji, Christopher Brown, Joel Werier, Jin Han Cho, Dong Ewon Lee, Yaohe
Wang, John Bell, and David H. Kirn. 2007. ―Rational Strain Selection and Engineering
Creates a Broad-Spectrum, Systemically Effective Oncolytic Poxvirus, JX-963.‖ Journal of
Clinical Investigation 117 (11): 3350–58. doi:10.1172/JCI32727.
Tong, Jessica G, Yudith Ramos Valdes, John W Barrett, John C Bell, David Stojdl, Grant
McFadden, J Andrea McCart, Gabriel E DiMattia, and Trevor G Shepherd. 2015.
―Evidence for Differential Viral Oncolytic Efficacy in an in Vitro Model of Epithelial
Ovarian Cancer Metastasis.‖ Molecular Therapy — Oncolytics 2 (April): 15013.
doi:10.1038/mto.2015.13.
153
Tooze, J, M Hollinshead, B Reis, K Radsak, and H Kern. 1993. ―Progeny Vaccinia and Human
Cytomegalovirus Particles Utilize Early Endosomal Cisternae for Their Envelopes.‖
European Journal of Cell Biology 60 (1). GERMANY: 163–78.
Topolcan, Ondrej, and Lubos Holubec. 2008. ―The Role of Thymidine Kinase in Cancer
Diseases.‖ Expert Opinion on Medical Diagnostics 2 (2): 129–41.
doi:10.1517/17530059.2.2.129.
Townsley, Alan C, Andrea S Weisberg, Timothy R Wagenaar, and Bernard Moss. 2006.
―Vaccinia Virus Entry into Cells via a Low-pH-Dependent Endosomal Pathway.‖ Journal
of Virology 80 (18): 8899–8908. doi:10.1128/JVI.01053-06.
Toyokuni, Shinya. 2009. ―Mechanisms of Asbestos-Induced Carcinogenesis.‖ Nagoya Journal
of Medical Science 71 (1-2). Japan: 1–10.
Ueda, Yukiko, and Ann Richmond. 2006. ―NF-kappaB Activation in Melanoma.‖ Pigment Cell
Research 19 (2): 112–24. doi:10.1111/j.1600-0749.2006.00304.x.
Unterholzner, Leonie, Sinead E Keating, Marcin Baran, Kristy A Horan, Søren B Jensen, Shruti
Sharma, Cherilyn M Sirois, Tengchuan Jin, Eicke Latz, T Sam Xiao, Katherine A
Fitzgerald, Søren R Paludan, and Andrew G Bowie. 2010. ―IFI16 Is an Innate Immune
Sensor for Intracellular DNA.‖ Nature Immunology 11 (11): 997–1004.
doi:10.1038/ni.1932.
Vanderplasschen, a, E Mathew, M Hollinshead, R B Sim, and G L Smith. 1998. ―Extracellular
Enveloped Vaccinia Virus Is Resistant to Complement because of Incorporation of Host
Complement Control Proteins into Its Envelope.‖ Proceedings of the National Academy of
Sciences of the United States of America 95 (June): 7544–49. doi:10.1073/pnas.95.13.7544.
Verheije, M. H., and P. J M Rottier. 2012. ―Retargeting of Viruses to Generate Oncolytic
Agents.‖ Advances in Virology 2012. doi:10.1155/2012/798526.
Verwaal, V. J. 2003. ―Randomized Trial of Cytoreduction and Hyperthermic Intraperitoneal
Chemotherapy Versus Systemic Chemotherapy and Palliative Surgery in Patients With
Peritoneal Carcinomatosis of Colorectal Cancer.‖ Journal of Clinical Oncology 21 (20):
3737–43. doi:10.1200/JCO.2003.04.187.
Verwaal, Vic J., Sjoerd Bruin, Henk Boot, Gooike van Slooten, and Harm van Tinteren. 2008.
―8-Year Follow-up of Randomized Trial: Cytoreduction and Hyperthermic Intraperitoneal
Chemotherapy Versus Systemic Chemotherapy in Patients with Peritoneal Carcinomatosis
of Colorectal Cancer.‖ Annals of Surgical Oncology 15 (9): 2426–32. doi:10.1245/s10434-
008-9966-2.
Wack, Andreas, Ewa Terczyńska-Dyla, and Rune Hartmann. 2015. ―Guarding the Frontiers:
The Biology of Type III Interferons.‖ Nature Immunology 16 (8): 802–9.
doi:10.1038/ni.3212.
154
Wakamatsu, Nobuko, Daniel J. King, Bruce S. Seal, Siba K. Samal, and Corrie C. Brown. 2006.
―The Pathogenesis of Newcastle Disease: A Comparison of Selected Newcastle Disease
Virus Wild-Type Strains and Their Infectious Clones.‖ Virology 353 (2): 333–43.
doi:10.1016/j.virol.2006.06.013.
Wang, James Q., Yogesh S. Jeelall, Laura L. Ferguson, and Keisuke Horikawa. 2014. ―Toll-
Like Receptors and Cancer: MYD88 Mutation and Inflammation.‖ Frontiers in
Immunology 5 (JUL): 1–10. doi:10.3389/fimmu.2014.00367.
Wein, Lawrence M, Joseph T Wu, and David H Kirn. 2003. ―Validation and Analysis of a
Mathematical Model of a Replication-Competent Oncolytic Virus for Cancer Treatment :
Implications for Virus Design and Delivery Validation and Analysis of a Mathematical
Model of a Replication-Competent Oncolytic Virus for Can,‖ 1317–24.
Whilding, Lynsey M, Kyra M Archibald, Hagen Kulbe, Frances R Balkwill, Daniel Öberg, and
Iain A McNeish. 2013. ―Vaccinia Virus Induces Programmed Necrosis in Ovarian Cancer
Cells.‖ Molecular Therapy : The Journal of the American Society of Gene Therapy 21 (11):
2074–86. doi:10.1038/mt.2013.195.
Whitbeck, J Charles, Chwan-Hong Foo, Manuel Ponce de Leon, Roselyn J Eisenberg, and Gary
H Cohen. 2009. ―Vaccinia Virus Exhibits Cell-Type-Dependent Entry Characteristics.‖
Virology 385 (2). Elsevier Inc.: 383–91. doi:10.1016/j.virol.2008.12.029.
White, C L, K R Twigger, L Vidal, J S De Bono, M Coffey, L Heinemann, R Morgan, A
Merrick, F Errington, R G Vile, Alan A Melcher, H S Pandha, and K J Harrington. 2008.
―Characterization of the Adaptive and Innate Immune Response to Intravenous Oncolytic
Reovirus (Dearing Type 3) during a Phase I Clinical Trial.‖ Gene Therapy 15 (12): 911–20.
doi:10.1038/gt.2008.21.
Willis, Kristen L., Samir Patel, Yan Xiang, and Joanna L. Shisler. 2009. ―The Effect of the
Vaccinia K1 Protein on the PKR-eIF2α Pathway in RK13 and HeLa Cells.‖ Virology 394
(1): 73–81. doi:10.1016/j.virol.2009.08.020.
Workenhe, Samuel T, and Karen L Mossman. 2014. ―Oncolytic Virotherapy and Immunogenic
Cancer Cell Death: Sharpening the Sword for Improved Cancer Treatment Strategies.‖
Molecular Therapy : The Journal of the American Society of Gene Therapy 22 (2): 251–56.
doi:10.1038/mt.2013.220.
Wu, Jiaxi, and Zhijian J. Chen. 2014. ―Innate Immune Sensing and Signaling of Cytosolic
Nucleic Acids.‖ Annual Review of Immunology 32 (1): 461–88. doi:10.1146/annurev-
immunol-032713-120156.
Xagorari, Angeliki, and Katerina Chlichlia. 2008. ―Toll-like Receptors and Viruses: Induction
of Innate Antiviral Immune Responses.‖ The Open Microbiology Journal 2: 49–59.
doi:10.2174/1874285800802010049.
155
Xia, Zhong-Jun, Jian-Hua Chang, Li Zhang, Wen-Qi Jiang, Zhong-Zhen Guan, Ji-Wei Liu,
Yang Zhang, Xiao-Hua Hu, Guo-Hua Wu, Hua-Qing Wang, Zheng-Chang Chen, Jian-
Chao Chen, Qing-Hua Zhou, Jian-Wei Lu, Qing-Xia Fan, Jian-Jin Huang, and Xiao Zheng.
2004. ―Phase III randomized clinical trial of intratumoral injection of E1B gene-deleted
adenovirus (H101) combined with cisplatin-based chemotherapy in treating squamous cell
cancer of head and neck or esophagus.‖ Ai zheng = Aizheng = Chinese journal of cancer
23 (12). China: 1666–70.
Yim, Howard CH, Die Wang, Liang Yu, Christine L White, Pieter W Faber, Bryan RG
Williams, and Anthony J Sadler. 2016. ―The Kinase Activity of PKR Represses
Inflammasome Activity.‖ Cell Research 26 (3): 367–79. doi:10.1038/cr.2016.11.
Yoon, Cheol-Hee, Eun-Soo Lee, Dae-Seog Lim, and Yong-Soo Bae. 2009. ―PKR, a p53 Target
Gene, Plays a Crucial Role in the Tumor-Suppressor Function of p53.‖ Proceedings of the
National Academy of Sciences of the United States of America 106 (19): 7852–57.
doi:10.1073/pnas.0812148106.
Zamanian-Daryoush, Maryam, Trine H Mogensen, Joseph A DiDonato, and Bryan R G
Williams. 2000. ―NF-κB Activation by Double-Stranded-RNA-Activated Protein Kinase
(PKR) Is Mediated through NF-κB-Inducing Kinase and IκB Kinase.‖ Molecular and
Cellular Biology.
Zeh, Herbert J, Stephanie Downs-Canner, J Andrea McCart, Zong Sheng Guo, Uma N M Rao,
Lekshmi Ramalingam, Stephen H Thorne, et al. 2015. ―First-in-Man Study of Western
Reserve Strain Oncolytic Vaccinia Virus: Safety, Systemic Spread, and Antitumor
Activity.‖ Molecular Therapy 23 (1): 202–14. doi:10.1038/mt.2014.194.
Zhang, Zhouning, Abrahams, Melissa Rose, Lawrence A. Hunt, Jill Suttles, William Marshall,
Demonoy K. Lahiri, and Girish J Kotwal. 2005. ―The Vaccinia Virus N1L Protein
Influences Cytokine Secretion in Vitro after Infection.‖ Annals of the New York Academy
of Sciences 1056 (1): 69–86. doi:10.1196/annals.1352.005.
Zhang, Jane, Nagarajan Ramesh, Yu Chen, Yuanhao Li, Jeanette Dilley, Peter Working, and De
Chao Yu. 2002. ―Identification of Human Uroplakin II Promoter and Its Use in the
Construction of CG8840, a Urothelium-Specific Adenovirus Variant That Eliminates
Established Bladder Tumors in Combination with Docetaxel.‖ Cancer Research 62 (13):
3743–50.
Zhang, Y., and J. M. Bergelson. 2005. ―Adenovirus Receptors.‖ Journal of Virology 79 (19):
12125–31. doi:10.1128/JVI.79.19.12125-12131.2005.
Zhou, Mingfu, Molly M. McFarland-Mancini, Holly M. Funk, Nader Husseinzadeh, Taofic
Mounajjed, and Angela F. Drew. 2009. ―Toll-like Receptor Expression in Normal Ovary
and Ovarian Tumors.‖ Cancer Immunology, Immunotherapy 58 (9): 1375–85.
doi:10.1007/s00262-008-0650-y.
156
Zhu, Jiangao, Jennifer Martinez, Xiaopei Huang, and Yiping Yang. 2007. ―Innate Immunity
against Vaccinia Virus Is Mediated by TLR2 and Requires TLR-Independent Production of
IFN-.‖ Blood 109 (2): 619–25. doi:10.1182/blood-2006-06-027136.
Zitvogel, Laurence, Lorenzo Galluzzi, Oliver Kepp, Mark J Smyth, and Guido Kroemer. 2015.
―Type I Interferons in Anticancer Immunity.‖ Nature Reviews. Immunology 15 (7). Nature
Publishing Group: 405–14. doi:10.1038/nri3845.